ID: 1165829680

View in Genome Browser
Species Human (GRCh38)
Location 19:38724234-38724256
Sequence CGATCCTCTGGGCCTCCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 2, 1: 0, 2: 2, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165829680_1165829684 5 Left 1165829680 19:38724234-38724256 CCACAAGGAGGCCCAGAGGATCG 0: 2
1: 0
2: 2
3: 10
4: 125
Right 1165829684 19:38724262-38724284 AGCAACCACATCAAGCTGTCGGG 0: 1
1: 1
2: 1
3: 8
4: 143
1165829680_1165829683 4 Left 1165829680 19:38724234-38724256 CCACAAGGAGGCCCAGAGGATCG 0: 2
1: 0
2: 2
3: 10
4: 125
Right 1165829683 19:38724261-38724283 GAGCAACCACATCAAGCTGTCGG 0: 1
1: 0
2: 2
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165829680 Original CRISPR CGATCCTCTGGGCCTCCTTG TGG (reversed) Exonic
900117231 1:1033899-1033921 CGATCCTCTGGAACTCCCCGCGG + Intronic
901218062 1:7565657-7565679 CCATACTGTGGGGCTCCTTGGGG + Intronic
903033667 1:20480867-20480889 CGATCCTTTTGGCCTCTCTGGGG + Intergenic
903603220 1:24556739-24556761 CAGTCCTCTGGGTATCCTTGTGG + Intronic
904321069 1:29698165-29698187 CAAGCCTGTGAGCCTCCTTGTGG - Intergenic
904546796 1:31280617-31280639 CTTTCCTCTTGGCTTCCTTGGGG - Intronic
904602881 1:31683490-31683512 TGACCCTCAGGGTCTCCTTGGGG - Intronic
905412204 1:37778458-37778480 TGATCCTCTGGGCTTCCTTGTGG - Intergenic
907340425 1:53731422-53731444 CCTTCCTTTGGGCTTCCTTGGGG + Intronic
907480715 1:54743923-54743945 CGAGCCTCTGGCCCTGCTGGGGG - Intergenic
910432531 1:87173196-87173218 CAATCTTCTGGGCCTCTTTCTGG + Intergenic
912700588 1:111875535-111875557 TGATCCTCAGGGTCCCCTTGGGG - Intronic
920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG + Intronic
922223944 1:223628981-223629003 GGATCCTCTGCTCCTCCCTGTGG + Intronic
922715237 1:227866786-227866808 CCATCCTGTGAGCCTCCATGAGG + Intergenic
922764175 1:228149039-228149061 CCATCTTGTGGCCCTCCTTGGGG - Intergenic
1069949865 10:72011365-72011387 CGATGCTCTGGGAACCCTTGGGG + Exonic
1070537291 10:77389312-77389334 CGATCCTCAGCCCCTCCTGGGGG + Intronic
1070686980 10:78492023-78492045 CTATGCTTTGGCCCTCCTTGTGG + Intergenic
1074215275 10:111378156-111378178 AGATCCTATGGGCTTCCTTCTGG - Intergenic
1075041825 10:119114079-119114101 AAACCCTCTGGGCCTCCTTCTGG - Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076853406 10:133103887-133103909 CCATCCTCTGGGGTTCCCTGGGG + Intronic
1077366589 11:2163708-2163730 CGAGCCTCTGGAGCTGCTTGGGG + Intergenic
1079166603 11:18049931-18049953 CTATTCTCTTGACCTCCTTGTGG - Intergenic
1081509718 11:43757922-43757944 CTATCCTCTGGGCCCATTTGGGG + Intronic
1083332428 11:61905164-61905186 AGACCCTCAGTGCCTCCTTGAGG + Intronic
1084968785 11:72758223-72758245 GGGTCCTCTGGTCCTCCCTGAGG - Intronic
1087701405 11:101440459-101440481 CCATGCTCTGGCCCTTCTTGTGG + Intergenic
1090182833 11:124716112-124716134 GTATCCTCTGGGCCTTCCTGGGG - Intergenic
1090502592 11:127275949-127275971 GGCACCTCTGGGCCTGCTTGCGG + Intergenic
1090751029 11:129746683-129746705 CCCTGCTCTGGGCCTTCTTGAGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1093535612 12:20219290-20219312 TGGTCCTCTGGGCCTTCTTGTGG + Intergenic
1097272565 12:57786177-57786199 CCTCCTTCTGGGCCTCCTTGTGG - Exonic
1099090875 12:78306057-78306079 CGGTGCTCTGGGCCTGGTTGTGG + Intergenic
1100764153 12:97845278-97845300 CCATCTTCTGGGGCTCCTTGGGG + Intergenic
1101217667 12:102600917-102600939 TAATCTTCTGGGCCTCTTTGGGG + Intergenic
1101320692 12:103670569-103670591 TGACCCTCTGGGACTCCTCGTGG - Intronic
