ID: 1165831022

View in Genome Browser
Species Human (GRCh38)
Location 19:38730358-38730380
Sequence TGGGGACCCTCCAGAGGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 253}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831010_1165831022 19 Left 1165831010 19:38730316-38730338 CCTTGCTGATGCTCCTCCGGGTC 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831004_1165831022 27 Left 1165831004 19:38730308-38730330 CCCGGGCCCCTTGCTGATGCTCC 0: 1
1: 0
2: 2
3: 28
4: 299
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831013_1165831022 6 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831005_1165831022 26 Left 1165831005 19:38730309-38730331 CCGGGCCCCTTGCTGATGCTCCT 0: 1
1: 0
2: 4
3: 35
4: 316
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831016_1165831022 3 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831007_1165831022 21 Left 1165831007 19:38730314-38730336 CCCCTTGCTGATGCTCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253
1165831009_1165831022 20 Left 1165831009 19:38730315-38730337 CCCTTGCTGATGCTCCTCCGGGT 0: 1
1: 0
2: 0
3: 18
4: 108
Right 1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG 0: 1
1: 0
2: 2
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831022 Original CRISPR TGGGGACCCTCCAGAGGTGG AGG Exonic
900134096 1:1106918-1106940 GGGGGACCCTCCACAGCTGCTGG - Intronic
900579399 1:3401078-3401100 TGAGGACCCGCCAGGGGTGCTGG + Intronic
901451693 1:9339969-9339991 TGGGGGTCCTCCCGAGGTGGGGG - Intronic
901627330 1:10631576-10631598 TGGGGACCCTCCAGTGGGTAGGG - Intergenic
901673466 1:10869131-10869153 TGGGGACCCTGCAGAGCCTGCGG + Intergenic
901679612 1:10905344-10905366 GGGGGGCCCTCAAGGGGTGGGGG + Intergenic
902325733 1:15699345-15699367 TGGGGCCCATCGTGAGGTGGGGG - Intronic
902410447 1:16208705-16208727 CAGGGTCCCTCCAGAGCTGGGGG + Exonic
902499673 1:16901535-16901557 TGGGGACTTTCCCCAGGTGGTGG - Intronic
903466699 1:23556962-23556984 TGGGGAGCCACCAGGGGTGTGGG + Intergenic
905763069 1:40576715-40576737 TGGGGACTGTCAAGGGGTGGGGG + Intergenic
906584923 1:46967703-46967725 TAGGGACCCTCCTGAGATGCAGG + Intergenic
906667372 1:47631479-47631501 TCGGGGCCCTGCAGAGGTTGTGG - Intergenic
906686344 1:47765809-47765831 TGGGCACCCCCTGGAGGTGGTGG + Exonic
906710317 1:47924591-47924613 TTGGCACCCTCCACAGCTGGGGG - Intronic
910999652 1:93149514-93149536 TGGGGATCCTCAATAGGTGAAGG - Intergenic
913532061 1:119740525-119740547 TGGGGACCTTGCAGAGGGAGGGG + Intronic
916073969 1:161189524-161189546 TTGGGAACTTCCAGAGGTGAGGG + Exonic
920684226 1:208096805-208096827 TGGGAACCTGACAGAGGTGGAGG - Exonic
