ID: 1165828263

View in Genome Browser
Species Human (GRCh38)
Location 19:38717912-38717934
Sequence TTGATGTCCTGGGGCAGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165828263_1165828274 13 Left 1165828263 19:38717912-38717934 CCTGCCCTGCCCCAGGACATCAA 0: 1
1: 0
2: 2
3: 46
4: 355
Right 1165828274 19:38717948-38717970 CACTTGGAGCAGGCTGAGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 315
1165828263_1165828275 21 Left 1165828263 19:38717912-38717934 CCTGCCCTGCCCCAGGACATCAA 0: 1
1: 0
2: 2
3: 46
4: 355
Right 1165828275 19:38717956-38717978 GCAGGCTGAGAAGGGCTACGAGG 0: 1
1: 1
2: 0
3: 15
4: 177
1165828263_1165828271 -3 Left 1165828263 19:38717912-38717934 CCTGCCCTGCCCCAGGACATCAA 0: 1
1: 0
2: 2
3: 46
4: 355
Right 1165828271 19:38717932-38717954 CAACAATGGCTGGCAGCACTTGG 0: 1
1: 0
2: 2
3: 10
4: 128
1165828263_1165828276 26 Left 1165828263 19:38717912-38717934 CCTGCCCTGCCCCAGGACATCAA 0: 1
1: 0
2: 2
3: 46
4: 355
Right 1165828276 19:38717961-38717983 CTGAGAAGGGCTACGAGGAGTGG 0: 1
1: 1
2: 1
3: 17
4: 232
1165828263_1165828272 3 Left 1165828263 19:38717912-38717934 CCTGCCCTGCCCCAGGACATCAA 0: 1
1: 0
2: 2
3: 46
4: 355
Right 1165828272 19:38717938-38717960 TGGCTGGCAGCACTTGGAGCAGG 0: 1
1: 0
2: 1
3: 36
4: 261
1165828263_1165828273 12 Left 1165828263 19:38717912-38717934 CCTGCCCTGCCCCAGGACATCAA 0: 1
1: 0
2: 2
3: 46
4: 355
Right 1165828273 19:38717947-38717969 GCACTTGGAGCAGGCTGAGAAGG 0: 1
1: 1
2: 3
3: 47
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165828263 Original CRISPR TTGATGTCCTGGGGCAGGGC AGG (reversed) Exonic
900119809 1:1043737-1043759 GTGAGGCCCTGGGGCCGGGCGGG + Intronic
900598436 1:3493036-3493058 TTGCCCTCCTGGGGCGGGGCAGG - Intronic
901480013 1:9518695-9518717 TTGGTGTCCTAGGAGAGGGCTGG - Intergenic
901655519 1:10767226-10767248 CTGATCTCCTGGGCCAGGACTGG - Intronic
901666930 1:10831377-10831399 TGGCTCTCCTGAGGCAGGGCAGG + Intergenic
902295776 1:15466014-15466036 CTGATGTCCTGCAGCAGGGCCGG + Exonic
902479309 1:16703143-16703165 GTGCTGGGCTGGGGCAGGGCAGG - Intergenic
903222799 1:21878340-21878362 TTCATGAGCTGGGGCAGGGAGGG + Intronic
903307696 1:22424816-22424838 TTGGTGACCGGGAGCAGGGCAGG - Intergenic
903552604 1:24168424-24168446 TTTCTGACCTCGGGCAGGGCCGG - Intronic
903608198 1:24590487-24590509 TTCACGTACTGAGGCAGGGCCGG + Intronic
904246584 1:29192406-29192428 TTGATGCCCTCGGGCAGAACTGG + Intergenic
904501747 1:30916628-30916650 AACATGTCCTTGGGCAGGGCTGG - Intergenic
904876987 1:33662970-33662992 TGCAGGTCCTTGGGCAGGGCCGG + Exonic
905260050 1:36710722-36710744 TTGGAGTGCTGGGGGAGGGCAGG + Intergenic
907743511 1:57189957-57189979 TTGGTGTTATGGGGCAGTGCTGG + Intronic
907743964 1:57193997-57194019 TTGGTGTTATGGGGCAGTGCTGG + Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
908515419 1:64887392-64887414 GTGCTGTTCTGAGGCAGGGCAGG - Intronic
910233998 1:85016073-85016095 ATCATGTCCTGGGGGAGGCCAGG - Intronic
910876072 1:91879407-91879429 TTGGTGTCGGGGGGCAGGGCAGG - Intronic
911200251 1:95036973-95036995 TTCAGGCCCTGGGGCAGAGCTGG - Intronic
911475423 1:98367245-98367267 TAGATGTCCCTTGGCAGGGCAGG - Intergenic
912787459 1:112618876-112618898 CAGACCTCCTGGGGCAGGGCGGG - Intronic
913455920 1:119030664-119030686 GTGATGTCCTAGGGCAGGAGAGG - Intergenic
914420785 1:147526769-147526791 TGGATTGGCTGGGGCAGGGCGGG + Intergenic
915197289 1:154199157-154199179 TTGATGTAAGGGGGCAGGGGTGG - Intergenic
915399487 1:155611906-155611928 CTCTTGTCCTGGGGAAGGGCAGG - Intronic
915416600 1:155747486-155747508 CTCTTGTCCTGGGGAAGGGCAGG - Intergenic
915464711 1:156090039-156090061 ATGCTGTCTTGGGGCAGGGAGGG + Intronic
915731649 1:158058414-158058436 TTGGAAGCCTGGGGCAGGGCAGG - Intronic
