ID: 1165825762

View in Genome Browser
Species Human (GRCh38)
Location 19:38704924-38704946
Sequence CTGTGTGCAGAGATTGTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165825752_1165825762 0 Left 1165825752 19:38704901-38704923 CCTTCTGCCCTCTGCCCCCTTCC 0: 1
1: 2
2: 38
3: 385
4: 2352
Right 1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG 0: 1
1: 0
2: 2
3: 33
4: 350
1165825753_1165825762 -7 Left 1165825753 19:38704908-38704930 CCCTCTGCCCCCTTCCCTGTGTG 0: 1
1: 0
2: 5
3: 67
4: 684
Right 1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG 0: 1
1: 0
2: 2
3: 33
4: 350
1165825754_1165825762 -8 Left 1165825754 19:38704909-38704931 CCTCTGCCCCCTTCCCTGTGTGC 0: 1
1: 0
2: 5
3: 105
4: 884
Right 1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG 0: 1
1: 0
2: 2
3: 33
4: 350
1165825751_1165825762 20 Left 1165825751 19:38704881-38704903 CCTCACTCTGGTTTTAACGACCT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG 0: 1
1: 0
2: 2
3: 33
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165825762 Original CRISPR CTGTGTGCAGAGATTGTGGA CGG Exonic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902517672 1:16998136-16998158 ATGTGTGGACAGTTTGTGGAGGG + Intronic
902785571 1:18730757-18730779 CGGTGAGCAGAGGCTGTGGAAGG + Intronic
902917358 1:19646648-19646670 CTGGGTGCAGAGGGTGTGGAGGG - Intronic
903847280 1:26285823-26285845 CTGTGTGGAGGGATCGTAGAAGG + Exonic
904958396 1:34308684-34308706 CTGTGTGCTCAGAGTGTGGTTGG - Intergenic
905034865 1:34911462-34911484 CTGTGTCCTGGGATAGTGGATGG - Intronic
905071158 1:35226538-35226560 TTTTGTGTAGAGATTGGGGAGGG + Intergenic
905837838 1:41143750-41143772 CTGGGTGCAGAGGTCCTGGAGGG - Intronic
907819921 1:57957137-57957159 ATGTGTGAAGAGATTGTACAGGG + Intronic
908009110 1:59757584-59757606 CTGTGTCCAGATAGTGAGGAGGG + Intronic
908388904 1:63667921-63667943 CTGTGTCCTGACATGGTGGAAGG + Intergenic
909652510 1:77991574-77991596 GTGTGTGTAGAGATGGTGGGAGG - Intronic
909714387 1:78690427-78690449 CTTTATGCAGATATTGTGCAGGG - Intergenic
911202885 1:95064031-95064053 CTTTTTGCAGTGATTGTGAATGG + Intronic
911561563 1:99412294-99412316 CTCTTTGCAGTGATTGTGAATGG + Intergenic
912224016 1:107711311-107711333 CCGAGTGCAAAGATTTTGGAGGG + Intronic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917804121 1:178598175-178598197 CTGGGTGCAGAGGGTGTGGCTGG - Intergenic
918894890 1:190329421-190329443 GTGTGTGCAGATATTGTAAATGG - Intronic
919409112 1:197221952-197221974 CTGTGAGCAAAGATTTTGGTTGG - Intergenic
919493555 1:198236028-198236050 CTCTGTGGAGTGACTGTGGAGGG + Intronic
919980223 1:202638258-202638280 CTGTGTCCTGAGACTGGGGAGGG - Intronic
920064953 1:203262342-203262364 CTCTTTGCAGCGATTGTGAATGG - Intronic
920084044 1:203401492-203401514 CTGTGTATAGAGAGTGCGGAAGG + Intergenic
920206630 1:204296866-204296888 GTGTCTGCAGAGAGCGTGGACGG + Intronic
920762043 1:208793790-208793812 TTGTCTGCAGGGAGTGTGGAAGG - Intergenic
921008824 1:211120923-211120945 CAGTTTGCAGTGATTGTGAATGG - Intronic
922205611 1:223443523-223443545 CTGTGGGCAGAGGGTATGGATGG + Intergenic
