ID: 1165831013

View in Genome Browser
Species Human (GRCh38)
Location 19:38730329-38730351
Sequence CACGCCCGACGCAGACCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831013_1165831024 10 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831013_1165831028 17 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG 0: 1
1: 0
2: 13
3: 92
4: 924
1165831013_1165831020 0 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831013_1165831029 22 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831029 19:38730374-38730396 GTGGAGGTGGGCTGATGGCCTGG 0: 1
1: 0
2: 5
3: 57
4: 523
1165831013_1165831023 9 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831023 19:38730361-38730383 GGACCCTCCAGAGGTGGAGGTGG 0: 1
1: 0
2: 3
3: 37
4: 360
1165831013_1165831030 30 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464
1165831013_1165831022 6 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831013_1165831021 3 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831013 Original CRISPR CACGCCCGACGCAGACCCGG AGG (reversed) Exonic
902503583 1:16925839-16925861 CACACCCGCTGCAGACCCTGGGG - Intronic
908695965 1:66842136-66842158 CAAGCCAGAAGCAGACCTGGAGG - Intronic
1065598584 10:27344812-27344834 CACACCCAAAGCAGCCCCGGGGG - Intergenic
1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG + Intergenic
1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG + Intergenic
1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG + Exonic
1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG + Exonic
1081528304 11:43942203-43942225 CGCGCCCCGCGCAGAACCGGCGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1084587707 11:70072733-70072755 CACGCCCGGCGTACACCCCGTGG + Intergenic
1090074463 11:123571327-123571349 CACGCCCACTGCAGACACGGTGG - Intronic
1102517985 12:113463100-113463122 AACGCCCGACGCAGACGCGGTGG - Exonic
1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG + Intronic
1125126087 15:36222231-36222253 CAGGCCAGACTCAGACCAGGTGG + Intergenic
1132604014 16:786099-786121 CACCCCCGACCCTGACCCCGAGG - Exonic
1133125406 16:3642895-3642917 CACACCAGACGCAGAGCCTGCGG - Intronic
1161264569 19:3358496-3358518 TGCGCCAGACGCAGAGCCGGTGG + Intergenic
1161939833 19:7395335-7395357 GAGGCCCGAGGCAGCCCCGGGGG - Intronic
1163775267 19:19213630-19213652 CACCCCAGACACAGACCCTGGGG - Intronic
1163836644 19:19579057-19579079 CACGCCCGGCCCAGACTGGGTGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG + Intergenic
925084949 2:1100613-1100635 CACGCCCGACACAGCAACGGTGG - Intronic
925742167 2:7015469-7015491 CAGGCCTGATGCAGACCCAGGGG + Intronic
931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG + Intergenic
934735502 2:96687857-96687879 CAAGCCACATGCAGACCCGGAGG - Intergenic
937329703 2:121018938-121018960 CACGCCCGCAGCAGCCCCTGAGG + Intergenic
937912787 2:127083939-127083961 CAAACACGACTCAGACCCGGCGG - Intronic
943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG + Exonic
1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG + Intronic
1175994284 20:62805274-62805296 CGCGCCCGAGGCACCCCCGGGGG - Intronic
1176178769 20:63740178-63740200 GCCGCCCGGCGCAGCCCCGGCGG - Intronic
1181283623 22:21736503-21736525 GGGGCCAGACGCAGACCCGGGGG - Intergenic
1183878445 22:40804770-40804792 CACAATCGACACAGACCCGGAGG - Intronic
1185021717 22:48380373-48380395 CAGGCCAGACCCAGAGCCGGGGG - Intergenic
950660964 3:14466799-14466821 CACACCCGCCACAGGCCCGGTGG - Intronic
951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG + Intronic
954912491 3:54121728-54121750 CGCGCCCGACCCAGGCCCCGGGG - Intergenic
968571022 4:1340691-1340713 CTCGGCCGAAGCAGACCCTGTGG + Intergenic
991216887 5:64165961-64165983 CCCGCCCGACTCCGACCCGCCGG - Intronic
1001651261 5:173317923-173317945 CATGCCCGAGGCAGAGTCGGGGG - Exonic
1004516649 6:16327122-16327144 CACGCCCGCAGCTGACCTGGAGG - Exonic
1018978388 6:168582818-168582840 CACGCACGGGGAAGACCCGGGGG + Intronic
1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG + Intronic
1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG + Intronic
1040543306 8:48378547-48378569 CACCCCCAACGCAGTGCCGGTGG - Intergenic
1056539198 9:87556880-87556902 CACGCCCAAGGCAGCCCAGGAGG - Intronic
1061839225 9:133347954-133347976 CCCGCCCTAGGCCGACCCGGCGG - Intronic
1061919658 9:133775944-133775966 CAGGCACCACCCAGACCCGGCGG + Intronic