1101530739 12:105571105-105571127 CCATACTCTGGGCCCGCTTGGGG + Intergenic
1105957836 13:25301034-25301056 CGCTCTTCTGGGCCCCCTTCGGG + Intergenic
1106701638 13:32235225-32235247 CTATCTTGAGGGCCTCCTTGTGG - Intronic
1110817320 13:79876392-79876414 CTCTCCTCTGAGCCTCCCTGAGG + Intergenic
1123702749 15:22927989-22928011 CCGTCTTCTGGGCCTCCTGGCGG + Exonic
1125795675 15:42402490-42402512 AAGTCCTCTAGGCCTCCTTGGGG + Intronic
1129239926 15:74245149-74245171 CACTCCTCTGGGGCTCCCTGAGG + Intronic
1131413431 15:92230377-92230399 AGAACTTCTGGGCCTTCTTGGGG + Intergenic
1133223216 16:4328050-4328072 CGCCCCTCTGCGCCTCCTGGTGG - Intronic
1136775797 16:32871151-32871173 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1136894820 16:33990361-33990383 CGCTCCTCTGGACTTCCCTGCGG + Intergenic
1141386058 16:83623433-83623455 CCCTCTTCTGGGGCTCCTTGAGG + Intronic
1141839954 16:86567944-86567966 CCTTCTTCTCGGCCTCCTTGGGG - Exonic
1203078213 16_KI270728v1_random:1133260-1133282 CGCTCCTCTGGACTTCCCTGCGG - Intergenic
1143116264 17:4583483-4583505 CCAGCCTCTGGGCCTCTTTCAGG + Intergenic
1144873357 17:18383494-18383516 CCATCTTCAGGGCCTCCTGGTGG - Exonic
1147600467 17:41742097-41742119 GGATGCTCTGGGCTTCCTGGAGG - Intergenic
1147669423 17:42168185-42168207 CAATACTCTGGGTCTCCCTGAGG + Intronic
1148437742 17:47695890-47695912 CCATCCTCTCTGCCGCCTTGGGG - Exonic
1148887060 17:50781471-50781493 CGATCTTCTGGGTCTCCGGGTGG + Intergenic
1149313934 17:55421696-55421718 TGATCCTCTGCTCCTCCTCGGGG + Exonic
1149616494 17:58005451-58005473 TGATCCTCTGCTTCTCCTTGGGG + Exonic
1150645615 17:66975945-66975967 AGTTCCTCTCTGCCTCCTTGGGG - Intronic
1151351535 17:73534852-73534874 GCATCTTCTAGGCCTCCTTGTGG + Intronic
1151504177 17:74515564-74515586 CTAACCTCAGGGCATCCTTGGGG - Intergenic
1151682436 17:75629130-75629152 CGATGCTCTGAGAATCCTTGTGG + Exonic
1151747884 17:76021539-76021561 CCATCTTCAGGGCCTCCTGGTGG + Exonic
1153676092 18:7456906-7456928 TGTTCCTCTGAGCATCCTTGAGG + Intergenic
1153796441 18:8627272-8627294 CAATCCACTGCGCCTCCTTGAGG - Intronic
1155310810 18:24521183-24521205 CGTTTCTCTGGGCCTCCCTGGGG - Intergenic
1155536853 18:26827747-26827769 CGACCCTGTGAGCCTCCTTGAGG + Intergenic
1157184238 18:45524510-45524532 GGCTGCTCTGGGCTTCCTTGAGG - Intronic
1160368444 18:78349855-78349877 AGATCATGCGGGCCTCCTTGTGG + Intergenic
1160888829 19:1366150-1366172 CGTTTCTCAGCGCCTCCTTGCGG + Intronic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1161604232 19:5205776-5205798 GGATCCTCTCTGTCTCCTTGGGG + Exonic
1161618512 19:5286080-5286102 TGGTCCCATGGGCCTCCTTGTGG - Exonic
1162034910 19:7933554-7933576 CGACCCCCAGGGCCTCCCTGGGG + Exonic
1162567108 19:11450690-11450712 CGCCCCTCTGGGCCTGCCTGTGG + Exonic
1163294321 19:16402431-16402453 GGCTCCTGTGGGCCTCCTGGCGG + Exonic
1164751378 19:30657537-30657559 TGCTCTTCTGGCCCTCCTTGGGG + Intronic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
1166948548 19:46411986-46412008 AGATCAACTGGGCCTCCTTTCGG - Exonic
928171165 2:29003737-29003759 AGATCCACTGGGGCTCCTTGTGG + Intronic
929824431 2:45299318-45299340 GGATCCTCTGACCTTCCTTGAGG + Intergenic
932944962 2:76218116-76218138 GGTTCCTCTCAGCCTCCTTGAGG + Intergenic
935686361 2:105687532-105687554 GGCTCCTGTGGGCCTCGTTGAGG - Intergenic
937851727 2:126642204-126642226 CCTTCCTCTGGGCTTCCTTTGGG + Intergenic
938556525 2:132429758-132429780 TGATTCTCTGGCCCTCCTAGGGG + Intronic
939035395 2:137124642-137124664 AGATCCTGTGTGCCTCCATGTGG + Intronic
