ID: 1165831020

View in Genome Browser
Species Human (GRCh38)
Location 19:38730352-38730374
Sequence GGTCTCTGGGGACCCTCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 258}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831005_1165831020 20 Left 1165831005 19:38730309-38730331 CCGGGCCCCTTGCTGATGCTCCT 0: 1
1: 0
2: 4
3: 35
4: 316
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831007_1165831020 15 Left 1165831007 19:38730314-38730336 CCCCTTGCTGATGCTCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831013_1165831020 0 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831009_1165831020 14 Left 1165831009 19:38730315-38730337 CCCTTGCTGATGCTCCTCCGGGT 0: 1
1: 0
2: 0
3: 18
4: 108
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831016_1165831020 -3 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831004_1165831020 21 Left 1165831004 19:38730308-38730330 CCCGGGCCCCTTGCTGATGCTCC 0: 1
1: 0
2: 2
3: 28
4: 299
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258
1165831010_1165831020 13 Left 1165831010 19:38730316-38730338 CCTTGCTGATGCTCCTCCGGGTC 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG 0: 1
1: 0
2: 1
3: 18
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831020 Original CRISPR GGTCTCTGGGGACCCTCCAG AGG Exonic
900174675 1:1286488-1286510 GGGCCCTGGTGTCCCTCCAGGGG - Intronic
900307579 1:2018830-2018852 GATCCCTGGGGACCCTCGACGGG - Intergenic
900579398 1:3401072-3401094 AGGCTCTGAGGACCCGCCAGGGG + Intronic
900888944 1:5435407-5435429 GGTCTCTGTGGTCCTTCCAGAGG - Intergenic
901443723 1:9294375-9294397 TGTGTGTGGGGACCATCCAGGGG + Intronic
902172605 1:14625088-14625110 TGTCGGGGGGGACCCTCCAGGGG - Intronic
904260449 1:29284754-29284776 GATCTCTGGGACACCTCCAGGGG - Exonic
904470451 1:30732572-30732594 GGTCTCTGGGGACTGTCGGGGGG - Exonic
906150972 1:43587626-43587648 GGTCTCTGAGGACCCTCGCTGGG - Intronic
906248701 1:44294901-44294923 CCTCTCTGCGGAGCCTCCAGAGG - Intronic
907330086 1:53665057-53665079 GCTCTCTCGGAACCCTCCAGTGG - Intronic
912435046 1:109656020-109656042 AGTCCCTGGGGACCCAGCAGAGG + Intergenic
915623055 1:157097905-157097927 GGTCTCTGGTGGCCCTCGGGGGG + Exonic
915841143 1:159214331-159214353 GGTGCCTGGGGTCCCTCTAGTGG + Intergenic
917482215 1:175422277-175422299 GCCCTCTAGGGACCCTCCAGGGG - Intronic
917878207 1:179306275-179306297 CCTTGCTGGGGACCCTCCAGTGG + Intronic
918505104 1:185245359-185245381 TATCTCTGAGGACCTTCCAGTGG - Intronic
919793184 1:201305557-201305579 GGTCCCTGGAGACCCAACAGTGG - Intronic
920052128 1:203170631-203170653 ATTCTCTGAGGACCCTACAGAGG - Intronic
920379708 1:205528404-205528426 GGTCTCTGGTAACCCCCCACAGG - Intronic
920504303 1:206505946-206505968 GGGCTCTGGGGGCTCACCAGAGG - Intergenic
922586093 1:226736291-226736313 GGGCTCTGGGGAGCCTGAAGTGG - Exonic
922763874 1:228147855-228147877 GGGTTCTGGGGACCCTCACGGGG - Intronic
923275556 1:232392602-232392624 GGACTCTGGGGACACTCAAGGGG + Intergenic
924622928 1:245678054-245678076 GGTCACTGGTGACCTTTCAGGGG + Intronic