923146082 1:231199201-231199223 CTGGGTGCAGAGGATGTGGCAGG - Intronic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1064560333 10:16589365-16589387 TTGTGTGCAGAGTCTGTAGAAGG + Intergenic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1065129902 10:22610010-22610032 CTGTGGGATGAGGTTGTGGAGGG - Intronic
1065710577 10:28513213-28513235 CTGTGAGAAGATATGGTGGAAGG - Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066327893 10:34383799-34383821 CTGTGTGCAGCAAAGGTGGACGG + Intronic
1066699283 10:38109733-38109755 CTGTTTGTAGAAATTGTGAATGG - Intronic
1070826528 10:79393552-79393574 TTGTGTGCAGAGATTGAGTGTGG - Intronic
1071093261 10:81945043-81945065 CTCTCTGCAGAGGATGTGGAAGG - Intronic
1071598979 10:86947103-86947125 CTGGGTGCAGAGATGATGGGAGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1075615096 10:123884996-123885018 GTGTGTGCAGACACTGTGCAGGG + Intronic
1076211068 10:128645398-128645420 CTGTGTCCACAAATGGTGGAAGG + Intergenic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076649266 10:131976621-131976643 CTGGTTGCAGAGAGTGTGGTTGG - Intronic
1076692125 10:132229227-132229249 CAGAGAGCAGAGGTTGTGGAAGG - Intronic
1076819235 10:132930533-132930555 CTGTGTGCGGAGTGTGGGGAAGG - Intronic
1077442434 11:2574933-2574955 CTGCCTGCAGTGAGTGTGGATGG + Intronic
1084057581 11:66646280-66646302 TTGTGTGCAGAAACTGTGGTGGG + Exonic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1085250880 11:75143021-75143043 GTGTGTGCACAGAATGTGGGGGG + Intronic
1085889870 11:80565847-80565869 CTGTGTGAATAGATTGTAGCAGG - Intergenic
1086187461 11:84035722-84035744 TTGTGTGAAGAGACTGTAGAGGG + Intronic
1088695360 11:112361709-112361731 CAGTGTGCAGAGAGTGTGGTGGG + Intergenic
1088823944 11:113477993-113478015 CTGTGTTCACACATGGTGGAAGG + Intergenic
1089269925 11:117295088-117295110 CAGTGTGCATAGAGTGTGTAGGG + Intronic
1089283872 11:117393277-117393299 CTGTGGTCAGGGATTGTGGGAGG + Intronic
1089785226 11:120902814-120902836 GTGTGTGGAGAGTTTGTGCAGGG + Intronic
1090058014 11:123439846-123439868 CTCTGTGGTCAGATTGTGGAGGG - Intergenic
1090651892 11:128814256-128814278 CTGTGTGCTGATATGGTGTAAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090996973 11:131875647-131875669 CTGTGTACAGAAACTGTTGAAGG - Intronic
1091088405 11:132746068-132746090 CTTTGTGAAGAGCTTGGGGAGGG - Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1092686419 12:11053110-11053132 CTTTGAGCAGAGTTTGTGGTGGG - Intronic
1093055755 12:14554193-14554215 ATGAGTGCAGGGATTGTGTAGGG - Intronic
1093497729 12:19776993-19777015 CTGTGGTCTGAGATTGTGGTTGG + Intergenic
1093812964 12:23510227-23510249 CTGTGAGCAGAGACTAGGGAGGG + Intergenic
1094788016 12:33873753-33873775 ATGTGTGGAGAGGTTATGGAGGG + Intergenic
1096375693 12:51108352-51108374 CTCTGGGAAGAGGTTGTGGAGGG + Intronic
1096459994 12:51816974-51816996 CTGTGTGCAGACATTGGGCCTGG - Intergenic
1099228869 12:80000400-80000422 CTGTATGGGGGGATTGTGGATGG - Intergenic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1101059371 12:100954989-100955011 CTGTGGGCAGTTATGGTGGAAGG - Intronic
1102797891 12:115704858-115704880 CTGTGTGCAGGCATTGTGTTGGG - Intergenic
1104049368 12:125185851-125185873 CTGTGTGCAGAGCCTCTGCACGG - Intergenic
1104484673 12:129140412-129140434 CTGTGGTCAGGGATTGGGGAGGG - Intronic