944920014 2:204402936-204402958 ATATCCTCTGGGCCTTCCTGGGG + Intergenic
945620907 2:212135882-212135904 CCATCATCTGGCTCTCCTTGAGG + Intronic
948897262 2:240933280-240933302 CGAGCCTCTGGGCCTCCAGCTGG - Intronic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1175977795 20:62721305-62721327 CCATCCTCTGGGTCATCTTGAGG + Intronic
1176033365 20:63024494-63024516 GGAGCCTCTGGGCCTCCTGTGGG + Intergenic
1179495090 21:41766582-41766604 GGCTCCTCTGGGGCTCCTCGGGG - Intronic
1179988729 21:44934829-44934851 TGATCCTCTGGACATCCCTGGGG - Exonic
1180160331 21:45996285-45996307 TGAGCTTCTGGACCTCCTTGAGG + Intronic
1181166062 22:20983704-20983726 TGGTCCTGTAGGCCTCCTTGGGG + Intronic
1182260595 22:29071224-29071246 GGATCCTCTGGGCCTCTTATTGG - Intergenic
1183094886 22:35546058-35546080 CGGGCCTCTGGGTCTCCTGGAGG + Intronic
1183828777 22:40407181-40407203 TGGTTCTCTGGGCCTCCTAGGGG + Exonic
1184382606 22:44155307-44155329 GGGGCCTCTGGGCCTCCGTGGGG + Intronic
1184986579 22:48140142-48140164 TCATCCTCTGGGCATCTTTGCGG + Intergenic
949479161 3:4477044-4477066 CCATCCTCTTGGCATCCTTTGGG + Intergenic
952583025 3:34856801-34856823 CTTTCCCCTGGGCCTCCTTCAGG + Intergenic
953435612 3:42874962-42874984 TGATGCTCTGGGCCTCCCAGGGG - Exonic
953947621 3:47163510-47163532 CGGTCCTCTCGGGCTCCTCGTGG - Intronic
955042284 3:55329345-55329367 CTCTCCTTTGGGCCTCCTGGAGG - Intergenic
963895593 3:150682351-150682373 AGAGCCTCTGGGCCTCTTTGTGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968958197 4:3729870-3729892 CCATCCTCTGAGCTTCCTGGGGG - Intergenic
974468788 4:62292442-62292464 CCATCCCCTGGGTTTCCTTGTGG + Intergenic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
986351307 5:6882227-6882249 CCTTTCTCTGGGCCTCCCTGTGG + Intergenic
986357172 5:6940095-6940117 AGATCCACTGGGCCTCCTGCTGG - Intergenic
999197595 5:149793094-149793116 CCATCATCTGGGCCTCCCTGTGG + Intronic
1003847909 6:10192982-10193004 GGGTCCTCAGGGACTCCTTGGGG - Intronic
1006020061 6:31112507-31112529 CGCTCCTCTGGGCCTGCTCCTGG - Exonic
1014258426 6:119187433-119187455 CAATTCTCTAGGCCTCTTTGAGG - Intronic
1018928134 6:168221595-168221617 CCATGCTCTGGGCCTGCTTTTGG + Intergenic
1022191005 7:28016755-28016777 CGATCCCCTGGGCTGCCTTTTGG - Intronic
1023870168 7:44259024-44259046 CGATCCTCTGGGCAGCCCTAGGG - Intronic
1024197364 7:47072412-47072434 CGATACCCTGGCCCTCCTTGAGG - Intergenic
1025177687 7:56810294-56810316 AGAACCTCTGGGCCCACTTGAGG - Intergenic
1025694066 7:63765945-63765967 AGAACCTCTGGGCCCACTTGAGG + Intergenic
1026896737 7:74013794-74013816 AGCTCCTCTGGGTCTCCTGGGGG - Intergenic
1029215189 7:98942987-98943009 CGCTCCTCTGGCCCCCTTTGTGG - Exonic
1031876330 7:127146024-127146046 GGATGCTCTGGGCCTCTCTGGGG + Intronic
1034938238 7:155213537-155213559 GGGGCCTCTGGGCCTCCATGAGG - Intergenic
1046098937 8:109592530-109592552 TGACCCTCTTGGCCTCCTTAAGG - Intronic
1048915202 8:139176059-139176081 CTTTCCTCTGAGCCTTCTTGGGG - Intergenic
1049424826 8:142533285-142533307 CCATCCCCAGGGCCTCCCTGTGG + Exonic
1052499219 9:29267883-29267905 TGATCCTCTGCCCTTCCTTGGGG + Intergenic
1056128813 9:83564084-83564106 CCAGCCTCTGGGACTCCTGGAGG - Intergenic
1056714811 9:89020438-89020460 CTTCCCTCTGGGCCTCCTTCAGG + Intronic
1062111593 9:134785069-134785091 CGGTCCTCTGGGACCCCCTGGGG + Exonic
1062450795 9:136614913-136614935 CCCTCCTCTGGGCTTCCTGGTGG - Intergenic
1189175231 X:38950039-38950061 GCCTCCTCTGAGCCTCCTTGGGG + Intergenic