920368282 1:205460128-205460150 TTGAGGTCCTGGGACAGTGCAGG + Intergenic
921918002 1:220634395-220634417 TGGTTGTGCTGGGGTAGGGCAGG - Intronic
922028208 1:221773018-221773040 TAGATGTCCTGGGGGAGCCCAGG - Intergenic
922423691 1:225475517-225475539 ATGAGGTCCTGGGCCAGGACAGG - Intergenic
923099419 1:230800585-230800607 GTGATGATATGGGGCAGGGCAGG - Intronic
923611971 1:235504118-235504140 GTGAGGTCCTGGGGCCGGGCGGG - Intronic
1063676037 10:8141267-8141289 GTGGGGTCCCGGGGCAGGGCGGG + Intergenic
1064030285 10:11879198-11879220 TTGTTGTCCCTGGTCAGGGCTGG - Intergenic
1064075350 10:12264393-12264415 CTGAGGGCCTGGGGGAGGGCGGG - Intergenic
1064281304 10:13954051-13954073 CTGATGTCCTAGCACAGGGCTGG - Intronic
1066065199 10:31756656-31756678 TTGACTTCCTGGGACAGGACAGG - Intergenic
1066202757 10:33158083-33158105 TTACTGTCCTACGGCAGGGCAGG - Intergenic
1066532202 10:36353168-36353190 TAGATTTCCTGGGGGAGAGCTGG + Intergenic
1069842701 10:71349673-71349695 CTCATGTCCTGGAGGAGGGCGGG - Intronic
1070599121 10:77853586-77853608 GTGATGCCCTGGGGTGGGGCGGG - Intronic
1070916765 10:80160055-80160077 TTTATGTCCTGGGTCAGAACTGG - Intronic
1071752771 10:88499760-88499782 CAGATGTGCTGGGTCAGGGCTGG - Intronic
1074754049 10:116611292-116611314 TGGATCTCCAGGGGCAGGGGAGG + Intergenic
1075354711 10:121761000-121761022 TTAATGACCTGGAGCAGGGGAGG + Intronic
1075396734 10:122133112-122133134 CTGATCTCCTGGGACAGAGCTGG + Intronic
1076367327 10:129930063-129930085 CTGATGTCCAGGGACAGGGGAGG - Intronic
1076413209 10:130266115-130266137 TTGCTGTTCTGGGGGAGGGGAGG - Intergenic
1077137135 11:1006107-1006129 TTGCAGTCATGGGGCGGGGCCGG + Intronic
1077154342 11:1084766-1084788 TTGAGCTCCTGGGACGGGGCTGG + Intergenic
1078149589 11:8747515-8747537 TTGATGACCTGGGGTGGGACTGG - Intronic
1079239687 11:18713841-18713863 TTAGTGTGCTGGGTCAGGGCAGG - Exonic
1083269287 11:61563278-61563300 TAGTTGGCCAGGGGCAGGGCTGG - Intronic
1083629531 11:64088447-64088469 CTGTGGGCCTGGGGCAGGGCAGG + Intronic
1084710004 11:70838160-70838182 TGGAAGACCTGGGGCAGGGGAGG + Intronic
1085205099 11:74726938-74726960 TGGATGGCCTGGGGCAGTGAAGG - Intronic
1086694084 11:89823413-89823435 AAGATTTGCTGGGGCAGGGCTGG - Intergenic
1086712065 11:90021156-90021178 AAGATTTGCTGGGGCAGGGCTGG + Intergenic
1089392259 11:118110184-118110206 TCTCTGTCCTGGGGCAGTGCTGG - Intronic
1089579550 11:119472905-119472927 ACCCTGTCCTGGGGCAGGGCAGG + Intergenic
1089634611 11:119804229-119804251 AAGAGGTCATGGGGCAGGGCAGG - Intergenic
1089828408 11:121300987-121301009 TTAAAGCCCTGGGGCAGGGTGGG + Intronic
1090434253 11:126673671-126673693 GGGATGTCCTGGAGCAGGACAGG + Intronic
1091688900 12:2582736-2582758 TTGACGTAGTGGGGCAGGGCAGG + Intronic
1091738047 12:2939512-2939534 TTTAAGTCCTGGGGCAGGGAGGG - Intronic
1092290879 12:7158852-7158874 GTCATGTCCTGGGGCAGGGGCGG + Exonic
1092754716 12:11752612-11752634 TTGATGGCGTGGGGCGGGGGTGG + Intronic
1094458212 12:30662874-30662896 GAGATGGCCTGGGGCAGGGAAGG - Intronic
1096801613 12:54114202-54114224 GTGATGACAGGGGGCAGGGCAGG + Intergenic
1101514051 12:105418420-105418442 TGGAGGCTCTGGGGCAGGGCAGG - Intergenic
1101755516 12:107618091-107618113 TGGATCTGCTGGGGCAGGGCAGG - Intronic
1102443249 12:112979489-112979511 TTGCTGGCCTGGGCCAGGGCTGG - Intronic
1102496616 12:113323949-113323971 TTGAGGGGTTGGGGCAGGGCTGG - Intronic
1104366353 12:128181323-128181345 TCGATGTTCGAGGGCAGGGCAGG + Intergenic
1104894245 12:132153975-132153997 TTGGGCTCCTGGGGCAGGGCTGG + Intergenic
1105599048 13:21869528-21869550 GTGGTGTCCTGGGGCTGGCCTGG + Intergenic
1105775348 13:23654372-23654394 TGGGTGTCCTGGGGCAGGGGCGG - Intronic
1105809211 13:23979758-23979780 TTCATTTCCTCGGCCAGGGCGGG - Exonic
