ID: 1165827054

View in Genome Browser
Species Human (GRCh38)
Location 19:38711507-38711529
Sequence CTCGGAAGGTCCCCTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165827046_1165827054 -7 Left 1165827046 19:38711491-38711513 CCCTGCCGGCCTCTGACTCGGAA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183
1165827039_1165827054 26 Left 1165827039 19:38711458-38711480 CCAGGCCGTGGGCCGCCACACCA 0: 1
1: 0
2: 2
3: 8
4: 131
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183
1165827047_1165827054 -8 Left 1165827047 19:38711492-38711514 CCTGCCGGCCTCTGACTCGGAAG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183
1165827041_1165827054 14 Left 1165827041 19:38711470-38711492 CCGCCACACCACACAGACTGACC 0: 1
1: 0
2: 3
3: 24
4: 350
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183
1165827044_1165827054 6 Left 1165827044 19:38711478-38711500 CCACACAGACTGACCCTGCCGGC 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183
1165827042_1165827054 11 Left 1165827042 19:38711473-38711495 CCACACCACACAGACTGACCCTG 0: 1
1: 0
2: 0
3: 46
4: 326
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183
1165827040_1165827054 21 Left 1165827040 19:38711463-38711485 CCGTGGGCCGCCACACCACACAG 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165827054 Original CRISPR CTCGGAAGGTCCCCTGGGGC AGG Intronic
900195710 1:1374626-1374648 CTCAGCAGCTCCGCTGGGGCAGG - Intronic
900439803 1:2648836-2648858 GTCGCAAGTTCACCTGGGGCTGG - Intronic
900483934 1:2912638-2912660 CTGGGATGGTCCCCTAGGGAGGG - Intergenic
900574366 1:3375717-3375739 TTCTCAAGGTCCCCTGGGGTGGG - Intronic
901231219 1:7642567-7642589 ATCAGTAGGCCCCCTGGGGCGGG - Intronic
905517582 1:38573379-38573401 CTTGGAAGGGACTCTGGGGCAGG - Intergenic
905853356 1:41290611-41290633 CTCTGAAGAAGCCCTGGGGCAGG + Intergenic
906531459 1:46526267-46526289 CTCGGGAGCTCCCCTAGGGTGGG + Intergenic
906797576 1:48710278-48710300 CTCTGAAGTTCCCCTGGGAAGGG + Intronic
909289882 1:73868970-73868992 CTAGAAAGCCCCCCTGGGGCAGG + Intergenic
912798557 1:112707063-112707085 AGCGGAAGGTACCCTGGGCCGGG - Exonic
914917273 1:151826375-151826397 CTTGGAAGGTCCTCGGGGGTAGG - Intronic
915333158 1:155126100-155126122 CTGGGCACGTCGCCTGGGGCAGG + Intergenic
916651721 1:166839762-166839784 CCCGGCAGGTGCGCTGGGGCCGG + Intronic
918621340 1:186609369-186609391 CTGGAAAAGTGCCCTGGGGCAGG + Intergenic
923563691 1:235060851-235060873 CTCTGCAGGTGCCCTGAGGCTGG - Intergenic
1064031680 10:11886969-11886991 TCGGGGAGGTCCCCTGGGGCAGG - Intergenic
1065126029 10:22575330-22575352 ATCGGTGTGTCCCCTGGGGCAGG - Intronic
1065916503 10:30358175-30358197 CTCTGAAGGGACCCTGGGGGAGG - Intronic
1069739615 10:70679146-70679168 CTAGGAAGGTTCCCTGGAGGAGG + Intronic
1070491595 10:76981685-76981707 CTGGGAAGGCCCCCTGGAGGAGG - Intronic
1070544905 10:77444736-77444758 CTCAGCAGGTTCACTGGGGCTGG - Intronic
1070826380 10:79392603-79392625 CTGGGAAGGAGCCCTTGGGCTGG - Intronic
1072658626 10:97348317-97348339 CTTGGAAGGTGGGCTGGGGCTGG - Intergenic