1063023567 10:2155059-2155081 GCTCTCTGGGGTCCCTCCTATGG - Intergenic
1066308855 10:34175456-34175478 AGTCTCTGGGGCCCCTGCATTGG - Intronic
1066547679 10:36518644-36518666 GTTCTATGTGGACCCTCCACAGG - Intergenic
1067509957 10:46886348-46886370 GGTCGCTGGGGACCCTGATGTGG + Intergenic
1067652296 10:48165510-48165532 GGTCGCTGGGGACCCTGATGTGG - Intronic
1067760095 10:49038726-49038748 GGTGCCTGTGGGCCCTCCAGGGG + Intronic
1068689913 10:59905271-59905293 CGTTTCTGGGCAGCCTCCAGGGG + Intronic
1069051101 10:63795579-63795601 TGTCCCTGGAGACCTTCCAGTGG - Intergenic
1070103963 10:73414326-73414348 GGTATCCGGGGCCCCTTCAGTGG + Intergenic
1070375338 10:75825171-75825193 AGTCTCTGATTACCCTCCAGTGG - Intronic
1070803550 10:79257215-79257237 GGGCTCTGGGGTCCCCACAGTGG - Intronic
1070963956 10:80518187-80518209 TGTCTCTGGGTAGACTCCAGAGG - Exonic
1071334716 10:84591208-84591230 GTGCTCTGAGGCCCCTCCAGTGG + Intergenic
1073119311 10:101111884-101111906 TCTCTTTGGGGACCCTCCAAAGG - Intronic
1074154931 10:110789763-110789785 TATCTCTGGGGACCCTAGAGTGG - Intronic
1075231633 10:120684915-120684937 GGTCTGGGAGGAGCCTCCAGAGG + Intergenic
1075455998 10:122585447-122585469 AGTCTCTGGGGACCCAGCTGTGG + Intronic
1076151100 10:128162485-128162507 GGTGTCTGGGGACCCTCCCAGGG + Intergenic
1076192996 10:128495953-128495975 GGGCTCTTGGGACCCGCCTGGGG + Intergenic
1076394235 10:130126972-130126994 GGTACCTGGGGCCACTCCAGAGG + Intergenic
1077407025 11:2387243-2387265 GGAGCCTGGGGACCTTCCAGTGG + Intronic
1077571096 11:3339195-3339217 GGTCCCAGAGGACACTCCAGTGG + Intergenic
1079365733 11:19807669-19807691 GGTCACTGGGGAGCCTGCAGTGG - Intronic
1080683409 11:34496274-34496296 GGGCTCTGGCTCCCCTCCAGGGG - Intronic
1083295866 11:61715420-61715442 GTTCCCTGTGGACACTCCAGAGG + Intronic
1084359006 11:68657482-68657504 GGTCTCTGGGGCCCATCCTAGGG - Intergenic
1084444631 11:69196504-69196526 GGTCTCTGTGGCCCCTCCGCCGG - Intergenic
1092124472 12:6065756-6065778 GGCCTCCAGGGACTCTCCAGGGG - Intronic
1092335678 12:7630801-7630823 AGACACTGGGGACCCTCAAGTGG - Intergenic
1093825742 12:23685745-23685767 GGTCCATGGAGTCCCTCCAGGGG - Intronic
1095049942 12:37546272-37546294 GGTCTGTGGGCACCCTCCTGGGG - Intergenic
1097170853 12:57111738-57111760 GGACTCTGCGCTCCCTCCAGTGG + Intronic
1097733015 12:63150964-63150986 GGGCTCTGCGATCCCTCCAGTGG + Intergenic
1098194168 12:67982252-67982274 GTTCTCTGGCGATGCTCCAGGGG + Intergenic
1098750896 12:74292580-74292602 GGACACTGGGGGCCCGCCAGGGG - Intergenic
1100068795 12:90684792-90684814 TGTCTCTGAAGACCTTCCAGTGG - Intergenic
1100382964 12:94078866-94078888 GGCCTGTGGGGACCTTCAAGTGG + Intergenic
1102248198 12:111368481-111368503 TGTCTCTGGGGTCCCTGCTGGGG - Intronic
1102258765 12:111430852-111430874 GGACCCTGGGGACCCACCTGTGG - Intronic
1103842955 12:123880031-123880053 AGAATCTGGGGACCCTCCATGGG - Intronic
1104479016 12:129091290-129091312 GGTCTCTGGGGACCTTATATAGG + Intronic
1104595238 12:130116016-130116038 GGCCCCTGGTGACCTTCCAGTGG - Intergenic