1106126462 13:26903681-26903703 TTGATTAGTTGGGGCAGGGCAGG + Intergenic
1106199434 13:27524111-27524133 TTGAGGCCCTGGGGGAGGTCAGG + Intergenic
1107662134 13:42649681-42649703 TTGATTTCCTGGGCCAGTGATGG - Intergenic
1108167281 13:47706780-47706802 CTCATTTGCTGGGGCAGGGCTGG - Intergenic
1108648782 13:52455566-52455588 TGCAGGTCCTGGGGCACGGCCGG - Exonic
1108676427 13:52740850-52740872 ATGATGACCTGGGGCTGGGAAGG + Intergenic
1109687796 13:65843899-65843921 TGGGTGTCCTTGGGCAGGCCTGG - Intergenic
1113292170 13:108919192-108919214 TTTTTCTCCTGAGGCAGGGCAGG + Intronic
1114134718 14:19834613-19834635 ATGATGTCAGGGGGCAGGGGCGG - Intergenic
1114675153 14:24435426-24435448 ATGCTTTCTTGGGGCAGGGCAGG + Intronic
1115465470 14:33709807-33709829 TTTAAGTCCTGAGGAAGGGCAGG - Intronic
1117203001 14:53411623-53411645 TTGATGTTGTGGGGGAGGGTGGG - Intergenic
1117723047 14:58646103-58646125 TTGTTCTCCTGCGGCGGGGCAGG - Exonic
1118975640 14:70673782-70673804 TGAGTGTGCTGGGGCAGGGCTGG + Exonic
1120582525 14:86270647-86270669 TTGATCAGTTGGGGCAGGGCAGG - Intergenic
1121328689 14:93036251-93036273 TGGACCTCCTGGGGCAGGGCTGG - Intronic
1121962497 14:98274328-98274350 TTGATGTCCAAGGTCAGTGCTGG + Intergenic
1122925271 14:104896452-104896474 TTCATGTCCAGGGGCAGGCGGGG - Exonic
1123577773 15:21690187-21690209 ATGATGTCAGGGGGCAGGGGTGG - Intergenic
1123614397 15:22132668-22132690 ATGATGTCAGGGGGCAGGGGTGG - Intergenic
1124399951 15:29339214-29339236 TTGATGCCATGGGAGAGGGCTGG + Intronic
1124848165 15:33311319-33311341 TGGAGGGCCTGGGGCAGGGGTGG - Intronic
1125519376 15:40339612-40339634 TGGATCTCCTGTGGGAGGGCTGG + Exonic
1128732765 15:70032571-70032593 CTGTGGTCCTGGGGCAGGGCTGG - Intergenic
1128803656 15:70514326-70514348 GGGATGTCCTGGGGCATGGAAGG - Intergenic
1129294832 15:74594483-74594505 GTGATGCCCTGGGCCAGGCCTGG - Intronic
1129301550 15:74628494-74628516 TGCATGTCCTGGGGCAGTGAGGG + Intronic
1131378029 15:91941266-91941288 TAGGTGTGTTGGGGCAGGGCGGG + Intronic
1202986642 15_KI270727v1_random:424432-424454 ATGATGTCAGGGGGCAGGGGTGG - Intergenic
1132708603 16:1256783-1256805 TTGATGTCCCTGGGCAGCGGAGG - Exonic
1132897597 16:2236398-2236420 TTGAGGTCCTGGGCCAGGGAGGG - Exonic
1133319718 16:4905420-4905442 GTGGTTGCCTGGGGCAGGGCTGG + Intronic
1133333034 16:4987995-4988017 TTGGTGTCCTGGGTCCGGGCTGG + Intronic
1138614830 16:58157125-58157147 TTGCTGTCCTGAGGCAGGAGAGG - Intergenic
1138693816 16:58792760-58792782 CTGAGCTCCTGGGGCAGGGCTGG - Intergenic
1139491778 16:67289815-67289837 GAGATGCCCTGGGGCAGAGCTGG - Intronic
1139950389 16:70665433-70665455 TGACTGTCCTGGGGCCGGGCTGG + Intronic
1140221396 16:73047224-73047246 TTTATTTCCTTGGGCAGGGGCGG - Intronic
1140482982 16:75272509-75272531 TTGACCTCCAGTGGCAGGGCAGG + Intergenic
1141386179 16:83624342-83624364 CTGCTGACCTGGGGCAGGGGTGG - Intronic
1141629268 16:85277835-85277857 CTGGTGTCCTGGGGCCGGCCTGG - Intergenic
1141919394 16:87125959-87125981 TCTATGTCCTGGGGAAAGGCAGG - Intronic
1142326989 16:89421839-89421861 TCCATGTCTTGGGGCAGGGGTGG + Intronic
1142583303 17:955013-955035 TTGTTTTCCTGTGGAAGGGCTGG - Intronic
1143615471 17:8046809-8046831 TTGAGGTCCTGGGGTAGGAGTGG + Intronic
1144443897 17:15308965-15308987 TGGGTTCCCTGGGGCAGGGCTGG - Intronic
1144726558 17:17505302-17505324 TGGGTGTGCTGGGGCAGGGGTGG + Intergenic
1145213527 17:21034312-21034334 GTGATGTCCTTGGACAGGTCAGG + Intronic
1146562839 17:33886311-33886333 TTGATGTCAGGGGGCAGGGAAGG + Intronic
1148342400 17:46881168-46881190 CTGAAGAACTGGGGCAGGGCAGG - Intronic
1149771889 17:59328966-59328988 TTGATGAACTGGGGGATGGCGGG + Intergenic
1150141878 17:62737149-62737171 TGGAAGGCCTGGGACAGGGCTGG + Exonic
1150574679 17:66419824-66419846 TTGATGTCTTGGGGCATGATTGG + Intronic
