ID: 1165831021

View in Genome Browser
Species Human (GRCh38)
Location 19:38730355-38730377
Sequence CTCTGGGGACCCTCCAGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 229}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831010_1165831021 16 Left 1165831010 19:38730316-38730338 CCTTGCTGATGCTCCTCCGGGTC 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831009_1165831021 17 Left 1165831009 19:38730315-38730337 CCCTTGCTGATGCTCCTCCGGGT 0: 1
1: 0
2: 0
3: 18
4: 108
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831004_1165831021 24 Left 1165831004 19:38730308-38730330 CCCGGGCCCCTTGCTGATGCTCC 0: 1
1: 0
2: 2
3: 28
4: 299
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831016_1165831021 0 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831007_1165831021 18 Left 1165831007 19:38730314-38730336 CCCCTTGCTGATGCTCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831013_1165831021 3 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229
1165831005_1165831021 23 Left 1165831005 19:38730309-38730331 CCGGGCCCCTTGCTGATGCTCCT 0: 1
1: 0
2: 4
3: 35
4: 316
Right 1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 51
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831021 Original CRISPR CTCTGGGGACCCTCCAGAGG TGG Exonic
900902452 1:5526409-5526431 CTCTGAGGCCCCTCAAGAGGCGG - Intergenic
901027249 1:6285155-6285177 CTCTGGGGACCCACGAGGGCTGG + Intronic
902410443 1:16208702-16208724 CTCCAGGGTCCCTCCAGAGCTGG + Exonic
903065440 1:20696873-20696895 CTCTGGGGAGGCTCCCGGGGAGG - Intronic
906134952 1:43492185-43492207 CTCTTGGCAGCCACCAGAGGAGG - Intergenic
906166493 1:43690237-43690259 CTCTGGGTACACTCCTGAGGTGG + Intronic
907238863 1:53069707-53069729 CTCTGAGGACAGTCCAGAGTGGG + Intronic
908928211 1:69283021-69283043 CTCTGGTGATCCTCCAGATTTGG + Intergenic
915844263 1:159247246-159247268 CTCTGTGTACCTTCCAGTGGTGG - Intergenic
918097622 1:181347956-181347978 CTTGGGGCACCATCCAGAGGCGG + Intergenic
918299192 1:183186569-183186591 ATCTGGGGCTCCTCCAGAGACGG + Intronic
920047778 1:203144920-203144942 CTCTGGGGCCTCTGCACAGGAGG - Intronic
920504302 1:206505943-206505965 CTCTGGGGGCTCACCAGAGGCGG - Intergenic
921089369 1:211829461-211829483 CTCAGGGGAAATTCCAGAGGGGG + Intronic
922729711 1:227943176-227943198 CTCAGGGGACTCTCAAGAGGAGG - Intronic
922803947 1:228376244-228376266 CTATGGAGACCCTGCACAGGAGG - Intronic
923042260 1:230327674-230327696 CTGTCGGGAGCCTGCAGAGGGGG + Intronic
923673949 1:236064690-236064712 CTTCGCGGACCCTGCAGAGGCGG + Intronic
1063023564 10:2155056-2155078 CTCTGGGGTCCCTCCTATGGGGG - Intergenic
1067802610 10:49369523-49369545 CTCTGGGGACCTCACAGAAGAGG - Intronic