921055952 1:211542657-211542679 GGTGGACTCTCAAGAGGTGGGGG - Intergenic
924222130 1:241888554-241888576 TTGGGACTCTCCAGGGGTTGTGG + Intronic
924429291 1:243983069-243983091 TGGAGACACTCCAGAAGAGGTGG - Intergenic
924550906 1:245075929-245075951 TGGGGAAACAGCAGAGGTGGAGG + Intronic
1067699374 10:48557748-48557770 TAGGGCCCCTGCAGTGGTGGGGG - Intronic
1068051946 10:51961347-51961369 TGAGGAACCTGCAGATGTGGAGG + Intronic
1068249887 10:54424847-54424869 TGGGGCCCGTCAAGCGGTGGGGG + Intronic
1069557212 10:69406350-69406372 TGGGGCACCTGGAGAGGTGGGGG - Intronic
1069898899 10:71695849-71695871 TGGGAGCTCTCCAGAGGGGGTGG - Intronic
1069917077 10:71793761-71793783 TGGTTTCCCTCCAGAGGAGGGGG - Intronic
1071954622 10:90744242-90744264 TGGGGTGGCTGCAGAGGTGGTGG - Intronic
1072628995 10:97132682-97132704 ACTGGACCCTCCAAAGGTGGGGG - Intronic
1075198669 10:120383024-120383046 TGGTGCCCCTCCATAGGTGGGGG - Intergenic
1075391406 10:122095159-122095181 TGGGGACCCTCCTTAGGAGGGGG + Intronic
1075703624 10:124485092-124485114 TGGGGGCTCTCAAGAAGTGGCGG + Intronic
1075909208 10:126108767-126108789 TGGGGACCCTCCACAGTTCACGG + Intronic
1076482584 10:130794458-130794480 TGGGGACCCAAGAGAGGTGATGG + Intergenic
1077464706 11:2728191-2728213 AGTGGCCGCTCCAGAGGTGGAGG - Intronic
1083598872 11:63933846-63933868 TGGGGACTGTGCCGAGGTGGGGG + Intergenic
1084706874 11:70820741-70820763 TGGGGACCCTAGGGAGGTGCAGG + Intronic
1084937778 11:72596206-72596228 TTGGGATCCTCCAGATGGGGTGG - Intronic
1085396769 11:76210413-76210435 CGGGGACCCGCCAGGGCTGGGGG - Intronic
1085781082 11:79409756-79409778 TTGGGACTCTCTGGAGGTGGAGG + Intronic
1086352053 11:85952163-85952185 TGGGGACTGTCATGAGGTGGGGG - Intergenic
1086455286 11:86954765-86954787 AGGGGTCCCGCCAGGGGTGGGGG + Intronic
1090058656 11:123444921-123444943 TGGGGAGCCTCAAGATGGGGAGG - Intergenic
1090670471 11:128941924-128941946 AAGGGACCCTCTAGAGGTTGTGG + Intronic
1091563165 12:1629824-1629846 GGGGCATCCTCCAGAGGAGGGGG + Intronic
1092194512 12:6541268-6541290 AGGGGAACCACCAGAGCTGGTGG + Intronic
1092335674 12:7630795-7630817 TGGGGACCCTCAAGTGGGGAGGG - Intergenic
1093010476 12:14101695-14101717 TGTGGAGACTCCACAGGTGGGGG + Intergenic
1094495241 12:30985141-30985163 GGGGGTCCCTCCAGAGGCGACGG - Intronic
1096100061 12:48965463-48965485 TGGGGACCCTCCAAAGGAAGGGG - Exonic
1096818462 12:54216323-54216345 TGGGAACCCGTCAGGGGTGGTGG - Intergenic
1097629516 12:62042910-62042932 TGAGGACCCTACAGAAGGGGAGG - Intronic
1100827000 12:98483849-98483871 AGGGGAGCCTCCAGAGGAGGAGG + Intergenic
1102997100 12:117359619-117359641 TGGGGACCCTCCCTCCGTGGTGG + Intronic