1072935067 10:99704269-99704291 CACAGAAGGGCTCCTGGGGCGGG + Intronic
1076065443 10:127444414-127444436 CTGGGAGTGTCCCCTGGGACAGG + Intronic
1076882005 10:133244217-133244239 CTCGGAAGAGACGCTGGGGCCGG - Intergenic
1077048626 11:556820-556842 CTCAGAAGGTGCAGTGGGGCGGG - Exonic
1077074489 11:694268-694290 CTAGGCAGGTCACCAGGGGCAGG + Intronic
1077148249 11:1055471-1055493 CTCCGGAGGTCCCCTAGGGTAGG - Intergenic
1077323420 11:1952871-1952893 CTCGGAGGCCCCGCTGGGGCTGG - Intronic
1077421125 11:2450508-2450530 CTCGGGAGGTGCCTTGGGGCTGG + Intronic
1077484817 11:2833829-2833851 GTCGGAACGGCCCCTGGCGCTGG - Intronic
1078359607 11:10658149-10658171 CTCTGGGGGTCCCCTGGGCCTGG + Intronic
1080561286 11:33465348-33465370 ACAAGAAGGTCCCCTGGGGCCGG - Intergenic
1081491925 11:43576021-43576043 CTGGGAAGCTCCTCTGGGGAAGG + Intronic
1081669972 11:44937381-44937403 AGGGGAGGGTCCCCTGGGGCAGG - Intronic
1082002399 11:47400308-47400330 CTCGGGCGCTCCCCTGGGGGCGG - Intergenic
1083331375 11:61899991-61900013 CTGGGAAGGGGCCCTGGGCCAGG - Intronic
1083616515 11:64029056-64029078 CACAGATGGTGCCCTGGGGCGGG - Intronic
1085251294 11:75145487-75145509 CTAGGAAGGCCCCCTGAGGTAGG - Intronic
1087114641 11:94512398-94512420 CTCGGAAGGCCGGCTGGGGGCGG + Intergenic
1089269935 11:117295151-117295173 CTGGGAAGGCATCCTGGGGCTGG - Exonic
1202806408 11_KI270721v1_random:8066-8088 CTCGGAGGCCCCGCTGGGGCTGG - Intergenic
1091817682 12:3452496-3452518 CTCGGAAGCTGCCCTGGGCTGGG + Intronic
1092904183 12:13087249-13087271 CTTGGTAGGTCTCCTGGGGATGG - Exonic
1096551829 12:52378194-52378216 CTCAGCAGGTCCCCAGTGGCCGG + Exonic
1096626577 12:52899577-52899599 CAGGGAAGGTCCCTTGGGCCAGG - Intronic
1102182499 12:110923022-110923044 AACAGAAGGCCCCCTGGGGCTGG + Intergenic
1103371344 12:120421893-120421915 GGAGGAAGATCCCCTGGGGCGGG + Intergenic
1103728995 12:123013652-123013674 CCCCGAAGGTCACCTAGGGCAGG - Intronic
1104843380 12:131834968-131834990 CTCAGGAGGCCCCCTGGGGCAGG + Intronic
1104966045 12:132509261-132509283 CTGGGAGGGACCCCTGGGGCTGG - Intronic
1105705261 13:22964393-22964415 CAGGGAAGGTTCCCTGGGGAAGG - Intergenic
1105858176 13:24389409-24389431 CAGGGAAGGTTCCCTGGGGAAGG - Intergenic
1113851965 13:113423027-113423049 CTCTGCAAGACCCCTGGGGCTGG + Intronic
1114009290 14:18349686-18349708 TTTGGAACGTCCCCTGGGACAGG + Intergenic
1116868762 14:50052223-50052245 CTAGGGATGTCACCTGGGGCAGG + Intergenic
1118259661 14:64235296-64235318 CAGGGAAGATCCCCTGGGGGAGG - Intronic
1122848228 14:104512431-104512453 CCCTGAAGGCCCCCTGTGGCAGG - Intronic
1123020381 14:105395266-105395288 TTCTGAAGTCCCCCTGGGGCTGG + Exonic
1123106789 14:105845513-105845535 CAGGGAAGGTTCTCTGGGGCTGG + Intergenic
1124247270 15:28081704-28081726 CCCGGCAGCCCCCCTGGGGCAGG + Exonic
1124490359 15:30151471-30151493 CTCTGAAGGGACCCTGGGGGAGG + Intergenic
1124753174 15:32386858-32386880 CTCTGAAGGGACCCTGGGGGAGG - Intergenic
1124974913 15:34522558-34522580 CTCTGAAGGGACCCTGGGGGAGG - Intergenic