1069557215 10:69406353-69406375 CTCTGGGGCACCTGGAGAGGTGG - Intronic
1069565261 10:69459806-69459828 CTCTGGGGTACCCACAGAGGAGG - Intronic
1069917080 10:71793764-71793786 TTCTGGTTTCCCTCCAGAGGAGG - Intronic
1071601143 10:86959268-86959290 CTCCTGGCACTCTCCAGAGGAGG + Intronic
1073119310 10:101111881-101111903 CTTTGGGGACCCTCCAAAGGTGG - Intronic
1073511804 10:104047116-104047138 GTCTGGGCACCCGCCAAAGGAGG + Intronic
1074440115 10:113470783-113470805 ATCTGGGGACATTCAAGAGGAGG + Intergenic
1075391403 10:122095156-122095178 AACTGGGGACCCTCCTTAGGAGG + Intronic
1075835426 10:125448773-125448795 CTCTGGGGACCAGCTAGCGGTGG - Intergenic
1076242344 10:128917775-128917797 TCCTGGGCACCCTCCAGAGTAGG - Intergenic
1077486034 11:2838831-2838853 CTCTGCGGGCTCGCCAGAGGGGG + Intronic
1078483847 11:11704109-11704131 CTCTAGGCACCCTGCAGAGAGGG + Intergenic
1079203578 11:18395105-18395127 CTCTTGGGACGCTCGAGAGGTGG + Intronic
1080421082 11:32111016-32111038 CTCTGTTGACCCTCCTGAGCAGG + Intergenic
1081765091 11:45604752-45604774 CTCTGAGGGGCCTCCAGAGAGGG - Intergenic
1082801631 11:57419129-57419151 CTCTGGGGAGCCACACGAGGAGG - Intronic
1083202593 11:61129579-61129601 CTCTAGGCATCCTCCACAGGTGG + Intergenic
1084044699 11:66561880-66561902 CTCAGTGGAGCCTCCAGATGGGG + Intronic
1084753363 11:71218927-71218949 CTCTGGGTGCCCTACAGAGAAGG - Intronic
1086352056 11:85952166-85952188 CTCTGGGGACTGTCATGAGGTGG - Intergenic
1089257116 11:117199870-117199892 CCCTGGGGACCCGCCAGAGTGGG - Intronic
1089612964 11:119679833-119679855 CTCAGGGGGCCATCCACAGGTGG - Intronic
1090058658 11:123444924-123444946 CCCTGGGGAGCCTCAAGATGGGG - Intergenic
1091095323 11:132815676-132815698 CTTTGGGGACCCTCCTATGGGGG - Intronic
1091547305 12:1509998-1510020 CTCTGGGGACCCTCCTGAGCCGG - Intergenic
1092445561 12:8553414-8553436 CTGTGGTGATCCACCAGAGGCGG - Intergenic
1095060964 12:37687591-37687613 CTCTGGGGACCCTTGTGGGGTGG + Intergenic
1095539163 12:43288162-43288184 AGCTGGGCACTCTCCAGAGGGGG + Intergenic
1097170854 12:57111741-57111763 CTCTGCGCTCCCTCCAGTGGAGG + Intronic
1100826999 12:98483846-98483868 CCTAGGGGAGCCTCCAGAGGAGG + Intergenic
1101159117 12:101955615-101955637 CTCTGGGGATCCACATGAGGCGG + Intronic
1102248197 12:111368478-111368500 CTCTGGGGTCCCTGCTGGGGCGG - Intronic
1103547671 12:121713307-121713329 CTGGGGAGACCCTGCAGAGGTGG - Intronic
1103750543 12:123156108-123156130 CTCTGAGAGCCCTCCAGAGAGGG + Exonic
1108542105 13:51453771-51453793 CTCGGGGGAGCCACGAGAGGTGG + Intronic
1114524415 14:23359276-23359298 CTCTGGGGTCCCTCCTGGTGGGG + Intronic
1115962801 14:38854477-38854499 CTCTGAGGCCCCTCCAGAGCTGG - Intergenic