1104586377 12:130051175-130051197 GTGTGTGCAGAGACTGTGCTGGG + Intergenic
1107926553 13:45268710-45268732 CTGTTTTCAGAGTTTCTGGAAGG - Intronic
1109233523 13:59787908-59787930 CTGTGTCCTCACATTGTGGAAGG - Intronic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1109920553 13:69052354-69052376 CTGTTTGAAGAAATTGTGAATGG - Intergenic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1111797776 13:92945322-92945344 CTGGGAGCATGGATTGTGGATGG + Intergenic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1113507351 13:110826373-110826395 CTGTGTCCAGTGATGCTGGATGG + Intergenic
1113507483 13:110827161-110827183 CTGTGTCCAATGATTATGGACGG + Intergenic
1113573945 13:111381725-111381747 GGGTCTGCAGAGATGGTGGAGGG + Intergenic
1113573961 13:111381782-111381804 GGGTCTGCAGAGATGGTGGAGGG + Intergenic
1113573976 13:111381840-111381862 GGGTCTGCAGAGATGGTGGAGGG + Intergenic
1113743256 13:112725353-112725375 CTGAGAGCAGAGAGAGTGGAGGG - Intronic
1113756741 13:112817577-112817599 CTGGCTGCAGAGAGTGTGAAGGG - Intronic
1113830624 13:113292746-113292768 TTGAGTGCAGAGCTTGAGGATGG - Intergenic
1115465486 14:33709896-33709918 CTGTGTGCACAGTGTGTGGGAGG - Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116091996 14:40320927-40320949 CTCTTTGCAGTAATTGTGGATGG - Intergenic
1118386714 14:65261785-65261807 CTGTGTCCTCACATTGTGGAAGG + Intergenic
1118958510 14:70505672-70505694 CTGTTTGAAGAAATTGTGAATGG - Intergenic
1120752461 14:88210583-88210605 CTGTGCGCAGAGCTGGTGGGAGG - Intronic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1123448962 15:20348775-20348797 CTGTTTGCAGAGATTTTTGTTGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1124188197 15:27548329-27548351 CTGTGTCCAGCCATTGGGGAAGG + Intergenic
1124495835 15:30186305-30186327 CTGTGTCCTGAGATTGGGGAGGG - Intergenic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1124747739 15:32352342-32352364 CTGTGTCCTGAGATTGGGGAGGG + Intergenic
1125186346 15:36935272-36935294 CTGTATGCAGAAGTTGGGGAGGG - Intronic
1125758411 15:42081436-42081458 GTGTGTGCAGATATCCTGGACGG - Intronic
1125987892 15:44073271-44073293 TTGTGTGCAGAGTGTCTGGAAGG - Intronic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1129757578 15:78107762-78107784 ATGTGGGCATAGTTTGTGGAGGG + Intronic
1129978348 15:79843099-79843121 CTTTGTGCAGGGATATTGGAAGG - Intronic
1130904404 15:88229672-88229694 CTGTGTGCAGAGAGTGACCAGGG - Intronic
1133685503 16:8161993-8162015 CTGTGTGTAGAGATTGCTGTTGG - Intergenic
1134104772 16:11477667-11477689 CTGTGTGCAGAGATGCTGGGTGG - Intronic
1134351898 16:13445285-13445307 CTTTGTGCTGAGATTGTGTTAGG - Intergenic
1134666940 16:16025520-16025542 CTGGGTGCAGGGGTTGTGGGGGG + Intronic
1135550703 16:23396126-23396148 CTGTGTGCAGAGACAGTGCCAGG - Intronic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1137859976 16:51836835-51836857 GAGTGTGCAGAGATTGGGGGTGG + Intergenic
1138122006 16:54407965-54407987 CTATGGGAAGAGAATGTGGATGG - Intergenic
1140865841 16:79061402-79061424 ATGTGTGCAGTGAGTGTGGGAGG + Intronic
1141272804 16:82556260-82556282 CAGTGTCCTGAGATTGTGGAGGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1144180191 17:12744464-12744486 CTGTGGGCAGAGGTTGGGAAGGG + Intronic