1108803204 13:54125236-54125258 TGTCTCTGAAGACCATCCAGTGG + Intergenic
1111509319 13:89240562-89240584 GGTCCCTGAAGACCTTCCAGTGG - Intergenic
1115488940 14:33940205-33940227 GGCCTATGTGGACCCTGCAGGGG - Intronic
1121017168 14:90555911-90555933 GGTCACCGGGGACCCGTCAGGGG + Intronic
1123053428 14:105558806-105558828 GGTCTCTGGGGTCCCTGCTGGGG + Intergenic
1123078005 14:105679220-105679242 GGTCTCTGGGGTCCCTGCTGGGG + Intergenic
1124650039 15:31467705-31467727 GGTGTCTGCGGGCTCTCCAGGGG + Intergenic
1124812293 15:32953135-32953157 GGTTTAGGGGGCCCCTCCAGTGG - Intronic
1125487557 15:40122944-40122966 GGTCTCTGTGGGCTTTCCAGAGG - Intergenic
1125489370 15:40135750-40135772 GGTCTCTGTGGGCTTTCCAGAGG - Intergenic
1126372875 15:47965480-47965502 GCTCTGTGGGGAGCCGCCAGAGG - Intergenic
1128493320 15:68172678-68172700 GGGATCTGGGGACTCTACAGTGG + Intronic
1129857645 15:78836215-78836237 GGTCTCTGGTGTGCCTCCAAAGG + Intronic
1131146924 15:90020227-90020249 GGCCTCTGGGGCCCTTCCTGTGG + Intronic
1132060635 15:98689737-98689759 GGTCTCTCGGGATGCCCCAGTGG + Intronic
1133742602 16:8662702-8662724 TGCCTCTGAGGAACCTCCAGTGG - Intergenic
1134550690 16:15137222-15137244 GGTCCGTGGGGCCCCACCAGGGG + Intronic
1134708558 16:16317402-16317424 GGTCCGTGGGGCCCCACCAGGGG - Intergenic
1135765913 16:25177922-25177944 GGTCACTGGGGGTCCTCTAGGGG + Intronic
1137506242 16:49056339-49056361 GGGCTCTAGGGACCCTGCAGAGG + Intergenic
1138203567 16:55107782-55107804 GGTCTTTGCAGAGCCTCCAGGGG + Intergenic
1139475031 16:67198930-67198952 GTTCTTTGGGGACCCTCCTTGGG + Intergenic
1139850861 16:69951039-69951061 GGTCTCTGGGGGCTCCCCAAGGG + Intronic
1139879843 16:70173951-70173973 GGTCTCTGGGGGCTCCCCAAGGG + Intronic
1140271647 16:73471662-73471684 GGGCTCAGGGGACCCTTTAGGGG + Intergenic
1140372677 16:74421597-74421619 GGTCTCTGGGGGCTCCCCAAGGG - Intronic
1141754150 16:85980161-85980183 GTTCTCTGAGGACCCACCTGAGG + Intergenic
1141779525 16:86150365-86150387 GTGCTCTAGGGACCCCCCAGGGG + Intergenic
1143874217 17:9979585-9979607 GCTCTCCTGGGACCCTCCACAGG - Intronic
1144462207 17:15467319-15467341 GGACTCTGGGGACCCTTTAATGG + Intronic
1145370562 17:22303358-22303380 GGTCTGTGAGCACCCTCCTGCGG - Intergenic
1148834772 17:50460290-50460312 GGTCACTGGGGTCCTTCCTGAGG - Intronic
1149659068 17:58324986-58325008 AGCCACTGGGGACCCTCCTGAGG + Exonic
1150280257 17:63925940-63925962 GGCCTCTGAGCACCCTCGAGAGG - Intergenic
1151482985 17:74381042-74381064 GGTCCCTGGGGACAATCCTGAGG - Intergenic
1152236598 17:79142285-79142307 GGTGGCTGCGGAGCCTCCAGGGG + Intronic
1152240224 17:79157087-79157109 AGTCTCTGGGGGCCCTCCAGAGG - Intronic
1152333601 17:79687110-79687132 GGTCCCTGAGAGCCCTCCAGGGG + Intergenic
1157583075 18:48784505-48784527 GGTCTCTGGGGCACCACCAAAGG + Intronic
1157600620 18:48890966-48890988 AGTCTGTGGTCACCCTCCAGAGG + Intergenic
1160209604 18:76865676-76865698 GGTTTCAGGGGACCCTGCACTGG - Intronic
1160809685 19:1008004-1008026 GGTCTCTGGGGACCTCCTGGGGG + Intronic
1161951505 19:7470351-7470373 GCTCTCTGGGGACCCCCATGGGG + Intronic
