ID: 1165830876

View in Genome Browser
Species Human (GRCh38)
Location 19:38729612-38729634
Sequence GGAGGTTCCCCCGACCAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165830871_1165830876 2 Left 1165830871 19:38729587-38729609 CCTCTCTCTCTTTGTGGGTTGGC 0: 1
1: 1
2: 3
3: 30
4: 258
Right 1165830876 19:38729612-38729634 GGAGGTTCCCCCGACCAGGTTGG 0: 2
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165830876 Original CRISPR GGAGGTTCCCCCGACCAGGT TGG Exonic
902871711 1:19317646-19317668 GGAGGGGCCCCCGGCCAGGCAGG - Exonic
903326535 1:22572072-22572094 AGAGGTTCCCCCTCCCAGCTGGG - Intronic
909480819 1:76127812-76127834 GGAGGCTCTCACCACCAGGTAGG + Intronic
915490129 1:156246108-156246130 GGAGCCTCCCCTCACCAGGTGGG + Exonic
923428488 1:233895851-233895873 GAAGGTTCCCCCCTCCAAGTAGG - Intergenic
1064344569 10:14520268-14520290 GAAGGTTCCCATGACCAGCTGGG - Exonic
1082867941 11:57916868-57916890 GGAGGTTGCCTCGATCAGCTCGG - Intergenic
1094821745 12:34231528-34231550 GGAGGATCCCTTGACCAGGGAGG + Intergenic
1101648737 12:106655502-106655524 GGAGGTGCCCCTCAGCAGGTGGG + Intronic
1103380710 12:120491990-120492012 GGAGGTTCCATCTACCATGTGGG + Intronic
1104859070 12:131915404-131915426 GCAGGTCCCCTCGTCCAGGTGGG + Exonic
1107940215 13:45376531-45376553 GGAGGCACCCCCCACGAGGTAGG - Intergenic
1107940491 13:45377607-45377629 GGAGGCACCCCCCACGAGGTGGG - Intergenic
1112238882 13:97661395-97661417 TGAGGTCCCCCCGCGCAGGTGGG - Intergenic
1113615957 13:111680930-111680952 GGAGGATCCCACGAGCAGTTTGG - Intergenic
1113621425 13:111765823-111765845 GGAGGATCCCACGAGCAGTTTGG - Intergenic
1114519497 14:23324349-23324371 GGAGGTTCCTCAGACCAGAGAGG - Intronic
1121823768 14:96993558-96993580 TGAGGTTCCCTCTACCATGTCGG + Intergenic
1122251444 14:100442716-100442738 GGAGGTTTCCCTGAAAAGGTTGG - Intronic
1122941290 14:104982556-104982578 GGAGGACCCCCTGACCAGGTGGG + Intergenic
1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG + Intronic
1128613434 15:69091411-69091433 GGAGGTGCCCCAGCCCAGGGGGG - Intergenic
1132996759 16:2827456-2827478 GGGGGTGCCTCCCACCAGGTGGG + Intergenic
1138512884 16:57518757-57518779 GGTGGTTCTCATGACCAGGTGGG - Intronic
1139081382 16:63525490-63525512 GGAGGTTGCCGAGACCAGCTCGG - Intergenic
1139948572 16:70658144-70658166 GGATGTTCTCCCGACAAGCTGGG - Intronic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1157200333 18:45654057-45654079 CATGGTTCCCCCGACCTGGTTGG - Intronic
1160551724 18:79697677-79697699 CGAGGTTGCCGTGACCAGGTTGG + Intronic
1161976855 19:7611989-7612011 GGAGGTCCCCTCGGGCAGGTAGG - Exonic
1164708247 19:30336084-30336106 GGAGGTGACCCCGCCCAGGCTGG + Intronic
1165830876 19:38729612-38729634 GGAGGTTCCCCCGACCAGGTTGG + Exonic