1103328670 12:120138576-120138598 TGTGGGCCCTCCAGAGGGAGTGG - Intronic
1103547668 12:121713304-121713326 GGGAGACCCTGCAGAGGTGGGGG - Intronic
1104823971 12:131695268-131695290 TGAGGATGCTGCAGAGGTGGAGG - Intergenic
1110461082 13:75746456-75746478 GGGAAACCCTCTAGAGGTGGTGG + Intronic
1112660802 13:101505456-101505478 TGGGGACCCTAAACAGGTTGTGG + Intronic
1113654002 13:112056992-112057014 TGGGGACCCGCTGGAGCTGGAGG + Intergenic
1114655098 14:24311141-24311163 CGCGGTCCCTCCACAGGTGGCGG - Exonic
1117618990 14:57564824-57564846 TGGGGACCAGAGAGAGGTGGTGG - Intronic
1118785855 14:69044837-69044859 TGGGGACCCTGAAAAGGTGGAGG - Intergenic
1118880305 14:69819999-69820021 TGGGCACACTCCAGGGGTAGAGG - Intergenic
1121665871 14:95671733-95671755 TGGGGAACAACCAGAGGAGGAGG + Intergenic
1122238537 14:100346421-100346443 TGGGGTCCCACCAGAGCTGTTGG + Intronic
1122774360 14:104110702-104110724 TAAGGGCCCTCCAGAGGAGGGGG + Intronic
1122882645 14:104696982-104697004 TGGGGACCCTGAAGCAGTGGCGG - Intronic
1125600951 15:40915583-40915605 TAGGGTCCCTTCGGAGGTGGTGG + Intergenic
1125685593 15:41561437-41561459 GTGGGACCTTCCAGAAGTGGGGG + Intronic
1127360551 15:58241241-58241263 TGGGAACCCTTAAGAGATGGTGG + Intronic
1127497167 15:59524194-59524216 TGTGGAGGCACCAGAGGTGGGGG + Intergenic
1128329466 15:66746126-66746148 TGGGGAAGCTCCAGAAGGGGTGG - Intronic
1128396683 15:67233434-67233456 TGGGGATCCTGCAGATGTTGAGG + Intronic
1128719227 15:69933986-69934008 TGTGGACTCTCCAGAGGTCTGGG + Intergenic
1129296096 15:74600957-74600979 TGTGGACCCTCTAGATGGGGTGG - Intronic
1129699108 15:77757422-77757444 TGGGAACACCACAGAGGTGGAGG + Intronic
1130062265 15:80578495-80578517 TGGGGACCATGCTGAGGAGGAGG + Intronic
1130175709 15:81568177-81568199 TGGGGTCTCTGCAGAGCTGGTGG - Intergenic
1130881642 15:88060601-88060623 TGGGGACCATCCAGAAGAGCAGG + Intronic
1131870238 15:96756741-96756763 TGGGGACCCTGGGGAGGTGGCGG + Intergenic
1132042694 15:98538285-98538307 TGGCGACACCCCAGGGGTGGTGG - Intergenic
1133026285 16:2990271-2990293 TGGGGTCCCAGCTGAGGTGGGGG - Intergenic
1133659878 16:7905983-7906005 TGGGCACCATCCAGAGGAGAGGG + Intergenic
1135293602 16:21260890-21260912 AAGGTACCCTTCAGAGGTGGAGG - Intronic
1135673180 16:24392091-24392113 TGAGGACAGTCCAGAGGTGTTGG + Intergenic
1135994555 16:27238308-27238330 TGGGGTCCAGCCAGGGGTGGTGG - Intronic
1136055116 16:27682660-27682682 TGGGGAGCCTACAGTGATGGGGG + Intronic
1136622201 16:31436684-31436706 TGTGGACCCGCCAGTGCTGGAGG + Exonic
1136993112 16:35169373-35169395 GGTGGGACCTCCAGAGGTGGAGG + Intergenic
1137506244 16:49056345-49056367 TAGGGACCCTGCAGAGGGTGAGG + Intergenic