1119046117 14:71320522-71320544 CCCCGGGGACCCTCCAGCCGGGG - Intronic
1119102189 14:71890038-71890060 CTCTGAGGCCCCCCCAGAAGTGG + Intergenic
1122361890 14:101172478-101172500 CCCTGAGGCCCCTCCAGAAGTGG - Intergenic
1122774356 14:104110699-104110721 CCCTAAGGGCCCTCCAGAGGAGG + Intronic
1122882646 14:104696985-104697007 CTCTGGGGACCCTGAAGCAGTGG - Intronic
1123205047 14:106704303-106704325 CTCGGGGGATTCTCTAGAGGCGG + Intergenic
1123472471 15:20565377-20565399 CTCCGGGGTCCCTCCAGGTGAGG - Intergenic
1123645533 15:22434976-22434998 CTCCGGGGTCCCTCCAGGTGAGG + Intergenic
1123666785 15:22614543-22614565 CTCTGGGGTCCCTCCAGGTGAGG + Intergenic
1123732777 15:23160368-23160390 CTCCGGGGTCCCTCCAGGTGAGG - Intergenic
1123750910 15:23357748-23357770 CTCCGGGGTCCCTCCAGGTGAGG - Intronic
1124283281 15:28381664-28381686 CTCCGGGGTCCCTCCAGGTGAGG - Intronic
1124299418 15:28529949-28529971 CTCCGGGGTCCCTCCAGGTGAGG + Intronic
1124320625 15:28709116-28709138 CTCTGGGGTCCCTCCAGGTGAGG + Intronic
1124481868 15:30086233-30086255 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1124488324 15:30138331-30138353 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1124521724 15:30410968-30410990 CTCTGGGGTCCCTCCAGGTGAGG + Intronic
1124536940 15:30555251-30555273 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1124543414 15:30607305-30607327 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1124563371 15:30794756-30794778 CTCTGGGGTCCCTCCAGGTGAGG - Intergenic
1124755203 15:32399989-32400011 CTCTGGGGTCCCTCCAGGTGAGG + Intronic
1124761710 15:32452340-32452362 CTCTGGGGTCCCTCCAGGTGAGG + Intronic
1124776917 15:32596728-32596750 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1124959912 15:34386474-34386496 CTCTGGGGTCCCGCCAGGTGAGG + Intronic
1124976539 15:34532695-34532717 CTCTGGGGTCCCGCCAGGTGAGG + Intronic
1127773996 15:62251754-62251776 CTCTGGGGTCCCTCTAGCTGAGG + Intergenic
1129029430 15:72607721-72607743 CTCTGGGGTCCCTCTAGGTGAGG - Intergenic
1129037370 15:72658765-72658787 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1129212517 15:74078460-74078482 CTCTGGGGTCCCTCCAGGTGAGG + Intronic
1129397882 15:75262619-75262641 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1129401493 15:75286900-75286922 CTCTGGGGTCCCTCCAGGTGAGG - Intronic
1129475093 15:75779602-75779624 CTCTGGGGTCCCTCCAGGTGAGG - Intergenic
1129729653 15:77922779-77922801 CTCTGGGGTCCCTCCAGGTGAGG + Intergenic
1129803821 15:78438023-78438045 CGCTGGGGAGGCTCCAGTGGGGG - Intronic
1129838872 15:78731203-78731225 CTCTGGGGTCCCTCCAGGTGAGG - Intergenic
1130547699 15:84868752-84868774 CTCAGGGGAGCCTCCAGCAGTGG - Exonic
