ID: 1165831013

View in Genome Browser
Species Human (GRCh38)
Location 19:38730329-38730351
Sequence CACGCCCGACGCAGACCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831013_1165831022 6 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831013_1165831028 17 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG 0: 1
1: 0
2: 13
3: 92
4: 924
1165831013_1165831024 10 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831013_1165831030 30 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464
1165831013_1165831023 9 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831023 19:38730361-38730383 GGACCCTCCAGAGGTGGAGGTGG 0: 1
1: 0
2: 3
3: 37
4: 360
1165831013_1165831021 3 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831013_1165831020 0 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831013_1165831029 22 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831029 19:38730374-38730396 GTGGAGGTGGGCTGATGGCCTGG 0: 1
1: 0
2: 5
3: 57
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831013 Original CRISPR CACGCCCGACGCAGACCCGG AGG (reversed) Exonic