1138338277 16:56269779-56269801 TTGTGACCCTCCAGAAGTTGGGG + Intronic
1138497056 16:57415312-57415334 TGGGGAGCCTGCAGGGGTTGGGG - Intronic
1140447214 16:75039881-75039903 TAGGGATCCTCCAGATGTTGTGG + Intronic
1140607845 16:76562790-76562812 TGTAGACCCTCAACAGGTGGTGG + Intronic
1141177577 16:81730823-81730845 TGGGGAACCCCCTGAGATGGGGG + Intergenic
1141693048 16:85607203-85607225 GGGTGCCTCTCCAGAGGTGGGGG + Intergenic
1141760490 16:86025838-86025860 TGGGGAGCCTCCTGACTTGGAGG - Intergenic
1141811716 16:86380367-86380389 TGGGGGCCCTCCGGGGGTGGGGG + Intergenic
1142903210 17:3026260-3026282 TGGGGAGCCGCCAGAGGTCCCGG + Intronic
1144585754 17:16486634-16486656 TGGGGCCTCTGCCGAGGTGGCGG - Intronic
1144631211 17:16873404-16873426 TGGGGACCATCAAGAGGTGCTGG + Intergenic
1144763897 17:17722710-17722732 GGGGGACCCTCCCCAGCTGGGGG - Intronic
1144836346 17:18158508-18158530 GGGGGACCCTGCAGAAGAGGCGG - Exonic
1146627476 17:34445375-34445397 TGGGGAGGCTCCAGTGGGGGTGG - Intergenic
1146977938 17:37131676-37131698 TCGGGACCTTCCAAAGATGGAGG + Intronic
1147425660 17:40344883-40344905 AGGGGACCCTTCCAAGGTGGTGG - Intronic
1147570702 17:41568768-41568790 TGGGTACCCTCCAGCCATGGAGG + Intronic
1149659072 17:58324992-58325014 TGGGGACCCTCCTGAGGTTGGGG + Exonic
1150291788 17:63986586-63986608 TGGGCACCCTTCGGAGCTGGGGG - Intergenic
1151354883 17:73552461-73552483 AGGGGACCCTCCTGAGGGGGTGG + Intronic
1151596775 17:75082752-75082774 TGAGGACCCTCCTGAGCAGGTGG + Intergenic
1151724342 17:75875811-75875833 TGGCGCCCATCCAGAAGTGGAGG - Intronic
1152710215 17:81867603-81867625 TGGGGACCCTGGTGGGGTGGTGG - Intergenic
1157613856 18:48975724-48975746 CAGGGACCCTCCCGGGGTGGGGG + Intergenic
1158689043 18:59643966-59643988 GTGGGAGGCTCCAGAGGTGGGGG - Intronic
1160395804 18:78571885-78571907 TGTGGACCCGTAAGAGGTGGCGG + Intergenic
1160585103 18:79909734-79909756 TGGGGACTCTGGTGAGGTGGTGG - Intronic
1160585130 18:79909826-79909848 TGGGGACTCTGGTGAGGTGGTGG - Intronic
1160585265 18:79910286-79910308 TGGGGACTCTGGTGAGGTGGTGG - Intronic
1160585275 18:79910316-79910338 TGGGGACTCTGGTGAGGTGGTGG - Intronic
1160585285 18:79910346-79910368 TGGGGACTCTGGTGAGGTGGTGG - Intronic
1160585295 18:79910376-79910398 TGGGGACTCTGGTGAGGTGGTGG - Intronic
1160757463 19:765143-765165 TGGGGACCCTGGGGAGGCGGGGG + Intergenic
1161009989 19:1955349-1955371 CGGGGCCACTCCTGAGGTGGGGG + Intronic
1161596525 19:5153737-5153759 TGGGGACCCTGGAGAGTGGGAGG - Intergenic
1162029457 19:7911165-7911187 TGGGGGCCCCCCAGCGGGGGAGG + Intronic
1162152381 19:8655555-8655577 TGTGGAACCTCCCGCGGTGGAGG - Intergenic