1144328075 17:14200764-14200786 ATGTGTACAAAGATTGTGCAGGG + Intronic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145353482 17:22112447-22112469 CTGTGTTCCGAGAATGTGGTTGG + Intergenic
1146566498 17:33917430-33917452 CTGGGTGCAAAGAATGTGAAGGG - Intronic
1147650736 17:42060450-42060472 GTGTGTGCAGGGAGTGTGCAGGG - Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1151107314 17:71631368-71631390 GTGTAGGCAGAGTTTGTGGATGG - Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151354921 17:73552702-73552724 CTGACTGCAGAGCTTGAGGACGG + Intronic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1152339689 17:79717089-79717111 CTGTTTGCAGAGATTTTTGTTGG - Intergenic
1153125798 18:1788879-1788901 CTCTTTGTAGAGATTGTGAATGG - Intergenic
1153824401 18:8862316-8862338 CTGGGTGGAGAGAGTATGGAGGG - Intergenic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1155466058 18:26136557-26136579 AAGTGTGCAGAGATTGTTAAAGG - Intronic
1156359562 18:36372409-36372431 CTTTGTGCAGACTCTGTGGATGG + Intronic
1156377468 18:36527871-36527893 CAGTGAGCTGAGATGGTGGAGGG - Intronic
1159564528 18:70033367-70033389 CTGTGGTCTGAGAGTGTGGATGG - Intronic
1159928239 18:74288254-74288276 GTGTGTGGTGAGATGGTGGAGGG - Intronic
1161868768 19:6854288-6854310 CTGTGTGCAGACATTGTGCTGGG + Intronic
1163429100 19:17256350-17256372 CTGAGTGCAGGCATTGTGAAGGG - Intronic
1163642147 19:18467898-18467920 GTGTGTGGGGAGATTGTGTATGG - Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1165735696 19:38174071-38174093 CTGTGTGCTGAGGCTGGGGAAGG + Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166698125 19:44865829-44865851 CTGTGTGCTGAGGATGTGGCAGG + Intronic
1166705089 19:44904033-44904055 CTGAGTGCAGAGATGGGGGCAGG + Intergenic
1167061527 19:47150668-47150690 TTATGTGCAAAGATTCTGGAAGG - Intronic
1167476812 19:49706147-49706169 CAGTGTCCTGAGACTGTGGAAGG + Intronic
1168550751 19:57291296-57291318 TTGTGTGCAGTGAATGTGGAAGG + Exonic
925317191 2:2935588-2935610 CTGTGTGCAGAGGCCTTGGATGG - Intergenic
926741655 2:16116261-16116283 CTGTGTGGAGAAATTTTGCAAGG + Intergenic
927050513 2:19323638-19323660 CTGTGTCCTCACATTGTGGAAGG + Intergenic
927934606 2:27069265-27069287 CTGTGTAGAAAGATAGTGGAGGG - Intronic
928546065 2:32330303-32330325 CTGTGTGCATAGATTGTCAGTGG - Intergenic
928606819 2:32950671-32950693 CAGTGAGCAGAGATTGTGCTGGG + Intronic
928755454 2:34519278-34519300 CTGTGTCCTTATATTGTGGAAGG + Intergenic
928804000 2:35128568-35128590 CTGTTTGTAGTGATTGTGAATGG - Intergenic
929033433 2:37670374-37670396 CTGTGTGCTGAGGTTGTAGGGGG - Intronic
929531930 2:42758129-42758151 CTGGGTGCAGAGATTGCTGGAGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932560303 2:72862208-72862230 ATGTCTGCAAAGTTTGTGGAAGG - Intergenic
933226249 2:79752672-79752694 CTATGTGCAGACATTGTGTCAGG - Intronic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
935279977 2:101508535-101508557 CTCAGTGCAGAGAGTGTGGGAGG + Intergenic
935537221 2:104308645-104308667 CTGTATGCAAACATTGTGGGGGG - Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
935679076 2:105620455-105620477 CTGGGGGCAGAGCTTGTGGCAGG - Intergenic
935809654 2:106785194-106785216 CTGTGTCCTCACATTGTGGAAGG + Intergenic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