1151322673 17:73361179-73361201 TTGATTTCCTGGGGCTGAGGTGG - Intronic
1151388318 17:73769040-73769062 TTGATGTCCTGGGGGTGTTCTGG + Intergenic
1151542541 17:74771934-74771956 AGGATGTCCTGGGGCAGAGTGGG - Intronic
1152190167 17:78883356-78883378 TTGCAGCCCTGGTGCAGGGCGGG + Intronic
1203171584 17_GL000205v2_random:153403-153425 TTGAAGTCTTGGGGAAGGTCTGG + Intergenic
1154510791 18:15099470-15099492 TTCATGTCCTTTGCCAGGGCAGG + Intergenic
1157566201 18:48680694-48680716 TTGATGACTTGGGCCAGGCCTGG + Intronic
1160698312 19:494972-494994 CTGAGGCCCAGGGGCAGGGCTGG - Intronic
1160805219 19:989625-989647 CCGCAGTCCTGGGGCAGGGCAGG + Intronic
1160924223 19:1535333-1535355 GGGCTGTCCTGGGGGAGGGCTGG + Exonic
1161285776 19:3467560-3467582 TCAAGGTCCTGGGGCAGGGAAGG - Intronic
1161773366 19:6243286-6243308 TTGATGCCCTGGTCCTGGGCAGG - Intronic
1162129247 19:8515365-8515387 GTGATGTCCTGGAGTGGGGCAGG + Intergenic
1162534357 19:11254086-11254108 ATGGGGTCCAGGGGCAGGGCTGG - Intronic
1162754901 19:12852100-12852122 TTGAATTCCTGAGGCAGGGCAGG - Exonic
1163097516 19:15070553-15070575 TTGATCAGTTGGGGCAGGGCAGG + Intergenic
1163209306 19:15828915-15828937 TTGATCAGTTGGGGCAGGGCAGG - Intergenic
1163210362 19:15835888-15835910 TTGATCAGTTGGGGCAGGGCAGG - Intergenic
1163398466 19:17077405-17077427 TGCATGTCCTGGGGCAAGCCAGG - Intronic
1163681492 19:18684729-18684751 TTGGTGTGCAGGGGCAGGCCAGG + Intronic
1164621871 19:29700893-29700915 CCCAGGTCCTGGGGCAGGGCAGG - Intronic
1164812009 19:31164810-31164832 TTGATGTCCTGTTGCAGAGAGGG - Intergenic
1164913916 19:32034644-32034666 TGAATGACCTTGGGCAGGGCTGG - Intergenic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1165828263 19:38717912-38717934 TTGATGTCCTGGGGCAGGGCAGG - Exonic
1166679341 19:44757631-44757653 TTAATGTCCTGCGGCGGGGAGGG - Exonic
1166808430 19:45500532-45500554 TTTACCTCCTGGGGGAGGGCTGG + Exonic
1166976314 19:46607139-46607161 TTGTTGTTCTTGGGGAGGGCAGG - Intronic
1167262599 19:48467529-48467551 TTGCTGTCCCTGGGCTGGGCAGG - Intronic
1167286037 19:48599434-48599456 TTGATGCGCTGTGGCAGGGCAGG + Intergenic
1167345373 19:48942412-48942434 GGGAAGTCCTGGGTCAGGGCAGG - Intronic
1167796467 19:51712939-51712961 TTAATCCCCTGGGGCAGGGTTGG - Intergenic
1168559361 19:57370388-57370410 TTGGTGTTCTGGGGCAGGACTGG + Intronic
1168562526 19:57395982-57396004 TTGGTGTTCTGGGGCAGGACTGG + Intronic
1202713349 1_KI270714v1_random:29049-29071 GTGCTGGGCTGGGGCAGGGCAGG - Intergenic
924999107 2:391056-391078 TTGTCGTCGTGGGGCAGGGATGG + Intergenic
925094580 2:1185724-1185746 ATGATTTCCTGGGCCAGGCCCGG - Intronic
925169545 2:1742817-1742839 TGGAGGCCCTGGGGCGGGGCGGG - Intronic
926172152 2:10559192-10559214 CTGGGGTCCTGGGGCTGGGCAGG - Intergenic
927152338 2:20203215-20203237 GTGAAGTCCTGTGGGAGGGCAGG + Exonic
927207812 2:20621121-20621143 TTCTTGCCCTGGGGCAGGGCCGG + Intronic
927895752 2:26780672-26780694 TGGATCTCCTAGGGCTGGGCTGG + Exonic
928091525 2:28377720-28377742 TTGCTCAGCTGGGGCAGGGCTGG - Intergenic
928185095 2:29102936-29102958 CTGAGGTCCTGGGGCAGGGTGGG - Intronic
928391731 2:30915738-30915760 TGGAGGTCCTGTGGCAGGCCAGG + Intronic
929597869 2:43187419-43187441 TGGGGGTCCTGGGGAAGGGCTGG - Intergenic
929613906 2:43293102-43293124 TGGAGGTACTGGGGCAGGCCTGG + Exonic
932735215 2:74249641-74249663 CTGCTGTGCTGGGGAAGGGCAGG + Intronic
933774162 2:85761769-85761791 TGGTAGTCCTGGGGCAGGGAAGG - Intronic
933776319 2:85773380-85773402 GTGGGGTCCTGGGGCAGGGCCGG + Intronic
935019114 2:99213485-99213507 TTGATTTCCTGGGTGAGGGTGGG - Intronic
935249473 2:101248952-101248974 TTGATTAGTTGGGGCAGGGCAGG + Intronic
935260303 2:101350021-101350043 TTGAGGGCCTGGCCCAGGGCCGG + Exonic
937477603 2:122229162-122229184 TTGTGGTCCTGGGGCAGGTTTGG + Intergenic