1166818698 19:45563089-45563111 TCAGGTTCACCCGTCCAGGTGGG + Intronic
1168358059 19:55714541-55714563 GAAGGTTCCCAGAACCAGGTGGG + Intronic
925313157 2:2902274-2902296 GGAGGTTCTGCCGCCCAGGCTGG + Intergenic
944824704 2:203470287-203470309 GGAGGTTTCCCTGTCCAGATAGG + Intronic
948766388 2:240223702-240223724 GGAAGTTGCTCTGACCAGGTCGG - Intergenic
948912665 2:241012160-241012182 GGAGGTCCCCCACACCAGGCAGG + Intronic
1169214781 20:3786633-3786655 GGAGGTGCCCCCGGCCCGGCCGG - Exonic
1175997112 20:62816917-62816939 GGAAGCCCCCCCGCCCAGGTGGG + Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1179424729 21:41266747-41266769 TGGGGTTCCCACGACCAGGAGGG - Intronic
1179995367 21:44971598-44971620 CGAGGTTTCCCCAACCAGGAAGG + Intronic
1184879996 22:47298648-47298670 GGAGCTACCCCTGACCAGGCCGG - Intergenic
949414435 3:3800004-3800026 TGAGGTTCCCCAGACCCCGTAGG - Intronic
952450743 3:33430370-33430392 AGTGGTTCCCCGGACCAGGCTGG - Intronic
953020018 3:39107330-39107352 GGAGGTGCCCCCTGCCCGGTGGG - Intronic
955830281 3:62994343-62994365 GGAGGGTCGCTAGACCAGGTGGG - Intergenic
969256069 4:6002644-6002666 AGAGCTTCCCCCCACCAGGTGGG + Intergenic
979099815 4:116599794-116599816 GGAGGTTCCCCCGACCAGGTTGG + Intergenic
985708323 5:1414339-1414361 TGAGGTTCCCCAGCCCAGGGTGG + Intronic
985784498 5:1886857-1886879 GGAGCTTCCCCAGCTCAGGTAGG - Exonic
991010930 5:61882353-61882375 GGAGTTTCCCCAAACCAAGTAGG - Intergenic
999224105 5:150005785-150005807 GGAGGTGCCATTGACCAGGTTGG + Intronic
1001407209 5:171484572-171484594 TGAGGCACCCCCCACCAGGTGGG + Intergenic
1005313223 6:24579352-24579374 GGAGGTGCCCCCCACCAGATGGG - Intronic
1017791254 6:157801636-157801658 GGAGGATCCCCTGGCCAGGGAGG + Intronic
1019021648 6:168923580-168923602 TGAGGAGCCCCCGACCAGGCCGG + Intergenic
1023878597 7:44306268-44306290 GGAAGTTCCCCCTTCCAGGGAGG + Intronic
1035756361 8:2035947-2035969 GGGGGTTCCTCTGACCAGGGAGG - Intergenic
1045263210 8:100595661-100595683 GGAAGTTCCCTTGACCAAGTAGG + Intronic
1047958673 8:129995074-129995096 GAGGGTTCCCCCAACCAGGAAGG + Intronic
1057393277 9:94657054-94657076 GGAGGGTCCCCACACCAGATTGG - Intergenic
1060383714 9:123202923-123202945 GGTGGTTGCTCTGACCAGGTTGG - Intronic
1061151967 9:128833897-128833919 AGAGGTTCCCACGACCAGGCGGG + Intronic
1061406298 9:130394632-130394654 GCAGGTTCCCCAGACCCAGTGGG + Intronic
1186295143 X:8141155-8141177 GGAGGTCCCCAAAACCAGGTGGG + Intergenic
1186512318 X:10139152-10139174 GAATGTTCCCCCAACAAGGTGGG - Intronic
1186853913 X:13607612-13607634 GGAGGTTCCACAGAACAGGGTGG + Intronic
1187765627 X:22638519-22638541 GGAGGTTTCATGGACCAGGTAGG - Intergenic
1193086370 X:77450526-77450548 GGAGAGTCCTCCCACCAGGTGGG + Intronic
1200765408 Y:7076760-7076782 GCAGGTGCCCACCACCAGGTCGG - Intronic