1131507978 15:93033048-93033070 CTCTGGGCACCCACAAGAGAAGG - Intergenic
1132433505 15:101778946-101778968 TTCTGGGGTCCCTCCAGGTGAGG + Intergenic
1132500645 16:283256-283278 CTCGGAGGAGCCTCCAGAGGAGG + Exonic
1132660167 16:1057746-1057768 CCCTGGGGACCCTCGAGGAGGGG - Intergenic
1132847109 16:2005724-2005746 CTCGGGGGACGCACCAGTGGAGG - Intronic
1132903346 16:2270069-2270091 CTCTGGGGCCCCTTCAGCAGGGG - Intergenic
1132986452 16:2770029-2770051 CTCTGGGGACCCAAGGGAGGGGG - Intronic
1135163249 16:20116035-20116057 CTCTGGGGACCCTGCTGAGTAGG - Intergenic
1135945916 16:26864839-26864861 CTCTGAGGTCCCTCCACAGCTGG - Intergenic
1137694264 16:50450733-50450755 CTCAGGGGCTCTTCCAGAGGAGG - Intergenic
1140607844 16:76562787-76562809 CTCTGTAGACCCTCAACAGGTGG + Intronic
1141698156 16:85630173-85630195 CTCTTGGGTCACTCCAGTGGAGG - Intronic
1141811713 16:86380364-86380386 CACTGGGGGCCCTCCGGGGGTGG + Intergenic
1142183304 16:88682086-88682108 GGCTGGGACCCCTCCAGAGGTGG - Intronic
1142671034 17:1487494-1487516 CCCTGGGGACCCCCGAGCGGGGG + Intronic
1144653244 17:17019888-17019910 CTCTGGGGACCCTGGATAGGGGG - Intergenic
1144955405 17:19016610-19016632 CTGTTGGGACACGCCAGAGGCGG + Intronic
1145279986 17:21460039-21460061 CTCTGACGACCCTCTAGAGCTGG - Intergenic
1149329681 17:55567972-55567994 CTCTGGGGATCCTGCCTAGGGGG - Intergenic
1151354882 17:73552458-73552480 CGCAGGGGACCCTCCTGAGGGGG + Intronic
1151700393 17:75739804-75739826 CTCTGGGGTCCCACCTGAAGAGG + Intronic
1152826071 17:82465662-82465684 CTACAGGGAGCCTCCAGAGGTGG - Intronic
1153510947 18:5851521-5851543 CACTGGGCACCCTCCAGATCTGG + Intergenic
1154046781 18:10913374-10913396 CTCCGGGGACCCTCCACACTTGG - Intronic
1154174880 18:12079634-12079656 CTCTGGGGACCCTCCACACTTGG + Intergenic
1154356744 18:13627423-13627445 CGCTGGGGACCCTTCAGTGCCGG + Intronic
1155527120 18:26728552-26728574 TTCTGAGGACCTACCAGAGGTGG + Intergenic
1156416019 18:36891466-36891488 CTTTGGGGACTCAGCAGAGGGGG - Intronic
1159115498 18:64108397-64108419 CTCTGTGCACCCACCTGAGGAGG - Intergenic
1159117876 18:64136053-64136075 CCCTGAGGCCCCTCCAGAAGGGG - Intergenic
1160757460 19:765140-765162 CTGTGGGGACCCTGGGGAGGCGG + Intergenic
1160886908 19:1354473-1354495 GTCTTGGGACCCTCCCAAGGTGG + Intergenic
1161388310 19:4008293-4008315 CTCGGGGGACCCTTCCGAGCAGG - Intronic
1161515532 19:4694116-4694138 CTCTTGGGACCTTCTAGTGGAGG - Intronic
1161619391 19:5290399-5290421 CGCGGGGGAGCCCCCAGAGGCGG - Intronic
1162904850 19:13817481-13817503 CTCTGGGCACTGGCCAGAGGAGG - Intronic
1164237280 19:23348163-23348185 CTCTAGTAACCCTCCAGTGGTGG + Intronic
1164582415 19:29442659-29442681 CTCTAGGTCCCCTCCAGAGGCGG - Intergenic