1129727546 15:77909266-77909288 CTCTGAAGGGACCCTGGGGAAGG - Intergenic
1129840337 15:78739699-78739721 CTCTGAAGGGACCCTGGGGAAGG + Intergenic
1130258562 15:82337292-82337314 CTCTGAAGGGACCCTGGGGAAGG - Intergenic
1130596361 15:85252668-85252690 CTCTGAAGGGACCCTGGGGAAGG + Intergenic
1131066241 15:89436535-89436557 CTCGGCCGATCCCCTGGGGGTGG + Intergenic
1132431545 15:101765740-101765762 CTCTGAAGGGACCCTGGGGGAGG - Intergenic
1132753793 16:1472033-1472055 GTCTGCAGGGCCCCTGGGGCAGG - Intronic
1132985567 16:2765407-2765429 CTGGGAAGGGCCCGAGGGGCTGG - Exonic
1133224736 16:4335451-4335473 CTGGGCAGGTCCCCAGGGGGAGG + Intronic
1136748987 16:32616123-32616145 AGCTGAAGGACCCCTGGGGCTGG - Intergenic
1138458424 16:57134143-57134165 CTCTGATGATCCTCTGGGGCTGG + Intronic
1141458478 16:84161280-84161302 CTCAGCATGGCCCCTGGGGCGGG - Intronic
1141716248 16:85728730-85728752 CTGGGAAGATCTCCTGGGTCAGG - Intronic
1141837010 16:86547536-86547558 CTCGCAGGGTCCACGGGGGCAGG + Intronic
1203051120 16_KI270728v1_random:875337-875359 AGCTGAAGGACCCCTGGGGCTGG - Intergenic
1144669723 17:17126188-17126210 CTGGGAAGGTGCCGTGGGCCAGG + Intronic
1145318600 17:21749771-21749793 CTAGCACTGTCCCCTGGGGCCGG - Intergenic
1146632980 17:34483978-34484000 CCCGGCAGGGCTCCTGGGGCAGG + Intergenic
1148325628 17:46781986-46782008 CTCAGAAGCTTCTCTGGGGCTGG + Intronic
1149253148 17:54793448-54793470 CTCAGAAGATCCCATGGGACAGG + Intergenic
1149990327 17:61379624-61379646 GCCGGCAGGTCCCCGGGGGCAGG - Intronic
1150410527 17:64937540-64937562 CAGGACAGGTCCCCTGGGGCGGG - Intergenic
1152101157 17:78302416-78302438 CTGGGCAGCTGCCCTGGGGCAGG - Intergenic
1152458845 17:80430960-80430982 CTTGCAAGGTGCCCAGGGGCTGG - Intronic
1158962123 18:62596183-62596205 CACGGAACCTCCCCTGGGCCTGG + Intergenic
1160190215 18:76709049-76709071 CTCTGCACCTCCCCTGGGGCGGG + Intergenic
1160971013 19:1767767-1767789 CCAGGACGGTGCCCTGGGGCGGG + Intronic
1160982161 19:1821442-1821464 CTCCGCAGGTCCCATGTGGCCGG + Intronic
1161555005 19:4936171-4936193 CCTGGAAGCTCCCATGGGGCTGG - Intronic
1161981597 19:7633023-7633045 CTGGCCAGGGCCCCTGGGGCGGG - Intronic
1162302194 19:9850283-9850305 GAGGGGAGGTCCCCTGGGGCCGG - Intergenic
1162474837 19:10893753-10893775 CCAGGATGGTGCCCTGGGGCCGG + Intronic
1163256736 19:16160622-16160644 CTGGGAAGGTCCCTAGGGGCTGG + Intergenic
1164651703 19:29895425-29895447 CTCAGAAGGCCCCGTGGAGCGGG - Intergenic
1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG + Intronic
1168103046 19:54151282-54151304 TTGGAAAGGTCCCCTGGGGCTGG + Intronic
925444885 2:3919202-3919224 CTGGGAACGTCTCCTGGGGGAGG + Intergenic
927713917 2:25341155-25341177 CCCGGGAGGCCCCCGGGGGCGGG - Intronic
933895985 2:86809665-86809687 CTCGGGGCGTGCCCTGGGGCAGG + Intergenic
934967038 2:98731638-98731660 CTCGGGAGCTCCTGTGGGGCTGG - Intergenic
934989853 2:98913531-98913553 CTGGGAAGGACCCACGGGGCTGG + Intronic
936463771 2:112729468-112729490 CTCGGAAGGTCAGCAGGGGCAGG - Intronic
937127985 2:119486362-119486384 CTCAGAAGCTAGCCTGGGGCTGG - Intronic