938506011 2:131883929-131883951 TTCATGTCCTTTGCCAGGGCAGG + Intergenic
940251341 2:151679949-151679971 TGGATGAACTGGGGCAGGTCTGG + Exonic
942111411 2:172686267-172686289 TGGATTTCCTGGGTCAAGGCGGG + Intergenic
942693775 2:178615554-178615576 TTGAAGTTATGGGGCAAGGCAGG - Intronic
944838981 2:203607554-203607576 TTGCTGACCTGGGGCTGGGCAGG + Intergenic
946101966 2:217333052-217333074 TTGATCAGTTGGGGCAGGGCAGG + Intronic
946231888 2:218296531-218296553 GTGGAGTCCTGGGGCTGGGCTGG - Intronic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
947598596 2:231430247-231430269 TTGATCAGCTGGGGCAGGGCAGG + Intergenic
947948289 2:234125287-234125309 ATGGTGTCCAGGGGCAGGGTGGG + Intergenic
947991096 2:234488104-234488126 GAGATTTCCTGGGGCAGGGAGGG - Intergenic
948940080 2:241191067-241191089 TGAGTGTTCTGGGGCAGGGCGGG + Intronic
1169002480 20:2178007-2178029 GTGATAGCCTGGAGCAGGGCTGG - Intergenic
1169074545 20:2752702-2752724 TTGAGGTTCTGCGGCAGGGGAGG - Intronic
1169899061 20:10534634-10534656 TTCAGCTCCTGGCGCAGGGCTGG + Intronic
1170044044 20:12066550-12066572 TTGATTTCCTGGCCCATGGCAGG + Intergenic
1170224237 20:13974136-13974158 TTGATGTTCAGGTGCAGGGCTGG + Intronic
1171300245 20:24053317-24053339 TTGACCTGCTGGGGCAGGGGTGG + Intergenic
1171795086 20:29560264-29560286 GTGATGACAGGGGGCAGGGCAGG - Intergenic
1171853367 20:30324001-30324023 GTGATGACAAGGGGCAGGGCAGG + Intergenic
1171977629 20:31605628-31605650 TTGCGGTTCTGGGGCAGGGTGGG - Exonic
1172181854 20:33008416-33008438 CTGTGGGCCTGGGGCAGGGCTGG + Intronic
1172598223 20:36165270-36165292 TTAATGTCCTGGGCCAGGCGCGG - Intronic
1172608468 20:36231623-36231645 GTGCTGGCCTGAGGCAGGGCAGG + Exonic
1172621017 20:36318668-36318690 TTAAGATCCTGGGCCAGGGCTGG - Intronic
1172753900 20:37270111-37270133 CTGAGATCCTGGGGCAGGGCTGG - Intergenic
1172853620 20:37984270-37984292 TTATTCTCCTGGGGCAGGACTGG + Intronic
1173513746 20:43650277-43650299 TTGATTTCCTGGGACAGTGGGGG + Intergenic
1174356709 20:50003179-50003201 TTAAAATCCTGGTGCAGGGCCGG - Intergenic
1174452872 20:50630669-50630691 TTAATGGGCTGGGGAAGGGCAGG - Intronic
1175230565 20:57471013-57471035 TTAATTCCCTGGGGCAGTGCAGG + Intergenic
1175302556 20:57953096-57953118 TTGAGGGGCTGGGACAGGGCTGG + Intergenic
1175816833 20:61887335-61887357 TTGATTTCGAGAGGCAGGGCAGG - Intronic
1176117421 20:63439170-63439192 TTGTTGCCCCAGGGCAGGGCAGG - Intronic
1176146839 20:63569253-63569275 TTGAACTCCAGGGCCAGGGCAGG + Exonic
1176248585 20:64109390-64109412 CTGCTGTCCTGGGGTGGGGCTGG + Intergenic
1176248607 20:64109461-64109483 CTGCTGTCCTGGGGTGGGGCTGG + Intergenic
1176327560 21:5515234-5515256 TTGAAGTCTTGGGGAAGGTCTGG + Intergenic
1176400197 21:6305717-6305739 TTGAAGTCTTGGGGAAGGTCTGG - Intergenic
1176436960 21:6683387-6683409 TTGAAGTCTTGGGGAAGGTCTGG + Intergenic
1176461222 21:7010457-7010479 TTGAAGTCTTGGGGAAGGTCTGG + Intergenic
1176484783 21:7392235-7392257 TTGAAGTCTTGGGGAAGGTCTGG + Intergenic
1176787062 21:13269809-13269831 TTCATGTCCTTTGCCAGGGCAGG - Intergenic
1177582076 21:23036913-23036935 TTAATGTCCTGAGGCAGGTGAGG - Intergenic
1177986228 21:27978448-27978470 TTCATGTCCTTTGCCAGGGCAGG - Intergenic
1179146270 21:38770702-38770724 GGGATCTCCTGGGGCAGAGCTGG + Intergenic
1179536665 21:42057250-42057272 TGGCTTTCCTGGGGAAGGGCGGG - Intergenic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180725192 22:17941817-17941839 GTGATGGCCTGGGGCAGGCGTGG + Intronic
1181135211 22:20760774-20760796 TTGGTCTCCTGGGCTAGGGCTGG + Intronic
1181953164 22:26569337-26569359 AAGGTGTCCTGGGGCAGGGAGGG + Intronic
1182003256 22:26938582-26938604 TTGATGTCCTAGGGCTGTGCTGG + Intergenic
1183731907 22:39622860-39622882 TTTCTGTCCTGGGGGACGGCGGG + Intronic