1163187018 19:15645926-15645948 GGTCTCTGTGCTGCCTCCAGCGG + Intronic
1163241159 19:16064667-16064689 GGTCTCTGGGGACACAGCGGGGG + Intergenic
1163519044 19:17781166-17781188 GGCCTCTGGGGCCTCCCCAGGGG - Intronic
1163603706 19:18263126-18263148 AGTCCATGGGGACACTCCAGAGG - Intronic
1163784280 19:19266658-19266680 GGTCTCAGGAGACCCACCTGGGG - Intronic
1164582417 19:29442662-29442684 GGCCTCTAGGTCCCCTCCAGAGG - Intergenic
1165509640 19:36258529-36258551 GATCTGTGGGCACCCTCCTGCGG - Intergenic
1165831020 19:38730352-38730374 GGTCTCTGGGGACCCTCCAGAGG + Exonic
925251438 2:2442238-2442260 TGTCTCTGTGAACCTTCCAGTGG - Intergenic
927245826 2:20956500-20956522 GGGCTCTGTGGAGCCTGCAGGGG + Intergenic
931632215 2:64311507-64311529 GCTCTCAGGGGCCCCGCCAGGGG + Intergenic
931787970 2:65638643-65638665 TCTCTCTGGGGACACTCCATAGG - Intergenic
932457910 2:71861354-71861376 GCTGTCTGGGGACCCTGAAGGGG - Intergenic
932671513 2:73741387-73741409 GGTCTCTGGATCCCCACCAGAGG - Intergenic
932797386 2:74708495-74708517 GGCCTCTGTGGACACTCCACTGG - Intergenic
934058015 2:88268831-88268853 GGTGTCTGGGGAGCCTGGAGTGG + Intergenic
936017444 2:108970518-108970540 GCTCCCTGGGCACCGTCCAGAGG - Intronic
936744306 2:115556023-115556045 AGACTCTGGGGACCCTCAAATGG - Intronic
936976981 2:118230315-118230337 GGTCTCTGAGACCCCTTCAGGGG + Intergenic
937132699 2:119524945-119524967 GGCATCTGGGGACCGTCCTGAGG + Intergenic
939963942 2:148592355-148592377 GTACACTGGAGACCCTCCAGGGG - Intergenic
940258561 2:151757795-151757817 GGTTTTTGAGGTCCCTCCAGTGG + Intergenic
944301160 2:198126478-198126500 GGGCTGTGGGGACCACCCAGGGG + Intronic
944485324 2:200199591-200199613 GGCATCTGGGGAGCCTGCAGAGG - Intergenic
946771867 2:223096893-223096915 GGTCACTGGGGCCCCTCCTTTGG + Intronic
947472753 2:230413515-230413537 GGTCAATGGGAAACCTCCAGGGG - Intergenic
947899756 2:233711544-233711566 GGGCTTTGGGAACTCTCCAGGGG - Intronic
948759376 2:240181123-240181145 GGTCCTTGGGGACCTTCCAGAGG - Intergenic
948783125 2:240337185-240337207 GGTCTCTGGGACCTCTGCAGGGG + Intergenic
948843569 2:240672319-240672341 TGGCTCTGGGGACGCTCCAAGGG - Intergenic
948850198 2:240701985-240702007 TGGCTCTGGGGACGCTCCAAGGG + Intergenic
1169018186 20:2308799-2308821 GGTGTCTGGGGACACACAAGGGG + Intronic
1171544465 20:25989786-25989808 GGTCTGTGGGCACCCTCCTGGGG - Intergenic
1172586913 20:36092042-36092064 ACTCTCTGGGGACTCTCCAAGGG - Intronic
1172828707 20:37813176-37813198 GGTCTCAGAGGACACTCCTGTGG - Intronic
1173886590 20:46464568-46464590 GGTCTCTGGGCAGCATCCATTGG + Intergenic
1176705620 21:10118576-10118598 GGTCTGCGGGCACCCTCCTGCGG + Intergenic
1177470955 21:21560351-21560373 GGAATCTGGGGACCCTGCATGGG - Intergenic
1178910199 21:36667889-36667911 AGACTCTGGGGTCCCTCCTGGGG - Intergenic
1180185591 21:46137628-46137650 TGCCTCCGGGGGCCCTCCAGGGG - Intronic
1181147527 22:20859179-20859201 GGTCTCGGGCGTCCCTCCAAGGG - Exonic
1182843278 22:33409540-33409562 GGACTCTGGGGATGCTTCAGTGG - Intronic
1183212190 22:36457974-36457996 GGCCTCTGGTGCCTCTCCAGAGG - Intergenic