938188514 2:129254472-129254494 CAAGGAAGGGGCCCTGGGGCTGG - Intergenic
940199971 2:151139935-151139957 CTGGGACAGGCCCCTGGGGCTGG - Intergenic
940660535 2:156539664-156539686 CTCGAAATCACCCCTGGGGCAGG + Intronic
946928122 2:224645696-224645718 CTCAGAAGCTGCTCTGGGGCAGG + Intergenic
947679275 2:232014957-232014979 CTCTGGGGGTCCCCAGGGGCCGG - Exonic
948376746 2:237525802-237525824 CTCGGTAGGTGCCCTTGGCCAGG + Exonic
948803990 2:240445280-240445302 CTGGGAAGGTCCCCTGGGATAGG + Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1170987196 20:21269244-21269266 CCAGGATGGTCCCCTGGGGTTGG - Intergenic
1173850480 20:46214734-46214756 CTGGGAAGGTTCCCTGGAGGAGG - Intronic
1174017639 20:47501807-47501829 CGCGCAAGGCCCCCTGGGACCGG + Intergenic
1175419046 20:58819947-58819969 CTGGGAGGGTCACCTGGGGCGGG - Intergenic
1175878734 20:62244133-62244155 CTGGGCAGGTGCCCTGGGGAAGG + Intronic
1176289432 21:5036335-5036357 CCCGGGAGGTGCCCTGGGCCCGG + Intronic
1179800170 21:43808019-43808041 CCCGGAACGTCCTCAGGGGCGGG + Intergenic
1179823561 21:43951436-43951458 CTCGGAAGGGCGGCTTGGGCAGG + Intronic
1179867798 21:44227252-44227274 CCCGGGAGGTGCCCTGGGCCCGG - Intronic
1180433791 22:15280496-15280518 TTTGGAACGTCCCCTGGGACAGG + Intergenic
1181674413 22:24442460-24442482 CTGGGGAGGGCCCCCGGGGCAGG - Intergenic
1184058450 22:42067555-42067577 CTAGGAAGGTTCCCTGGAGGAGG - Intronic
1184175879 22:42788463-42788485 CTCTGAAGGGACCCTGGGGGAGG + Intergenic
1184215773 22:43066326-43066348 CTTGCACTGTCCCCTGGGGCAGG - Intronic
1184465990 22:44669059-44669081 CTCGGGAGGTCCCGGGAGGCTGG - Intronic
1184685480 22:46094904-46094926 CTCGGCAGCTGCCCTGGCGCAGG + Intronic
1185226552 22:49656830-49656852 CTTTCAAGGTCCCCTGGGCCTGG - Exonic
1185320995 22:50200291-50200313 CTCAGACAGTCCTCTGGGGCCGG + Intergenic
1185419757 22:50728808-50728830 GTCGGGGGGTCCCCTGGGGGTGG - Intergenic
949923868 3:9025312-9025334 CTCTGAAGATCCCCTGCTGCTGG + Exonic
950187732 3:10955794-10955816 CTCAGAAGGGTCCCTGGGCCTGG + Intergenic
954003160 3:47573566-47573588 CTGGGAATGTCCCCAAGGGCAGG - Intronic
954147463 3:48641420-48641442 CTCTGAAAGGCGCCTGGGGCTGG - Exonic
954660188 3:52222931-52222953 CTGGGAGTGTCCACTGGGGCCGG + Exonic
954894748 3:53965875-53965897 CTCTGAAGGACCCCTGGGAAGGG - Intergenic
961305862 3:125958913-125958935 CTGGGAGGGACCCCTGGGGCTGG - Intergenic
966743264 3:183253482-183253504 CTGGGAAGCTGGCCTGGGGCGGG + Intronic
968728449 4:2258982-2259004 CACGGAAGGTGGCCTGGAGCTGG - Intronic
968913219 4:3486118-3486140 CTCGGGAGGTCCCCTGGCTGTGG + Intronic
969714316 4:8861033-8861055 CTGGGAAGGTCCCGGGCGGCCGG + Intronic
971385304 4:26136382-26136404 CAAGGAAGGGCTCCTGGGGCAGG - Intergenic
972283062 4:37621744-37621766 ATAGGAAGGGGCCCTGGGGCAGG + Intronic
972794447 4:42401192-42401214 CCGGGAGGGTGCCCTGGGGCTGG - Exonic
980027195 4:127781703-127781725 CTCGGCAGCTCCCCCGGGGCTGG + Intergenic
985474991 5:73922-73944 CCCTGCAGGTCTCCTGGGGCAGG - Intergenic
986437350 5:7747213-7747235 CTTGGAAGGTGCCCGGTGGCTGG - Intronic
