ID: 1165828669

View in Genome Browser
Species Human (GRCh38)
Location 19:38719819-38719841
Sequence GGCCAAGGGGCTGGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2812
Summary {0: 1, 1: 5, 2: 40, 3: 362, 4: 2404}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165828658_1165828669 5 Left 1165828658 19:38719791-38719813 CCATGAGGCCCTGCAGATGGTTT 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG 0: 1
1: 5
2: 40
3: 362
4: 2404
1165828655_1165828669 19 Left 1165828655 19:38719777-38719799 CCCTCTACAGGGCTCCATGAGGC 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG 0: 1
1: 5
2: 40
3: 362
4: 2404
1165828661_1165828669 -4 Left 1165828661 19:38719800-38719822 CCTGCAGATGGTTTCCTGAGGCC 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG 0: 1
1: 5
2: 40
3: 362
4: 2404
1165828660_1165828669 -3 Left 1165828660 19:38719799-38719821 CCCTGCAGATGGTTTCCTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG 0: 1
1: 5
2: 40
3: 362
4: 2404
1165828656_1165828669 18 Left 1165828656 19:38719778-38719800 CCTCTACAGGGCTCCATGAGGCC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG 0: 1
1: 5
2: 40
3: 362
4: 2404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165828669 Original CRISPR GGCCAAGGGGCTGGGTGTGG TGG Intronic
Too many off-targets to display for this crispr