1165258864 19:34596679-34596701 ATTTGGGGACCCTCCCCAGGGGG + Intronic
1165266423 19:34666117-34666139 ATCTGGGGACCCTCCCCAAGGGG - Intronic
1165831021 19:38730355-38730377 CTCTGGGGACCCTCCAGAGGTGG + Exonic
1166722198 19:45002937-45002959 GTCGGGGGACCCTGCAGAGAAGG - Exonic
1166768931 19:45268950-45268972 CTTTGGGGACCCTCCACCAGGGG - Intronic
1167266560 19:48485657-48485679 CTCGGGGGCCTCCCCAGAGGCGG + Exonic
925020630 2:564945-564967 CGCTGGGGAGGCTGCAGAGGGGG + Intergenic
927620752 2:24655628-24655650 CTCTGCAGACCCACCAGAGTAGG - Intronic
928091370 2:28377120-28377142 CTCCTGGGGCCCTCGAGAGGAGG - Intergenic
928403160 2:30993833-30993855 CTCTGTGGCCCCTCCAGCAGAGG + Intronic
930117741 2:47733062-47733084 CTCTGGGGTCTGTCAAGAGGTGG + Intronic
931460269 2:62444081-62444103 TTCAAGGGACTCTCCAGAGGAGG - Intergenic
932623187 2:73278667-73278689 GACTGGGGAACCCCCAGAGGTGG + Intronic
932926892 2:75986869-75986891 CTCTGAGGGCCCTCCAGCAGTGG - Intergenic
932955354 2:76345309-76345331 CTCTGGGGACTGTCCTGGGGTGG - Intergenic
934923044 2:98361183-98361205 CACTGGGGCCTCTCCAGGGGTGG - Intronic
936047724 2:109200209-109200231 CTCTGGCGACTCTGCAGATGGGG - Intronic
938213184 2:129485652-129485674 CTCTGTGGACCCTCCAGGCCTGG + Intergenic
941842120 2:170097192-170097214 CTCTGAAGTCCCTCTAGAGGTGG - Intergenic
946486533 2:220105885-220105907 CTCTGGGGACCCAGCAAAAGGGG - Intergenic
947815891 2:233036537-233036559 CTCTGGAGACCCTGGTGAGGGGG + Intergenic
947899755 2:233711541-233711563 CTTTGGGAACTCTCCAGGGGAGG - Intronic
948884721 2:240876986-240877008 CTCCGGGGACCCACCTGGGGTGG + Intronic
948920517 2:241063995-241064017 CTCTGGGTGTTCTCCAGAGGTGG + Exonic
1171123283 20:22583195-22583217 GTCTGGGCACCCTCCAGCCGCGG - Intronic
1172702581 20:36862515-36862537 CTCTGGGGACCACTCTGAGGTGG - Intronic
1174518867 20:51114448-51114470 CGCTGGGGACCCTGCAGCGCAGG + Intergenic
1175462217 20:59160143-59160165 CCCTGGGGAGACTCCAGAAGAGG + Intergenic
1175801702 20:61804662-61804684 GTGTGGGGATCCTCCAGGGGAGG + Intronic
1176096908 20:63348556-63348578 CTCTGGGGTCCTGGCAGAGGTGG + Intronic
1179183162 21:39062222-39062244 GTGTGGGGACCCCGCAGAGGGGG - Intergenic
1179580956 21:42343676-42343698 CTGGGGGGACCCCCCAAAGGAGG + Intergenic
1180189865 21:46157697-46157719 CTCTGTGGAGCCTCAAGGGGAGG + Intergenic
1182101103 22:27658163-27658185 CTCCAGGGTCTCTCCAGAGGAGG - Intergenic
1183068649 22:35381104-35381126 CGCTGAGGACGCTCGAGAGGAGG - Exonic
1183312185 22:37116306-37116328 CTCTGGGGACCCTGCCTAGGTGG - Intergenic
1184458429 22:44624305-44624327 CTCAGTAGACCCTCCAGAGTGGG + Intergenic
1184582282 22:45425850-45425872 CACTGGGGGCCCTCGAGGGGAGG - Intronic