990247305 5:53875559-53875581 CTCGCACTGTCGCCTGGGGCTGG - Intergenic
991002409 5:61795536-61795558 CAGGGAAGGCCCCCTGGGTCTGG + Intergenic
994690739 5:103016470-103016492 CTCCAAAGGTGCCCTGGGTCTGG - Intronic
998102172 5:139443631-139443653 CTTGGGAAGTCCCCGGGGGCAGG - Intronic
998451326 5:142236510-142236532 CTCGGAAGCTCCACTGTAGCAGG + Intergenic
1000642811 5:163723522-163723544 CTGGGATGGTCCCCTAGGACTGG - Intergenic
1001503296 5:172255709-172255731 CTCAGCAAGTCCCCCGGGGCTGG + Intronic
1002042932 5:176527829-176527851 CTGGGAAGGCCCCCTGGAGATGG + Exonic
1002044943 5:176536561-176536583 CTCGGAGGGACACCGGGGGCGGG + Intronic
1002465969 5:179408810-179408832 ATCGGAAGGTCAACCGGGGCAGG + Intergenic
1002487668 5:179550702-179550724 CTCCGCAGGTCGCCTGGGCCGGG - Exonic
1002698419 5:181105384-181105406 CTGGGGAGGTCCCCTGGTTCAGG - Intergenic
1007169112 6:39850037-39850059 CCCACCAGGTCCCCTGGGGCTGG - Intronic
1007590299 6:43016955-43016977 CTCGGCAGCTCCCTTGGGGCAGG + Intronic
1008685086 6:53916844-53916866 CATGGAAGGTCACTTGGGGCTGG + Intronic
1014778071 6:125533543-125533565 CTCTGGAGGTGGCCTGGGGCAGG - Intergenic
1018697983 6:166405574-166405596 CTCAGGAGGGCCCCTGGGCCTGG + Intergenic
1019946113 7:4330678-4330700 CTCGGAGGGTCCACAGGGACTGG + Intergenic
1020617697 7:10479632-10479654 CTGAGAAGCTTCCCTGGGGCTGG - Intergenic
1021627479 7:22608652-22608674 CTCAGAAGGTCCCATGGGATTGG - Intronic
1024173537 7:46814356-46814378 CTGGGAATGCACCCTGGGGCAGG + Intergenic
1027053343 7:75033194-75033216 CCGGGAAGGACCCCTGGTGCAGG - Intronic
1027232922 7:76282568-76282590 CGGGGAGGGTTCCCTGGGGCGGG - Intronic
1034068589 7:148160677-148160699 ATCGGAAGGATCCCTGGGGCTGG + Intronic
1034450912 7:151136855-151136877 CCCGGAAGGTTTCCTGAGGCGGG + Intronic
1035953094 8:4045448-4045470 GTCGGAAGGGCCACTGGTGCTGG + Intronic
1036785025 8:11680302-11680324 CTCGGAAGATCCCCGCGGACAGG + Intronic
1037951871 8:23023893-23023915 CTCAGGAGGTCCTCAGGGGCAGG + Intronic
1038406562 8:27326566-27326588 CTCGGAAGCTGCGCTGTGGCTGG + Intronic
1039926800 8:41941271-41941293 CTCGGAGGGGCCGCTGGGGGAGG - Exonic
1041928818 8:63265864-63265886 TGCAGAAGGTTCCCTGGGGCTGG + Intergenic
1043472913 8:80578985-80579007 GTGGGCAGGACCCCTGGGGCCGG + Intergenic
1046830302 8:118738262-118738284 CTGGGAAAGTCAGCTGGGGCTGG - Intergenic
1049664157 8:143835630-143835652 CCGGCATGGTCCCCTGGGGCTGG + Exonic
1052302969 9:26974383-26974405 TTTGGAAGATCCCCTTGGGCCGG - Intronic
1053429786 9:38034446-38034468 TTTGGGAGGTCCCCTGTGGCAGG + Intronic
1053456199 9:38234747-38234769 CCAGGAGGGTCCCCTGGGACTGG - Intergenic
1061061757 9:128254117-128254139 CTCTGAAGGGACCCTGGGGGAGG - Intronic
1062183767 9:135205348-135205370 ACCAGAAGGTCCCCTGGGGAGGG + Intergenic
1185456707 X:314386-314408 CTAGGCAGGTCCCCTCGGCCCGG - Intronic
1195310169 X:103624821-103624843 TTGGGAATTTCCCCTGGGGCAGG + Intronic
1195311766 X:103638780-103638802 TTGGGAATTTCCCCTGGGGCAGG + Intergenic
1200039745 X:153356265-153356287 CTCAGAAGGTCCCCAAGGTCAGG + Intronic