939044226 2:137231123-137231145 CTGTGTGCTGAGCGAGTGGACGG + Exonic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940021097 2:149156556-149156578 CTGTCTGCATAGCCTGTGGATGG + Intronic
940272929 2:151911053-151911075 CTCTTTGCAGTGATTGTGAATGG + Intronic
940378569 2:152986963-152986985 CTGTGTCCAAAGGTGGTGGAGGG - Intergenic
940560710 2:155292232-155292254 CTCTTTGCAGCGATTGTGAATGG + Intergenic
942140974 2:172977374-172977396 CTTTGTTCAGTGATTGTGGTGGG + Intronic
943369993 2:187003670-187003692 CTGTGTGTAAAGACTGTGGAAGG - Intergenic
943670933 2:190659578-190659600 CTGTGTGCAGAGCTTGGGACAGG + Exonic
944686030 2:202118703-202118725 CAGTGTTGAGAGATTGTAGAAGG + Intronic
944843571 2:203646506-203646528 CTCTGTGCAGGGCTTGTGGCTGG + Intergenic
945442731 2:209899637-209899659 GTGTGTGTAGAGGGTGTGGAAGG - Intronic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946187602 2:217989866-217989888 CTGTGTGGAGGGTTTGTGGCAGG - Intronic
946295837 2:218782696-218782718 CAGTGAGCAGAGGTTGAGGAGGG + Intronic
947447322 2:230173947-230173969 CTGCCTGCAAAGATTGTGTATGG - Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948271797 2:236679829-236679851 CTGTGGTCAAAGAATGTGGATGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169039576 20:2482038-2482060 CTGTGGGCAGGGCTTGTGGGTGG - Exonic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1169968245 20:11240807-11240829 CTGTGTGAGGAGGTTGTGCAGGG - Intergenic
1171231733 20:23492452-23492474 CTGTGTGCTGAGCTGGTGGGAGG + Intronic
1171563738 20:26156647-26156669 CTGTGTTCTGAGAATGTGGTTGG + Intergenic
1172786014 20:37469428-37469450 CTGTGAGCAGAGAGTTTGGATGG - Intergenic
1173049215 20:39542915-39542937 GTGTGAGCAGAAATTGTGGAAGG - Intergenic
1173180571 20:40803617-40803639 CTGTGTCCTGACATGGTGGAAGG + Intergenic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1173561110 20:44006321-44006343 CTGTGTGCAGAGCCTCTGGTGGG + Intronic
1173893016 20:46528006-46528028 CTGTGTGCAGTGTATGTGCAGGG + Intergenic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175564481 20:59962210-59962232 CTCTGTGCAGAGAATGTGTTAGG + Intronic
1175961200 20:62637288-62637310 CTGTGTGCAGAGATCCCTGATGG - Intergenic
1176249784 20:64114997-64115019 CTCTGTCCAGGGCTTGTGGATGG + Intergenic
1177878532 21:26665309-26665331 CTCTTTGAAGAGATTGTGAATGG + Intergenic
1179825919 21:43966450-43966472 CTGTGGGCAGAGGCAGTGGACGG - Intronic
1182145341 22:27993781-27993803 CTGTCTGCGGAGAGTGTGGAAGG - Intronic
1183499850 22:38172361-38172383 CTGTGAGCCAAGCTTGTGGACGG - Intronic
1184776965 22:46628100-46628122 CTGTGTGCTGAGCATGTGGTGGG + Intronic
1184858411 22:47159204-47159226 CTGTGTGCATACATGGTGTATGG - Intronic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
950955058 3:17044160-17044182 CTGTGTGCAGAGAATGTCCATGG + Intronic
951082089 3:18464587-18464609 CTGTTAGAAGAGAGTGTGGAAGG - Intergenic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953669554 3:44951295-44951317 CTCTGTGCAGAGAATGTGGAAGG - Intronic
953784385 3:45899705-45899727 CTGTGGGCAGAGGTTTTGGAAGG + Intronic
954879691 3:53824924-53824946 CTTGGTGCAGGGCTTGTGGAAGG - Intronic