1184737490 22:46407970-46407992 CCATGGGGACCCTCCCCAGGAGG - Intronic
1185121640 22:48974977-48974999 CTCTGGGCAGCCGCAAGAGGGGG - Intergenic
1185388918 22:50548616-50548638 CTCGGGGGACCCTCAAGGGGAGG + Exonic
950164149 3:10780932-10780954 CTCTCGGGACCCTCCAGGCTGGG - Intergenic
951517064 3:23571791-23571813 CTCTTGGTACCCTCCCGAAGTGG + Intronic
951861100 3:27253701-27253723 CTCTGGGGACCCTGCAGGGAAGG + Intronic
953884184 3:46706281-46706303 GTCTGGGGAGCCTCTAGTGGAGG - Intronic
954111496 3:48436065-48436087 CTCTGAGGACCCCAAAGAGGTGG + Intronic
954135951 3:48582322-48582344 CCCTGGGGACCCTGCAGTGGTGG - Exonic
956719973 3:72109064-72109086 CTTTGGGGAATCTCCAGAGATGG + Intergenic
960947786 3:122978673-122978695 CGCTGGGCAGCCTCCAGGGGTGG + Intronic
961128868 3:124446812-124446834 CTCTGTGGTCTCTCCAGTGGAGG - Exonic
962414826 3:135172678-135172700 CTCTGGTTACCCTCCAGAAGAGG - Intronic
962676096 3:137759802-137759824 CTCTGGGCACTCTCTAGAGGCGG + Intergenic
968913050 4:3485473-3485495 GGCTGGGGACCCTGAAGAGGAGG - Intronic
968990782 4:3910164-3910186 CCCTTGGGAACCTCCAAAGGGGG + Intergenic
969161926 4:5267863-5267885 TTCTGGGCAGCCTCCAGAGATGG - Intronic
969535898 4:7755840-7755862 CTCTGGCGACTCCCCAGAGGAGG - Intergenic
970447608 4:16137070-16137092 CTCCGGGGTCCCTCCAGAGCAGG - Intergenic
971181977 4:24337240-24337262 AGCTGGTGACCCTCCACAGGTGG - Intergenic
972633308 4:40860311-40860333 GTCTCGAGTCCCTCCAGAGGTGG - Intronic
972642769 4:40940600-40940622 CACTGGGCACCCTCCTGGGGGGG + Intronic
973377808 4:49299114-49299136 CTGTGAAGAACCTCCAGAGGAGG + Intergenic
976150601 4:82087525-82087547 CTCTGGGGACTCTTCTGGGGTGG - Intergenic
976550664 4:86391606-86391628 CTCTGGGGACACTCAAGTGAAGG + Intronic
982107857 4:152026350-152026372 CTCTGGTGACCATCCAGAATTGG - Intergenic
985947307 5:3196202-3196224 CTTGGGAGACCCTCCAGAAGAGG - Intergenic
987419706 5:17704886-17704908 CTCTAGGGACCTTATAGAGGAGG - Intergenic
990032523 5:51278829-51278851 GTCTGAGGACACTCCTGAGGAGG - Intergenic
991151319 5:63374308-63374330 CTTTGGACAGCCTCCAGAGGAGG - Intergenic
991302669 5:65144460-65144482 CTCTGTGGACCCACCACAGAAGG + Intergenic
991586172 5:68204095-68204117 CTCTGGGTCCCCTCCAGTGGAGG + Intergenic
995213457 5:109567888-109567910 CTCTGAGGATCATTCAGAGGAGG + Intergenic
996412359 5:123172156-123172178 CACTGTGTACCCTCCAGAGCTGG - Intronic
998107376 5:139477122-139477144 CTCAGGGGAGCCTGAAGAGGTGG - Intronic
999330951 5:150672943-150672965 ATCTGGGGACCCCTCAGAGAAGG - Intronic
1000312954 5:160062648-160062670 CTCAGTGGACCATCCAGAGTAGG + Intronic
1002701520 5:181128311-181128333 CTCCAGGGACACTCTAGAGGTGG - Intergenic
1003322516 6:5064024-5064046 CTCTGGGGACCCAACAGATGTGG - Intergenic