1183312187 22:37116309-37116331 GGCCTCTGGGGACCCTGCCTAGG - Intergenic
1183354803 22:37352387-37352409 GGACTCTGGGGACACAGCAGGGG + Intergenic
1183363901 22:37397206-37397228 GGTCACTGTGTCCCCTCCAGAGG + Intronic
1183730028 22:39613275-39613297 GGGCACTGGGGACCCAGCAGGGG + Intronic
1185310781 22:50153128-50153150 GGTCTGTGCGGACCCCACAGTGG + Exonic
1185388916 22:50548613-50548635 CGCCTCGGGGGACCCTCAAGGGG + Exonic
950044973 3:9943630-9943652 GGTCTCAGTGCAGCCTCCAGGGG - Intronic
950265489 3:11569946-11569968 GGTTTCAGGGCACCCTTCAGTGG - Intronic
951374292 3:21894649-21894671 GGTATATGGGCTCCCTCCAGTGG + Intronic
953884185 3:46706284-46706306 GGTGTCTGGGGAGCCTCTAGTGG - Intronic
954642201 3:52107412-52107434 GGTTTCTGAGGATGCTCCAGAGG - Intronic
957303199 3:78420434-78420456 GGTCTGTGGGGATCTTGCAGAGG - Intergenic
959581445 3:107987076-107987098 GGTCTCTGGAAACCATCAAGGGG + Intergenic
960665757 3:120107374-120107396 GGTCTTTGGGCACTTTCCAGAGG - Intergenic
961083251 3:124044227-124044249 GGTCTCACACGACCCTCCAGAGG + Intergenic
961501338 3:127338097-127338119 CGGCTCCGGGGCCCCTCCAGCGG - Intergenic
970742521 4:19254860-19254882 GGTCTCAGGGAACATTCCAGTGG - Intergenic
971204494 4:24550619-24550641 GGCCTTTGGAGACCTTCCAGTGG - Intronic
971420000 4:26466248-26466270 TGACTCGGGGGCCCCTCCAGTGG + Intergenic
978098918 4:104813049-104813071 GGTCTCTGAAGACTCTCCAAGGG - Intergenic
980354217 4:131723459-131723481 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980355291 4:131728442-131728464 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980356376 4:131733434-131733456 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980356914 4:131735922-131735944 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980357454 4:131738414-131738436 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980357993 4:131740903-131740925 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980358526 4:131743394-131743416 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980359068 4:131745867-131745889 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980360148 4:131750830-131750852 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980360688 4:131753305-131753327 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980361231 4:131755785-131755807 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980361771 4:131758260-131758282 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980362314 4:131760740-131760762 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980362857 4:131763223-131763245 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
980377890 4:131975294-131975316 GGTCTGCGGGCACCCTCCTGCGG + Intergenic
980378423 4:131977770-131977792 GGTCTGCGGGCACCCTCCTGCGG + Intergenic
981720327 4:147795475-147795497 GGTCTCTGTGGGTCCTTCAGAGG + Intronic
982166557 4:152618583-152618605 TTTCTCTGTGGACCCTCCAGAGG + Intergenic
982421918 4:155208559-155208581 GGTGGCTGGGGACCCGCGAGGGG + Intergenic