1184376761 22:44118500-44118522 TTGCTGTCCTGGGTTAGGGTGGG + Intronic
1184468149 22:44680863-44680885 TTGAGAACCTGGGGCAGGGCAGG + Intronic
1184648421 22:45908444-45908466 CTGAGGTCGTGGGTCAGGGCGGG - Intergenic
1184856104 22:47147666-47147688 CTGATGTGGTGGGACAGGGCCGG + Intronic
1184856549 22:47149606-47149628 GTGAGCTCCCGGGGCAGGGCTGG - Intronic
1184865483 22:47199699-47199721 GTGAGGGCCGGGGGCAGGGCCGG - Intergenic
949939266 3:9142088-9142110 TTAATGCCTTGAGGCAGGGCTGG - Intronic
952946021 3:38478301-38478323 GTGCTGGCTTGGGGCAGGGCAGG + Intronic
953568170 3:44051018-44051040 TTGCTGTCTTGGGGTAGGGAGGG - Intergenic
953884850 3:46709384-46709406 CTGGTCTCCAGGGGCAGGGCTGG - Intronic
954372395 3:50175677-50175699 GTGATGACCTGGGTCTGGGCTGG + Intronic
954640975 3:52097536-52097558 AGGATGTCCAAGGGCAGGGCTGG + Intronic
955884468 3:63583174-63583196 TTGATCAGTTGGGGCAGGGCAGG + Intronic
960418288 3:117412298-117412320 TTGGTGTGCTGGGGGAGGGGAGG - Intergenic
960941953 3:122940735-122940757 TTGCTGTCCTGGGGCTGGGCGGG + Intronic
961331801 3:126147013-126147035 TGGATGGCCTGGGGCCAGGCTGG + Intronic
961463321 3:127066851-127066873 ATGGTGTCCAGGGACAGGGCTGG + Intergenic
962250560 3:133833557-133833579 TGGAGCTGCTGGGGCAGGGCGGG - Intronic
963095346 3:141532773-141532795 TTGCTGTACTGAGTCAGGGCAGG - Intronic
963362218 3:144289034-144289056 TTCAGGTCCTGGGGCAGGACGGG + Intergenic
964145219 3:153452911-153452933 TTGATGTCCAAGGGCAGGAGAGG - Intergenic
964300793 3:155283043-155283065 TTGATCAGTTGGGGCAGGGCAGG + Intergenic
964403957 3:156329336-156329358 TTGAGATGCTGGGGCAGGGGTGG + Intronic
965926005 3:173980759-173980781 TTAATGTACTTGGGCAGGGGTGG + Intronic
967992521 3:195142139-195142161 TTGATGTGGTGGAGCAGGGAGGG - Intronic
968433113 4:570640-570662 TTGGTGTCCTGAGGCACTGCAGG - Intergenic
968433441 4:572960-572982 TGGTTGTCCTGGGGCAGGAAAGG + Intergenic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
968810846 4:2799106-2799128 ACGAAGTCCTGAGGCAGGGCGGG - Intronic
968823582 4:2876042-2876064 TTGAAGTCCTGGCGAAGGTCTGG - Exonic
968872802 4:3250212-3250234 TGGGAGTCCTGGGCCAGGGCAGG - Intronic
968916326 4:3498531-3498553 TTGAAGCCAAGGGGCAGGGCCGG - Intronic
969344633 4:6563342-6563364 GGGCGGTCCTGGGGCAGGGCTGG - Intronic
969594774 4:8142803-8142825 GTGTTGTCCTTGGGGAGGGCAGG - Intronic
969720287 4:8889752-8889774 TAAATGTCCAGGGGCGGGGCGGG + Intergenic
970159657 4:13176012-13176034 TTGAAATTCTGAGGCAGGGCAGG - Intergenic
972053721 4:34773624-34773646 TTGATCAGTTGGGGCAGGGCAGG + Intergenic
972555304 4:40175381-40175403 GTGATTACCTGGGGCAGGGTGGG + Intergenic
976130950 4:81883473-81883495 TTGATATCCTGGGGAAGGTGGGG - Intronic
976267057 4:83194639-83194661 GTCATGTCCTGAGGAAGGGCAGG - Intergenic
976351257 4:84062278-84062300 TTGTAGTGCTGGGGCTGGGCTGG - Intergenic
979657269 4:123209808-123209830 TTGAGGTTCTAGGGCAGGGAGGG - Intronic
981592089 4:146375504-146375526 TAGATGTTCTGTGGCAGGGTTGG - Intronic
982139483 4:152304350-152304372 TTGCTGTCCTGAGGACGGGCAGG - Intergenic
982411587 4:155083985-155084007 GTGATGTCCTTGGCCAGGGAGGG + Intergenic
982688469 4:158521280-158521302 TGGATGTCCTGGAGCAAAGCTGG - Intronic
983352605 4:166611302-166611324 GTGATGTCCTGGAGCTGAGCTGG - Intergenic
983451338 4:167914776-167914798 TTGAAGTACTGGAGCAGGTCAGG - Intergenic
985676512 5:1234315-1234337 TGGATGCCCTGGGCCAGAGCTGG + Intronic
986048122 5:4060547-4060569 ACTGTGTCCTGGGGCAGGGCTGG - Intergenic
986173820 5:5334825-5334847 TTGATGTCCTGTGGAGGGACTGG - Intergenic
986346319 5:6838738-6838760 TGGCTGTCATGGGTCAGGGCTGG + Intergenic
986348839 5:6858585-6858607 TTCCTGTCCTGGGGCAGTGCTGG + Intergenic
986370495 5:7075455-7075477 GTGAGGGCCTGGGGCAGGGGAGG - Intergenic