1004050535 6:12073824-12073846 CTCTGGGAAGCCTCCTGAGCTGG + Intronic
1004702127 6:18089071-18089093 CTCTGTGTACCCTGCAGTGGTGG + Intergenic
1005894266 6:30164278-30164300 CTCAGAGGACCCCACAGAGGTGG + Intronic
1006374542 6:33664714-33664736 CACTGGTGCCCCTCCAGATGAGG - Intronic
1006384931 6:33725412-33725434 CGCAGGGGACCCACCACAGGGGG - Intronic
1007252594 6:40506015-40506037 CTCTGAGGGCCCTCCAGTGAGGG + Intronic
1010711034 6:79174339-79174361 CTCTGGGAACCCACCAGAGTGGG + Intergenic
1011056705 6:83212634-83212656 GTCTGGGGACCCCTCAGAGCTGG + Intronic
1013474740 6:110496945-110496967 CTCTGGGAAAAGTCCAGAGGTGG + Intergenic
1017371100 6:153710102-153710124 CTCTTGGGACACTCCAGTAGAGG - Intergenic
1017774982 6:157673376-157673398 TTTTGGTGACCCTCCAGGGGTGG + Exonic
1019576704 7:1741161-1741183 CTTTGGGGTCCCTCCAAAGCTGG + Intronic
1019887724 7:3919944-3919966 CTCTGGGGTCACAGCAGAGGGGG + Intronic
1020058125 7:5132607-5132629 TAATGGGGACCCTTCAGAGGAGG - Intergenic
1021027336 7:15686046-15686068 CTCTGGGGGCCCTCCAGAGTCGG + Exonic
1021840044 7:24714844-24714866 CTCTGCGGACCCTTCGGTGGCGG - Intronic
1022451781 7:30522993-30523015 CTCTGGGGTCCCTCTAGGTGAGG + Intronic
1022508938 7:30923150-30923172 CTCTGGGGCCCTTCCAAAGCTGG + Intronic
1022655301 7:32313738-32313760 CTCTGGGGACTGTCATGAGGTGG + Intergenic
1023830758 7:44037854-44037876 CTCAGGGGTCCCACCAGATGAGG - Intergenic
1024617328 7:51126855-51126877 CTCTGGTGACACTGAAGAGGGGG - Intronic
1026018984 7:66693706-66693728 CTCTCGGGACCCTCCTGAAATGG - Intronic
1026881410 7:73908970-73908992 CTTTGGGGACCCTCCTGAGATGG + Intergenic
1027221698 7:76218223-76218245 CTCTGAGGACCCTCCCAAGCTGG - Intronic
1027244217 7:76355561-76355583 CTCTGTAGACTCTTCAGAGGTGG - Intronic
1029741094 7:102492170-102492192 CTCAGGGGTCCCACCAGATGAGG - Intronic
1029759086 7:102591340-102591362 CTCAGGGGTCCCACCAGATGAGG - Intronic
1029975268 7:104827872-104827894 CTCTGGGGACCTCACAAAGGAGG + Intronic
1034162437 7:149003164-149003186 CACTGGGGGCTCTCAAGAGGTGG + Exonic
1034330931 7:150281683-150281705 ATCTGCGGACCCTCCTCAGGCGG - Intronic
1034435618 7:151061513-151061535 GTCAGGGCACCCACCAGAGGTGG - Intronic
1034552358 7:151829791-151829813 TTCCGGGGACCCTGCAGCGGGGG + Intronic
1035067388 7:156117001-156117023 CTCTGGCCAGCGTCCAGAGGCGG - Intergenic
1035261398 7:157663667-157663689 CTCTTGGGAATCTCCAGACGTGG + Intronic
1035797954 8:2376538-2376560 CTGTGGTGACCTTTCAGAGGAGG - Intergenic
1036792591 8:11731499-11731521 CTCTGGGGGCCCCACAGAAGTGG - Intronic
1038894359 8:31764895-31764917 CTCTGGGGACCCTTGTGGGGTGG - Intronic
1039826316 8:41176850-41176872 CTGTGGGGTGCTTCCAGAGGAGG - Intergenic