983042630 4:162947975-162947997 TGTCTCTGTAGACCTTCCAGCGG + Intergenic
985575499 5:671761-671783 TGTCTTTGGGGAGCCTCTAGTGG - Intronic
986233254 5:5885781-5885803 GGTCTTGGGGGACCCTGGAGGGG + Intergenic
986736832 5:10674321-10674343 GGGCCCTAAGGACCCTCCAGGGG - Intergenic
987053169 5:14165617-14165639 TGTCTCTGTGGACCCTTCAAAGG + Intronic
988554061 5:32221319-32221341 GGTCTCTCGGGAGTCCCCAGGGG + Intergenic
990313537 5:54562860-54562882 TGTCCCTGAGGACCTTCCAGTGG + Intergenic
991586171 5:68204092-68204114 CATCTCTGGGTCCCCTCCAGTGG + Intergenic
996290900 5:121851763-121851785 GGGCTCTGGGGACCCGCGTGGGG - Intergenic
997807740 5:136935946-136935968 GGTCTCTAAGGACCCATCAGTGG + Intergenic
997825118 5:137099267-137099289 GATCTCTGGACACCCTCCACAGG + Intronic
1000122330 5:158209142-158209164 CATCTCTGGGAAACCTCCAGAGG + Intergenic
1004566581 6:16803695-16803717 GCTCTCCGGGGTCCCTCCAGAGG - Intergenic
1004707058 6:18134373-18134395 GGTGACTGGGACCCCTCCAGGGG + Intronic
1005926338 6:30448585-30448607 TGTCCTTGGGGATCCTCCAGTGG + Intergenic
1006384934 6:33725415-33725437 GGTCGCAGGGGACCCACCACAGG - Intronic
1006924955 6:37648967-37648989 GGTCTCCGGTGAGCGTCCAGTGG - Exonic
1009927905 6:70142451-70142473 GCTCTCTTGGGACACTCCTGTGG - Intronic
1012930193 6:105308777-105308799 GGACTCTGGGGACACAGCAGTGG + Intronic
1017072193 6:150585366-150585388 TGCCCCTGAGGACCCTCCAGTGG + Intergenic
1018308120 6:162479641-162479663 TGTCCCTGAAGACCCTCCAGTGG - Intronic
1018763715 6:166912683-166912705 GTTCTCTGGGGACTCTTCACTGG - Intronic
1018845336 6:167551800-167551822 GGTCCTGGGGGACCCTCGAGGGG - Intergenic
1019278333 7:187698-187720 GGTCGCTGGGGTCCCACCCGGGG - Intergenic
1021945847 7:25726407-25726429 CGTCTGTGGGGACCACCCAGAGG + Intergenic
1022892807 7:34718435-34718457 GGTCTCTGGGACCCCTTCGGGGG - Intronic
1023741290 7:43283173-43283195 AGGCTCTGGGGGCCTTCCAGGGG - Intronic
1024617331 7:51126858-51126880 GGTCTCTGGTGACACTGAAGAGG - Intronic
1025295850 7:57774851-57774873 GGTCTGTGGGCACCCTCCTGGGG - Intergenic
1025615332 7:63112867-63112889 GCTGTCTGGGGGCCCTCCTGGGG + Intergenic
1025813781 7:64891351-64891373 GGTCTATGGTGACCTTCCTGTGG + Intronic
1025818943 7:64945588-64945610 GGTCTATGGGGACCTTCCTGAGG - Intergenic
1026451109 7:70530421-70530443 GGTCTCTGGGGAGCGTCTGGTGG + Intronic
1026481921 7:70786775-70786797 GGTCTCTGGTGACACTTGAGAGG + Intronic
1026849652 7:73716989-73717011 GGTCACTGGGGACTAGCCAGGGG - Intronic
1026850424 7:73719872-73719894 GGTCTCTGGGGACCCATCCCCGG - Intergenic
1026894785 7:74003684-74003706 GAGCTCTGGGGACACCCCAGTGG - Intergenic
1031583793 7:123508405-123508427 GGGCTCTGGGGACCCTGTATTGG - Intronic
1034263883 7:149772455-149772477 GCTCTCTCGGGACCTTCCCGCGG + Intronic
1034957598 7:155344565-155344587 GCTCTCTCGGGACCTTCCTGGGG + Intergenic
1035295354 7:157864292-157864314 GTTCACTGGGCACCATCCAGAGG + Intronic
1035369272 7:158368704-158368726 GGTCTCTGAGGGACCTGCAGGGG - Intronic
1035391433 7:158507299-158507321 GGTCAGTGAGGACCATCCAGGGG + Intronic
1035391446 7:158507358-158507380 GGTCAGTGAGGACCATCCAGGGG + Intronic