1162336194 19:10061986-10062008 TGGGGACCCCCGGGAGGTGAGGG + Intergenic
1162948082 19:14055418-14055440 CGGTGACCCTGCAGAGATGGCGG + Exonic
1163650596 19:18515592-18515614 GGGGCACCCTCCACAGGTGTAGG + Intronic
1163754682 19:19099580-19099602 TGAGCAAACTCCAGAGGTGGGGG + Intronic
1165094608 19:33403318-33403340 TCTGGACCCTGCAGACGTGGTGG - Intronic
1165831022 19:38730358-38730380 TGGGGACCCTCCAGAGGTGGAGG + Exonic
1166676632 19:44745319-44745341 TGGGGGCCCTCCAGAGGCCAAGG + Intergenic
1167043366 19:47036005-47036027 TGGGGACCACTCAGAGGTGCTGG + Exonic
1167086132 19:47310860-47310882 TGGGGACCCTCCATGGTTGGTGG + Intronic
1168707401 19:58477834-58477856 TGGGGTCCCACCAGAGATGAGGG + Intronic
1168721161 19:58555739-58555761 GGTGGGACCTCCAGAGGTGGAGG + Exonic
926872804 2:17441508-17441530 TGTGCAACCTCCACAGGTGGGGG - Intergenic
928727461 2:34191508-34191530 AGGGCAACCTCCAGAGGTGGGGG - Intergenic
929810914 2:45188634-45188656 TGGGGACCCTGCAGAGGTCAGGG - Intergenic
929869578 2:45746965-45746987 GTGGGACACTGCAGAGGTGGCGG - Intronic
930115793 2:47717196-47717218 TCTGGACCCTACAGAGGTGATGG + Intronic
931536588 2:63284285-63284307 TGGGGACCCCCCACAGGTAAGGG - Intronic
932623188 2:73278670-73278692 TGGGGAACCCCCAGAGGTGGTGG + Intronic
932689681 2:73901496-73901518 TGGAGACCCTGCTGAGCTGGGGG + Intronic
932955351 2:76345306-76345328 TGGGGACTGTCCTGGGGTGGGGG - Intergenic
934037998 2:88104640-88104662 TGGGGGCCACCCCGAGGTGGCGG - Intronic
934654550 2:96110335-96110357 TGGGGACCATGCAGAGGATGGGG + Intergenic
934708399 2:96500404-96500426 TGGGGACCCCGCAGGGGAGGTGG - Intronic
935168376 2:100589742-100589764 GGGGCACCCTCAAGTGGTGGAGG - Intergenic
935744136 2:106176155-106176177 TGGGGAGCAGCCAGGGGTGGGGG - Intronic
936631791 2:114211160-114211182 TGGGGAGCTTCCAGTGGTGGAGG + Intergenic
938157267 2:128952198-128952220 GAGGGACCTTCCGGAGGTGGAGG - Intergenic
938802983 2:134779784-134779806 AGGGGACCCTCCGGAGTTTGAGG - Intergenic
940055441 2:149508032-149508054 TGGGGACCCAGCAGAGGGAGAGG + Intergenic
944921746 2:204421308-204421330 TTGGGTCCCTCTGGAGGTGGAGG - Intergenic
945496990 2:210520466-210520488 TGGGGCCCATCGTGAGGTGGAGG - Intronic
948105846 2:235412854-235412876 TGGAGACCCTCTAGAGGTGCGGG - Intergenic
948402829 2:237696346-237696368 TGGGGAAACTTCAGAGGAGGGGG - Intronic
948497490 2:238361587-238361609 TGGGCTCCCTAGAGAGGTGGGGG - Intronic
948854200 2:240722484-240722506 TTGGGAGCCTCCAGGGGTGATGG + Exonic
1168835458 20:874416-874438 TGGAGGCCACCCAGAGGTGGTGG + Intronic
1171014835 20:21530769-21530791 TGGGGGCCATACGGAGGTGGAGG + Intergenic
1175931000 20:62493693-62493715 TGGGACCCCTCCAGGGCTGGGGG - Intergenic