957120659 3:76086469-76086491 CAATGGGCAGAGGTTGTGGATGG + Intronic
957242495 3:77676579-77676601 TTGTTTGCAGACATTCTGGAGGG - Intergenic
957840748 3:85666132-85666154 CTGTTTGTAGAAATTGTGAATGG - Intronic
959365584 3:105453821-105453843 CTCTTTGTAGAGATTGTGAATGG + Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960218765 3:115077402-115077424 CTGTGCCCACACATTGTGGAAGG - Intronic
961465627 3:127079316-127079338 CTGTGTGCAAGGACTCTGGATGG + Intergenic
961570620 3:127795858-127795880 CTGGGTGATAAGATTGTGGATGG - Intronic
961819756 3:129569956-129569978 ATCTGTGCAGAGGTTGGGGAAGG + Exonic
962176254 3:133158677-133158699 GTGTGTGCAGTGTTTGTGGCGGG + Intronic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
965443638 3:168747173-168747195 CTGTGTGATGAGATTATGGGTGG - Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
968484131 4:850592-850614 GTGTTTGCAGAGACTGTTGAGGG - Intronic
968711467 4:2122426-2122448 CTGTGTTCAGAGGTAGAGGAGGG + Intronic
968900673 4:3430248-3430270 CTGTGGGAAGATAGTGTGGACGG + Intronic
970336286 4:15047312-15047334 CAGTGTGCTGAGATTTTGGATGG + Intronic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
971628362 4:28954808-28954830 CAGTGGACAGAGAGTGTGGAGGG - Intergenic
971987760 4:33848273-33848295 CTGTGTTCCGAGAATGTGGTTGG - Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
973534404 4:51867038-51867060 CTGTGTGCAGTGATTGGAGCGGG - Intronic
973755360 4:54068376-54068398 CTGTGTTCTAAGATAGTGGAAGG - Intronic
974462453 4:62205467-62205489 GTGTGTGCAGAGATATTGGCAGG - Intergenic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
977695095 4:99956239-99956261 CTGTGTCCTTACATTGTGGAAGG + Intergenic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
978054152 4:104242237-104242259 ATGTTTGCAGATATTGTAGAGGG + Intergenic
978488081 4:109278945-109278967 CTGTGTTCACACATGGTGGAAGG + Intronic
978914986 4:114113645-114113667 CTGTGTACATAAATTGTGCAAGG - Intergenic
979373657 4:119918868-119918890 CTCTTTGTAGAGATTGTGAATGG - Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981288335 4:143045822-143045844 CTGTCTGAAGAGGTTGTGGTTGG - Intergenic
982264152 4:153522847-153522869 CTGTGGGCAGTGATAGTGGGAGG - Intronic
984074847 4:175163659-175163681 CTGTGTCCAGATGTTGTGCATGG - Intergenic
985564980 5:611248-611270 GTGTGTGCAGAGGTTGTACACGG - Intergenic
985564993 5:611307-611329 CTGTGTGCAGGGAGTGTGTGTGG - Intergenic
986435422 5:7725434-7725456 GTGTGTCCATAGATTTTGGAAGG - Intronic
986878182 5:12136575-12136597 GTGTGTGCAGAAATTGTGAATGG - Intergenic
986956116 5:13151929-13151951 CTCTTTGTAGAGATTGTGAATGG + Intergenic
989714817 5:44450686-44450708 CTGTGGGGAGACATTGGGGAGGG - Intergenic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992503902 5:77366922-77366944 ATCTGTGCAGAGAATGTGCAAGG + Intronic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
993702580 5:91135819-91135841 CTGTGAACAGGGATTGTGCAGGG + Intronic
993761691 5:91803217-91803239 CTCTGTGCAGGGCTTGTGGCTGG - Intergenic
995295208 5:110512442-110512464 CTGTGTGAAGTCATTGTGGTAGG - Intronic
995886184 5:116896493-116896515 CCGTGTGCAGAGTTTTTGGTAGG + Intergenic
996152458 5:120056782-120056804 CTGTGTGCACTGATTTTGCAGGG + Intergenic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