1035391458 7:158507417-158507439 GGTCAGTGAGGACCATCCAGGGG + Intronic
1035391571 7:158508015-158508037 GGTCAGTGAGGACCGTCCAGGGG + Intronic
1035391612 7:158508199-158508221 GGTCAGTGAGGACCGTCCAGGGG + Intronic
1039893689 8:41701487-41701509 GGGCTCCGGGCACCCTCCAAGGG - Intronic
1041726549 8:61023378-61023400 GTTCTCTGGCGACCATGCAGCGG + Intergenic
1042218672 8:66452255-66452277 TGTCCCTTGGGTCCCTCCAGAGG - Intronic
1044290398 8:90462238-90462260 GGTGTCTGGGGAGCAGCCAGTGG - Intergenic
1045035966 8:98176671-98176693 TGTCCCTGGGGCCCCTCCACAGG - Intergenic
1045862477 8:106828696-106828718 GGTCTCTGTGGCCTCTCCAAGGG + Intergenic
1046190411 8:110788349-110788371 GCTCTATGGGGACTCCCCAGTGG - Intergenic
1047251954 8:123187298-123187320 GGTCCCTGGGGCCCTTTCAGCGG + Intronic
1047923630 8:129660382-129660404 TGCCTCTGAGGACCTTCCAGTGG - Intergenic
1049123176 8:140758519-140758541 TGCCTCTGAGGACCTTCCAGTGG + Intronic
1049591749 8:143465907-143465929 GGTGGCTGGGGACCCTCCTACGG + Intronic
1049787942 8:144460081-144460103 GGTCTGTGTTGACCTTCCAGGGG + Intronic
1051910899 9:22154017-22154039 GCTGTCTGGGGGCCCTCCTGGGG - Intergenic
1052262983 9:26539309-26539331 GGTCACTGGGGAATCTCCTGAGG - Intergenic
1053423676 9:37997315-37997337 TGGCTCTGGGGACCCACCAGTGG - Intronic
1053456202 9:38234749-38234771 AGTCCCAGGGGACCCTCCTGGGG + Intergenic
1053642905 9:40105705-40105727 GGTCTGCGGGCACCCTCCTGCGG + Intergenic
1053763248 9:41359785-41359807 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
1054541857 9:66270952-66270974 GGTCTGCGGGCACCCTCCTGCGG - Intergenic
1056753583 9:89368484-89368506 AGACTCTGGGGACCCTTCTGGGG + Intronic
1057348067 9:94269462-94269484 TTTCCCAGGGGACCCTCCAGAGG - Intronic
1057858946 9:98624684-98624706 GGTCTCTGTGGACCCGCCTAAGG + Intronic
1058833244 9:108837970-108837992 TGTCTCTGGGGCCTCTTCAGTGG - Intergenic
1059302033 9:113321548-113321570 GTTCTCTGGGGACCCAGCACAGG + Exonic
1060590244 9:124811717-124811739 AGGCTCTGGGGAGCCACCAGTGG - Exonic
1060735859 9:126066274-126066296 GGTCTCGGGGGGCCCCCCACTGG - Intergenic
1060788447 9:126468778-126468800 GGTCCCTGGGGAGCCACCAAAGG - Intronic
1061251349 9:129428297-129428319 GGTCTCTGCTGAGCCCCCAGTGG - Intergenic
1061783443 9:133008773-133008795 GGACTCAGGCCACCCTCCAGCGG - Intergenic
1062181039 9:135191473-135191495 GGTCGCTGGGGGCCATCCTGAGG + Intergenic
1062545969 9:137063894-137063916 GCTGTCTGGGGGCCCTCCTGGGG + Exonic
1062554742 9:137108869-137108891 GGTCTCTGTGGGCCGACCAGAGG + Exonic
1202790653 9_KI270719v1_random:88685-88707 GGTCTGCGGGCACCCTCCTGCGG + Intergenic
1185481851 X:452103-452125 GTGCTCTGTGGACCCTCCATGGG - Intergenic
1189925708 X:45952288-45952310 GTTCTCTGGGCAGCCACCAGGGG - Intergenic
1194419320 X:93652889-93652911 TGTCTCTGAAGACCTTCCAGTGG + Intergenic
1200135804 X:153874025-153874047 GCTCCCTGGGGACACTGCAGAGG + Intronic
1200335837 X:155350532-155350554 GGTCTCAGGGACTCCTCCAGGGG + Intergenic
1200350632 X:155490694-155490716 GGTCTCAGGGACTCCTCCAGGGG - Exonic