989108061 5:37881865-37881887 TTGATGCCCTGGGGGATTGCCGG + Intergenic
989613980 5:43321091-43321113 TTGATCTGTTGGGGCAGGGCAGG + Intergenic
990005340 5:50938712-50938734 CTTATGGCCTGGGGCAGGTCTGG + Intergenic
992225915 5:74619541-74619563 TTGCTGGCCTGGGCTAGGGCAGG - Intergenic
993290544 5:86062575-86062597 TTGCTGGCGTGGGGGAGGGCTGG + Intergenic
998023968 5:138797363-138797385 TTTATGTCCTGGGAAAGGGATGG - Intronic
998250105 5:140546914-140546936 TTGATGGCCTGGAGCACAGCAGG - Intronic
998957162 5:147450618-147450640 TTGGTTTCCTGTGGTAGGGCTGG - Intronic
1001555321 5:172632987-172633009 TTCATGTCTTGGTGCTGGGCGGG - Intergenic
1001739508 5:174040143-174040165 TTGATCTCAGGGGTCAGGGCAGG + Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002198595 5:177514316-177514338 TTGAGGCACTGGGGTAGGGCTGG - Intronic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1003425192 6:5994464-5994486 TTCCTCTCCTGGGGCTGGGCAGG + Intergenic
1004451498 6:15752174-15752196 TTGCTGTCCTGTGGTTGGGCAGG - Intergenic
1004859164 6:19783371-19783393 TTGATTTCCTTGGCCAGCGCGGG - Intergenic
1005416962 6:25610150-25610172 AAAATGTCCTGGGGCTGGGCTGG - Exonic
1006834958 6:36992380-36992402 TAGAACTCCTGGGGCTGGGCTGG - Intergenic
1007533529 6:42564220-42564242 CTGATTGCCTGGGGCAGGGGTGG + Exonic
1007591203 6:43021785-43021807 GTGAGGGCATGGGGCAGGGCGGG + Intronic
1007752694 6:44080027-44080049 TTGATTTCCTTAGTCAGGGCTGG - Intergenic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1010381576 6:75231679-75231701 CTTGTGTCCTGGGGCAGAGCTGG - Intergenic
1010465870 6:76166267-76166289 CTGAAGTCCTCAGGCAGGGCAGG - Intergenic
1013106921 6:107033520-107033542 TCAAAGTCCTGAGGCAGGGCCGG + Intronic
1014913738 6:127120625-127120647 CTCATGCCCAGGGGCAGGGCAGG - Intronic
1014974530 6:127862709-127862731 TTCATCTCCTGGGGCTGGGTGGG - Intronic
1015595842 6:134865962-134865984 TTTATGTCCTAGGTGAGGGCAGG - Intergenic
1016557369 6:145353611-145353633 TGCTTGTCCTGAGGCAGGGCTGG - Intergenic
1017757902 6:157545178-157545200 GTGATTTCCTGGGGCTGGGAGGG + Intronic
1018003179 6:159597500-159597522 TGGAGTTCCTGGGGCAGGGAGGG - Intergenic
1018050914 6:160006662-160006684 CTGAAGTCTTGGGGCAGGGGCGG - Intronic
1019115970 6:169762965-169762987 TTCATGACCTGCTGCAGGGCTGG - Intronic
1019385649 7:754648-754670 GTGATGTCGTGGCACAGGGCAGG - Exonic
1019515604 7:1438555-1438577 TTGCTGACCTGGAGGAGGGCAGG - Intronic
1020274907 7:6617922-6617944 GTGAGGGCCTGGGGCAGGGCGGG + Intronic
1022391259 7:29946636-29946658 TTGATGTCCTCTGGCAGAGTTGG + Intronic
1022778933 7:33558403-33558425 TTGATGGGCTTGGGCATGGCAGG + Intronic
1023824201 7:43997797-43997819 TTGATGACCTGGGGCTGGGTGGG - Intergenic
1025943542 7:66089790-66089812 TGGAGGACCTGGGGCAGGGAAGG + Intronic
1026538352 7:71259106-71259128 TTGAGTTCATGGGGTAGGGCTGG + Intronic
1026912290 7:74098003-74098025 TTGATGTGCTAGGGGAGGGAGGG - Intronic
1026915169 7:74115724-74115746 TTGGGGTCCTGGGGAGGGGCAGG + Intronic
1026942244 7:74293830-74293852 CTCCTGTCCCGGGGCAGGGCTGG - Intronic
1027144999 7:75688255-75688277 TTCCTCCCCTGGGGCAGGGCAGG + Intronic
1027327897 7:77062636-77062658 TTGGTGACCTGGGGCTGGGTGGG + Intergenic
1029357802 7:100065663-100065685 TTGATTGGCTGGGGAAGGGCAGG + Intronic
1029752467 7:102551126-102551148 TTGATGACCTGGGGCTGGGTGGG - Intronic
1029770419 7:102650219-102650241 TTGATGACCTGGGGCTGGGTGGG - Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1032794607 7:135267760-135267782 TGGCTGTGCTGGGGCAGAGCTGG + Intergenic
1033229308 7:139584130-139584152 TTCATGCCCTGGGGCAGGGGAGG + Intronic
1033717980 7:144022641-144022663 TTGGGGTAGTGGGGCAGGGCAGG + Intergenic
1034560189 7:151875514-151875536 TTGCTCTCCCGGGGCAGGGTGGG - Intronic