1039846258 8:41327819-41327841 CTCCTGGGACCCACCAGGGGAGG + Intergenic
1041044688 8:53879369-53879391 CTCCGGGGAGCCTCGGGAGGGGG - Exonic
1044320730 8:90798031-90798053 CCCTGGGAAGGCTCCAGAGGGGG + Intronic
1046190410 8:110788346-110788368 CTATGGGGACTCCCCAGTGGAGG - Intergenic
1048274146 8:133053158-133053180 CTCTGCAGAGGCTCCAGAGGAGG + Intronic
1049004635 8:139847052-139847074 ATCTGGGGACCCTGCAGGGCAGG - Intronic
1049605065 8:143525544-143525566 CCCTGGGGCCCATCCTGAGGGGG + Intronic
1050232425 9:3541176-3541198 CTCTGGAGACCCTCTTGTGGAGG + Intergenic
1052759287 9:32573199-32573221 ATCTGGGGCCCTTGCAGAGGCGG - Intergenic
1053456204 9:38234752-38234774 CCCAGGGGACCCTCCTGGGGTGG + Intergenic
1053456879 9:38239976-38239998 CTCTGAGGACCCTTCACAGGGGG - Intergenic
1056517961 9:87372746-87372768 CTATGGGGACCCAGCAGAGGAGG - Intergenic
1056518914 9:87381880-87381902 CTCAGGGGCCTCTCCAGAGAAGG - Intergenic
1057719271 9:97519088-97519110 ATGTGGGAACACTCCAGAGGAGG - Intronic
1057731577 9:97613533-97613555 TTCTGGGGGCCCTGCAGAGTTGG + Intronic
1057863214 9:98658547-98658569 CTCTGTCAACCCTCCAGAGGCGG + Intronic
1060190175 9:121587700-121587722 CAATGGGGAGCCACCAGAGGTGG + Intronic
1060256370 9:122034657-122034679 CTCTGAGCCACCTCCAGAGGTGG - Intronic
1060849019 9:126860138-126860160 CTCTGGGGACCTGTCATAGGGGG - Intergenic
1061064131 9:128267043-128267065 CTCTGGGGTCCCTCCAGCTGAGG + Intronic
1061665495 9:132158667-132158689 CTCTGGGGACTTCCAAGAGGAGG - Intergenic
1061783442 9:133008770-133008792 CTCAGGCCACCCTCCAGCGGTGG - Intergenic
1061922775 9:133791262-133791284 CTCTGGGGAGCCCCAGGAGGTGG + Intronic
1062361003 9:136188038-136188060 CATTGGTGACCCTCCAGAGTTGG - Intergenic
1062554745 9:137108872-137108894 CTCTGTGGGCCGACCAGAGGGGG + Exonic
1203568505 Un_KI270744v1:111035-111057 CTGTGAGGAATCTCCAGAGGAGG + Intergenic
1203655119 Un_KI270752v1:16366-16388 CTCTAGGGACAATTCAGAGGTGG + Intergenic
1188261871 X:28032927-28032949 CCCTGGGGACCCTCATGAGAAGG + Intergenic
1192104237 X:68298216-68298238 CTTTGAGGACCATCCAGTGGTGG + Intronic
1192840287 X:74848487-74848509 CTTTGCAGAGCCTCCAGAGGAGG - Intronic
1195042806 X:101029798-101029820 CTCTGTGGTCACTCCAGATGTGG - Intronic
1200045113 X:153396985-153397007 GTCTGGAGCCCCTCCAGTGGGGG + Intergenic
1200690920 Y:6306006-6306028 CTCTGGGGCCGCTCCCCAGGAGG - Intergenic
1201044352 Y:9868710-9868732 CTCTGGGGCCGCTCCCCAGGAGG + Intergenic
1202366789 Y:24171109-24171131 CTCTGGGGTCCCTCCAGGTGAGG - Intergenic
1202373618 Y:24214373-24214395 CTCTGGGGTCCCTCCAGGTGAGG + Intergenic
1202497163 Y:25455747-25455769 CTCTGGGGTCCCTCCAGGTGAGG - Intergenic
1202503993 Y:25499014-25499036 CTCTGGGGTCCCTCCAGGTGAGG + Intergenic