1176292997 21:5056080-5056102 TGGGCTCCCTCCAGGGCTGGGGG - Intergenic
1179558928 21:42200282-42200304 TTGGGACCCTGCAGAGGAGTAGG - Intronic
1179580957 21:42343679-42343701 GGGGGACCCCCCAAAGGAGGAGG + Intergenic
1179864263 21:44207570-44207592 TGGGCTCCCTCCAGGGCTGGGGG + Intergenic
1180083409 21:45496975-45496997 TGGGGACCCCTGAGTGGTGGTGG + Intronic
1180943930 22:19679435-19679457 TGGGGCCCAGCCAGGGGTGGTGG - Intergenic
1181955539 22:26585492-26585514 TGGGGCCCCTCCAGAGATCTGGG - Intronic
1182488581 22:30654579-30654601 TGGGGACCCGGAAGTGGTGGGGG + Intronic
1183383254 22:37501165-37501187 TGGGGAAGGTGCAGAGGTGGTGG - Intronic
1184096873 22:42320865-42320887 GAGGGACCCACCAGAGGTGGGGG + Intronic
1184259337 22:43305702-43305724 TTGGGACCCACCCGTGGTGGAGG - Intronic
1184661766 22:45968735-45968757 TGGGGACCCCCCACTGGAGGTGG - Intronic
1184692879 22:46125307-46125329 TGGGGACCCTGCTGAGGCTGGGG - Intergenic
1185033066 22:48455398-48455420 TGGAAACCCTCCTGGGGTGGAGG - Intergenic
1185282899 22:49983295-49983317 TGGGGTCCCTCCTGGGGTGAAGG + Intergenic
1185294524 22:50046698-50046720 TGGGGACCCTGCTGAGGGAGGGG - Intronic
949300608 3:2579422-2579444 TGGAGACACTGCAGAGCTGGCGG + Intronic
949511453 3:4770557-4770579 GGGGGCCCCTCCAGATGAGGTGG + Intronic
950136795 3:10586782-10586804 TGGAGACCTTCCAGAGAAGGTGG + Intronic
950170483 3:10835525-10835547 TGGGGACTTTCCAGAGGAGCAGG - Intronic
950552686 3:13676239-13676261 TCGGGACACTCCAGGGGAGGGGG - Intergenic
951238783 3:20266003-20266025 TGGGGCCTGTCCAGGGGTGGGGG - Intergenic
954259157 3:49426193-49426215 TGAGGACTTACCAGAGGTGGGGG - Intronic
955014112 3:55051567-55051589 TGCCCTCCCTCCAGAGGTGGAGG + Intronic
957170042 3:76726573-76726595 TTGGGACCTTACAGAGTTGGTGG - Intronic
961650608 3:128415028-128415050 TGGGAACCCTGCAGAGGATGGGG + Intergenic
961791641 3:129380762-129380784 TGGGGGCCTGCCAAAGGTGGCGG + Intergenic
961941339 3:130640155-130640177 CCGGGAACCTCCAGAAGTGGAGG - Intronic
962015736 3:131438598-131438620 AAAGGACCCTCCAGAGGGGGAGG - Intergenic
962365532 3:134776735-134776757 TGGGTATTCTCCAGAGTTGGAGG + Intronic
962658799 3:137579556-137579578 TGGGGACTATCGGGAGGTGGGGG - Intergenic
963872680 3:150435220-150435242 TTGGGATCCCACAGAGGTGGTGG - Intronic
966742533 3:183247604-183247626 TGTGGAACCTACAGAGATGGAGG - Intronic
967926495 3:194652959-194652981 TGAGGACTGTCCAGAGGAGGAGG - Exonic
969161925 4:5267860-5267882 TGGGCAGCCTCCAGAGATGGTGG - Intronic
969515288 4:7644362-7644384 TCTCCACCCTCCAGAGGTGGAGG + Intronic
971834943 4:31750613-31750635 TGGGGCCCGTCGAGGGGTGGGGG - Intergenic