1034738933 7:153455413-153455435 TTGCTGTCTAGGGACAGGGCTGG + Intergenic
1035749062 8:1983025-1983047 TTGATGTCCTGGGTGAGGCTTGG + Intronic
1036189604 8:6658379-6658401 TTGATGTCCTGGCCCTGGGAGGG - Intergenic
1036200154 8:6764081-6764103 TTGCTGACCAGTGGCAGGGCAGG - Intergenic
1036705027 8:11040220-11040242 TTGAGGGACTGAGGCAGGGCCGG - Intronic
1038610456 8:29055878-29055900 GGGATGTCCTGGGGCAGGGGTGG + Intronic
1038768410 8:30452384-30452406 TAGATGTCACTGGGCAGGGCTGG + Intronic
1039971848 8:42326944-42326966 ATGATTACCTGGGGCAGGGGAGG + Intronic
1041735864 8:61109860-61109882 GTGGAGTCCTGGGGCAGTGCAGG - Intronic
1043498578 8:80830450-80830472 GTGATTTCCTGGGGCTGGGGTGG + Intronic
1043506129 8:80904826-80904848 TTGAAGTTCTGGGGAAGGGGAGG - Intergenic
1044718166 8:95120457-95120479 GGGATGGCCTGGGGTAGGGCAGG - Intergenic
1047421496 8:124711509-124711531 TTGCAGCCCTGGGGCTGGGCTGG - Intronic
1047776026 8:128071234-128071256 TTGACATCATGGTGCAGGGCAGG - Intergenic
1047799944 8:128298447-128298469 GTGGGGTCCTTGGGCAGGGCAGG + Intergenic
1048779155 8:137982391-137982413 TGGCTGTCCTGGGGCACCGCAGG - Intergenic
1049497396 8:142942721-142942743 TTGCAGTGCTGGGGCTGGGCTGG - Intergenic
1049860370 8:144894228-144894250 TGGTTGTCATGGGGCAGGGAGGG - Intronic
1052999912 9:34572174-34572196 TGGATCTGCAGGGGCAGGGCAGG - Intronic
1053791167 9:41687300-41687322 GTGATGACAGGGGGCAGGGCAGG + Intergenic
1054153984 9:61627472-61627494 GTGATGACAGGGGGCAGGGCAGG - Intergenic
1054179515 9:61898994-61899016 GTGATGACAGGGGGCAGGGCAGG + Intergenic
1054473768 9:65558592-65558614 GTGATGACAGGGGGCAGGGCAGG - Intergenic
1054658023 9:67681827-67681849 GTGATGACAGGGGGCAGGGCAGG - Intergenic
1057874562 9:98743997-98744019 TAGATGTCAAGGGGGAGGGCAGG - Intronic
1059245496 9:112846385-112846407 TAGATGTCCTGGGGCAATGTTGG - Intronic
1059432937 9:114260656-114260678 TTGATGGCCAGGGGCAAGGGAGG + Intronic
1060307694 9:122431032-122431054 CTGAGGTCTTGGGGCAGGACAGG - Intergenic
1060828940 9:126701942-126701964 GAGACGTCCTGGGCCAGGGCTGG + Intergenic
1061193140 9:129093857-129093879 TTGTGGTCCTGAGGCTGGGCCGG + Intergenic
1062074204 9:134575651-134575673 TGGAATTCCTGAGGCAGGGCAGG - Intergenic
1062243435 9:135551636-135551658 GTGAGGGCCTTGGGCAGGGCAGG + Intergenic
1062283966 9:135764917-135764939 TTAGGGGCCTGGGGCAGGGCCGG - Intronic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062630451 9:137460921-137460943 GTGATGTGCTGGGGCAAAGCTGG - Intronic
1203434550 Un_GL000195v1:125273-125295 TTGAAGTCTTGGGGAAGGTCTGG - Intergenic
1185523146 X:756808-756830 TTGAGGTCCTGGTCCTGGGCAGG - Intergenic
1185523163 X:756897-756919 TTGAGGTCCTGGTCCTGGGCAGG - Intergenic
1185774136 X:2788556-2788578 CAAAAGTCCTGGGGCAGGGCTGG + Intronic
1186383264 X:9083593-9083615 TGGATATCCTGGTGGAGGGCTGG - Intronic
1186512827 X:10143276-10143298 TGGGTGTCCTGGGGCCGGGGTGG - Exonic
1186641060 X:11456414-11456436 TTAATGACATTGGGCAGGGCAGG - Intronic
1187270542 X:17776100-17776122 TTGATCTCCTGGTGCAGCGGCGG + Intergenic
1187319966 X:18229625-18229647 TTGATCTCCTGGTGCAGCGGCGG - Intergenic
1189277512 X:39797520-39797542 TTGATGTCATGGCTCAGGGCAGG - Intergenic
1191234170 X:58120727-58120749 TTGAAGTCCTGGGGTCGGCCAGG - Intergenic
1192439517 X:71164387-71164409 TGGATGCCCTGGGGCATGGATGG - Intronic
1194542420 X:95190586-95190608 ATGATTTACTGGGGCAGGCCTGG - Intergenic
1194588376 X:95766329-95766351 TGTATGTGCTGGGGCAGGGATGG - Intergenic
1195862859 X:109399955-109399977 TTGATGAAGTGGGGGAGGGCGGG + Intronic
1197273344 X:124449821-124449843 TTGAGTTTCTGGGGCAGGGCAGG + Intronic
1200116439 X:153771733-153771755 TTGGGGGCCTGGGGCAGGGCTGG - Intronic
1201295630 Y:12460841-12460863 CAAAAGTCCTGGGGCAGGGCTGG - Intergenic