999230098 5:150056701-150056723 ATGTGTGCAGAGTTTAGGGAAGG - Intronic
1000062428 5:157669167-157669189 CTGGGTGCTGGGATTGGGGAGGG + Intronic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000792659 5:165626595-165626617 CCGTGTGTAGAAATTTTGGAAGG - Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001601390 5:172931171-172931193 CCGTGACCCGAGATTGTGGAAGG + Intronic
1002213580 5:177612333-177612355 CTGTGTGGAGTGCTTGGGGAAGG + Intergenic
1003408947 6:5846548-5846570 CTGTGTACAGAGAGAGTGGGGGG + Intergenic
1003790886 6:9546179-9546201 CTGTATGAAGAGAATGTGAAAGG + Intergenic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006958673 6:37903016-37903038 CTGTGTGCAGTAATTTAGGATGG + Intronic
1007229362 6:40337756-40337778 TTGTGTGCAGGGGTTGTGGTGGG - Intergenic
1007451450 6:41942597-41942619 CTGTTTGGAGAAACTGTGGACGG + Intronic
1008027844 6:46658199-46658221 CTGTGTGCAGAGACTGTTACTGG + Intronic
1008684295 6:53907091-53907113 CTCTGTGCAGTGAGTGTGGTAGG + Intronic
1009516482 6:64625494-64625516 CTGTGTCCTCACATTGTGGAAGG + Intronic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1014484380 6:121980977-121980999 CTCTTTGCAGCAATTGTGGATGG + Intergenic
1017389486 6:153923664-153923686 TTGTGTGCTGAGGTTGTGGCTGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1019261039 7:82181-82203 GGGTGTGCAGGGATTGTGGGGGG - Intergenic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1019787492 7:2986628-2986650 CTGTGAGCAGGGGCTGTGGAGGG - Intronic
1019845602 7:3496973-3496995 TTCTGTGCCGAGAATGTGGAGGG - Intronic
1020620157 7:10507389-10507411 CTCTGTGCAGCAATTGTGAATGG - Intergenic
1022304427 7:29132999-29133021 CTGTGTGAAGACATTTTGGCTGG - Intronic
1022608073 7:31835868-31835890 CTGAATGCAGAAATTGTAGAAGG - Intronic
1023100354 7:36711693-36711715 CTGTGTCCAGAGAATGAGGGTGG + Intronic
1023557626 7:41439545-41439567 TTGTGTGCAGACATTCTGGAGGG - Intergenic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1024587528 7:50854700-50854722 CTGTGTGCAGGAATTGTGCTTGG - Intergenic
1025003639 7:55338960-55338982 CTGTCTGCAGAGATTGGTGTAGG + Intergenic
1026128639 7:67602067-67602089 CTGTGTGGCTAGATTATGGAGGG - Intergenic
1027045434 7:74988094-74988116 CTGTGTCCAGAGATGGCCGATGG + Intronic
1027724678 7:81789104-81789126 CTGTGTGCTGACATGGTGGATGG - Intergenic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1028674446 7:93442694-93442716 CTGAGAGCAGAGGCTGTGGATGG - Intronic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1030052427 7:105550452-105550474 CTGTTTTCAGAGATGGTTGACGG + Exonic
1032559272 7:132871777-132871799 GTGTGTGCAGATATTATGCATGG - Intronic
1032628083 7:133614708-133614730 CTGTGTTCAGATATTGTGCATGG + Intronic
1032642339 7:133783624-133783646 CTGTGTGGAGAGTTAGTGTATGG + Intronic
1034710409 7:153186022-153186044 CAGTGTCCTGAGATTGTGCAGGG + Intergenic
1035025289 7:155820940-155820962 CTGTGCACAGAGATTGCTGAGGG - Intergenic
1035122700 7:156581575-156581597 CAGTATGCAGAGACTGTGTAAGG - Intergenic
1036448303 8:8842672-8842694 CTGAGTCCAGAGATTGGGGCAGG - Intronic
1036655164 8:10673011-10673033 CTGTGTGCAGGGAGTGTGTTGGG + Intronic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1039044313 8:33436014-33436036 TTGTGTGCAGAAACTGTGGTGGG - Intronic