972307600 4:37846963-37846985 TGGGGGCCCTCCTGGGCTGGTGG + Exonic
973878151 4:55241754-55241776 TGGGGAGGCTCCAGTGGTGCAGG - Intergenic
975121643 4:70735221-70735243 TGGTGCCCCTCCTGAGGGGGAGG + Intronic
976150598 4:82087522-82087544 TGGGGACTCTTCTGGGGTGGGGG - Intergenic
976342896 4:83964670-83964692 TGGGGACCTTCAAGTGGAGGTGG - Intergenic
977310064 4:95374699-95374721 TGGGGACCCTCTGGAGAGGGAGG + Intronic
981461051 4:145014119-145014141 TGTGCAGCCTCCACAGGTGGAGG + Intronic
981635003 4:146867029-146867051 TGGGGAGGCAACAGAGGTGGAGG - Intronic
983935660 4:173501090-173501112 TGGGGCCCCTCCAAAGTGGGCGG + Intergenic
990745305 5:58953235-58953257 TGGGGACTGTCGAGGGGTGGGGG - Intergenic
992939695 5:81750603-81750625 TGGGGAGCCGCCGGGGGTGGCGG - Intronic
994598187 5:101866234-101866256 TGGGGACTATCAAAAGGTGGAGG + Intergenic
996124205 5:119706407-119706429 TGTGCACACTCCACAGGTGGGGG - Intergenic
997416381 5:133732002-133732024 TGGGGACCATCCTCAGCTGGAGG - Intergenic
999320802 5:150613935-150613957 TGGGGACCCTGCAGATGATGGGG + Intronic
1001512893 5:172336317-172336339 AGGGGACCCTCAAGCGGTGGCGG + Exonic
1003204404 6:3993764-3993786 TGGGGACACTCCAGAGGATTCGG - Intergenic
1003740637 6:8934530-8934552 TGGGGCCTGTCCAGGGGTGGGGG + Intergenic
1004430254 6:15536692-15536714 TGGGGACTCTGTGGAGGTGGTGG - Intronic
1006374541 6:33664711-33664733 TGGTGCCCCTCCAGATGAGGAGG - Intronic
1006712152 6:36083560-36083582 TGCAGACCCTACAGTGGTGGTGG + Intronic
1007411464 6:41664507-41664529 TGGGGGCCCTGCAGAGGAGGGGG + Intergenic
1007654107 6:43441873-43441895 TGGAGACCAGACAGAGGTGGGGG + Exonic
1009907275 6:69885187-69885209 TGGGCAACTTACAGAGGTGGTGG - Intronic
1010011089 6:71049459-71049481 TGGGGGCCTTCCAAAGGAGGTGG - Intergenic
1013402216 6:109809862-109809884 TGGGCAAGCTCCAGAGCTGGTGG + Intronic
1017119596 6:151011773-151011795 TGGGGACCAGCCAGGCGTGGTGG + Intronic
1017356583 6:153516987-153517009 TGGGGCCTCTCAGGAGGTGGTGG - Intergenic
1017827875 6:158095831-158095853 GGCGGCGCCTCCAGAGGTGGTGG - Exonic
1018893351 6:167997292-167997314 GGGGGAATCTGCAGAGGTGGGGG + Intronic
1019576707 7:1741164-1741186 TGGGGTCCCTCCAAAGCTGGGGG + Intronic
1020795153 7:12669649-12669671 TGGGGACTCTTCTGAGGTTGTGG - Intergenic
1022655304 7:32313741-32313763 TGGGGACTGTCATGAGGTGGGGG + Intergenic
1023205298 7:37742398-37742420 TGGGGCCTGTCCAGGGGTGGGGG - Intronic
1024680172 7:51678221-51678243 TGGGGCCTGTCCAGGGGTGGGGG + Intergenic
1029169046 7:98617922-98617944 TGGGGACGCTCCCGAGTCGGGGG + Intronic
1031846457 7:126810898-126810920 TGAGGAGCCTACAGATGTGGAGG - Intronic
1032092227 7:128916601-128916623 TGCGGACCCTTCAGAGCTGGGGG - Intergenic
1032519959 7:132536410-132536432 TGGGGTGCATGCAGAGGTGGAGG - Intronic
1034552360 7:151829794-151829816 CGGGGACCCTGCAGCGGGGGAGG + Intronic
1035261401 7:157663670-157663692 TTGGGAATCTCCAGACGTGGGGG + Intronic
1036294176 8:7522009-7522031 CGGGGACCCTGCAGAGGAAGGGG + Intergenic
1036328386 8:7798982-7799004 CGGGGACCCTGCAGAGGAAGGGG - Intergenic
1037734352 8:21554880-21554902 TGGGGGCACTCCCGAGGTGATGG - Intergenic
1038894356 8:31764892-31764914 TGGGGACCCTTGTGGGGTGGGGG - Intronic
1047719481 8:127626263-127626285 TGAGGAGCCTCCAGATGTGTGGG + Intergenic
1048381612 8:133870442-133870464 TGAGAACCTACCAGAGGTGGGGG - Intergenic
1048557509 8:135494854-135494876 TGGGGAACCTGTGGAGGTGGAGG + Intronic
1049086412 8:140481723-140481745 TGAGGAACCTACAGATGTGGAGG - Intergenic
1049925281 9:401358-401380 AGGGGACCATCCAGAGGAGCAGG + Intronic
1052990221 9:34514625-34514647 TCGGGGTCCTGCAGAGGTGGAGG - Exonic
1053063464 9:35049400-35049422 TGGTGACCTTCCAGAAGTGGGGG + Intergenic
1053326983 9:37162487-37162509 TAGGGACCCTTCAGGAGTGGAGG + Intronic
1056603278 9:88063520-88063542 TGGAGACCCAGGAGAGGTGGTGG + Intergenic
1059018912 9:110552337-110552359 TGGGGACTGGCCAGACGTGGTGG - Intronic
1059511978 9:114856907-114856929 TGGGGATACTACAGAGTTGGAGG - Intergenic
1060234586 9:121853452-121853474 GGGGGTTCCTGCAGAGGTGGGGG + Intronic
1060984674 9:127813289-127813311 TGGGGGCACTCCAGAGGTCCGGG - Exonic
1062056482 9:134471807-134471829 TTGGGGCCCTCCTGAGTTGGGGG + Intergenic
1062084873 9:134643258-134643280 GGGGGACCTTCCAGGGCTGGGGG - Intronic
1062086907 9:134653750-134653772 TGGGGACTCTGCAGGGCTGGGGG + Intronic
1062093408 9:134690341-134690363 TGAGGCCCCTCCAGAGGTCACGG - Intronic
1062137482 9:134937363-134937385 TTGGGTCCCTGCAGAGCTGGTGG + Intergenic
1062398836 9:136363606-136363628 CGGGGCCCGTCCAGAGGTCGCGG - Exonic
1062463765 9:136672427-136672449 TGGGGAGCCTCCCGAGGAAGGGG - Exonic
1062496126 9:136832586-136832608 AGGGGTCCCCGCAGAGGTGGAGG - Intronic
1062534669 9:137016201-137016223 TGGGGCCCCTGCAGAGGGCGTGG - Intronic
1203655122 Un_KI270752v1:16369-16391 TAGGGACAATTCAGAGGTGGGGG + Intergenic
1187607817 X:20905627-20905649 TGGGGAGCCTGCAGGGGTTGGGG + Intergenic
1190161953 X:48038578-48038600 TGGGGTCCTTGCAGAGATGGTGG + Intronic
1192207300 X:69105037-69105059 TGTGGCGCCTCCAGATGTGGAGG - Intergenic
1192536456 X:71932564-71932586 TGGCAACCCTGCAGAGGAGGTGG + Intergenic
1196606428 X:117662557-117662579 TGGGGCCTGTCCTGAGGTGGGGG + Intergenic
1199760110 X:150898677-150898699 GCGGGACCCTGCAGAGGCGGCGG - Exonic
1201500695 Y:14639726-14639748 TGGGGACCCTTCAGAGATGTTGG + Intronic