1039948800 8:42152438-42152460 CTGGGAACTGAGATTGTGGAGGG + Intergenic
1041461816 8:58119706-58119728 CTGTCTGCAGAGATTCTTCAGGG + Intronic
1041884687 8:62794811-62794833 GTGAGTGCAGAGATAGTGAAGGG + Intronic
1043670729 8:82881258-82881280 CTGTGTGTAGATAATGTGGTGGG + Intergenic
1045829504 8:106441666-106441688 CTCTTTGCAGTGATTGTGAATGG + Intronic
1046099624 8:109599815-109599837 CAGTCTGAAGAGATTATGGAGGG - Intronic
1046995728 8:120520025-120520047 CTCTGTGCAGAGATTGTCACTGG - Intronic
1047715862 8:127594586-127594608 CTGTGTTCAGAGAAGGTTGAAGG + Intergenic
1047843464 8:128779828-128779850 CTATGTCAAGATATTGTGGAAGG + Intergenic
1048500132 8:134967949-134967971 CTACATGCAGAGATTGTGAAAGG - Intergenic
1048933958 8:139340063-139340085 CTGGGTGCAGAGATTCCGGAAGG - Intergenic
1048993352 8:139774247-139774269 CTGTGAGAAGAGACTGTGGGTGG + Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049818236 8:144618538-144618560 CTGCCTGCAGAGGTTGTGGTGGG + Intergenic
1050144506 9:2552236-2552258 CTGGTTGCAGAATTTGTGGAAGG + Intergenic
1050618728 9:7430179-7430201 CAGAGTACAGTGATTGTGGAAGG - Intergenic
1050796165 9:9545572-9545594 CTGTGTACAGAGTTTTTGCATGG + Intronic
1051342179 9:16121523-16121545 CGGTGTGCAGAGAGGGTGGGGGG + Intergenic
1052449503 9:28610563-28610585 CTGTGTTCACAGGTAGTGGAAGG - Intronic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1056553670 9:87672110-87672132 CTGTGTGCAGGCAGTGTGCAAGG - Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1057208655 9:93187741-93187763 CTTTGTGCAGAGCTATTGGAAGG + Intronic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1061274648 9:129562449-129562471 GTGTGCACAGAGATTGTGCATGG + Intergenic
1061488226 9:130931054-130931076 CTCTGTGAAGAGATAGAGGAAGG - Intronic
1061488454 9:130932499-130932521 GTTTGTGCAGAGCTGGTGGAGGG - Intronic
1186057090 X:5661289-5661311 CTGTGTCCACACATAGTGGAAGG - Intergenic
1187061957 X:15795157-15795179 ATGTGTCCAGATATTGTGCATGG - Intronic
1187224964 X:17366977-17366999 CTGGGTGAAGAGAATCTGGAAGG + Intergenic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1191090444 X:56615573-56615595 CTCTGTGCAGGGTTTGTGGCTGG + Intergenic
1191614620 X:63155751-63155773 CTTTGTGTAGAAATTGTGAATGG - Intergenic
1191621676 X:63223175-63223197 CTTTGTGTAGAAATTGTGAATGG + Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192715785 X:73641191-73641213 CTGTGGTCTGAGATTGTGGTTGG + Intronic
1193555493 X:82948932-82948954 CTCTTTGCAGAGATTGTGAATGG - Intergenic
1193576990 X:83211754-83211776 CTGTTTGCAGCAATTGTGAATGG - Intergenic
1194237652 X:91404153-91404175 CTGTGTTCAAAGAGTGTGGTTGG - Intergenic
1194592772 X:95820150-95820172 CTATGTGTTGATATTGTGGAAGG + Intergenic
1195235275 X:102890585-102890607 CTGTGTGCAGAGGTGGGGGTGGG + Intergenic
1197490482 X:127110544-127110566 CTCTCTGTAGAAATTGTGGATGG - Intergenic
1198404879 X:136302333-136302355 CTCTGTGAAGTGATTGTGAATGG + Intronic
1199253509 X:145692381-145692403 CTGTGGTCCGAGATTGTGGCTGG + Intergenic
1199731055 X:150632551-150632573 GTGTGTGCAGAGTAGGTGGAGGG + Intronic
1199798548 X:151227245-151227267 CTGTGTGCAGAGCTTGGGACAGG - Intergenic