ID: 1165831024

View in Genome Browser
Species Human (GRCh38)
Location 19:38730362-38730384
Sequence GACCCTCCAGAGGTGGAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 373}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831016_1165831024 7 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831009_1165831024 24 Left 1165831009 19:38730315-38730337 CCCTTGCTGATGCTCCTCCGGGT 0: 1
1: 0
2: 0
3: 18
4: 108
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831005_1165831024 30 Left 1165831005 19:38730309-38730331 CCGGGCCCCTTGCTGATGCTCCT 0: 1
1: 0
2: 4
3: 35
4: 316
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831010_1165831024 23 Left 1165831010 19:38730316-38730338 CCTTGCTGATGCTCCTCCGGGTC 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831013_1165831024 10 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373
1165831007_1165831024 25 Left 1165831007 19:38730314-38730336 CCCCTTGCTGATGCTCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG 0: 1
1: 0
2: 4
3: 33
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831024 Original CRISPR GACCCTCCAGAGGTGGAGGT GGG Exonic
900300820 1:1976249-1976271 GAGCCCCCAGTGTTGGAGGTGGG + Intronic
901322919 1:8350274-8350296 GATCCTCCTTAGGAGGAGGTAGG + Intergenic
901712187 1:11124332-11124354 GAAACTCCAGAGGTTGAGGCAGG - Intronic
901778785 1:11578764-11578786 GATACTCCAGAGGCTGAGGTGGG + Intergenic
902410448 1:16208709-16208731 GTCCCTCCAGAGCTGGGGGCTGG + Exonic
902686712 1:18082025-18082047 CAACCTCCAGAGATGGATGTGGG - Intergenic
902785643 1:18731016-18731038 AACCTTACAGATGTGGAGGTCGG + Intronic
902882587 1:19382616-19382638 GATCCCCCAGAGCTGGTGGTAGG + Intronic
903377182 1:22874282-22874304 GACGCACAGGAGGTGGAGGTAGG + Intronic
903614196 1:24640406-24640428 GCTACTCCAGAGGTTGAGGTGGG + Intronic
905079299 1:35303026-35303048 GCTCCACCAGAGGTTGAGGTGGG + Intronic
905769157 1:40626163-40626185 GAGTCTCCAGGGATGGAGGTGGG - Exonic
906688799 1:47779328-47779350 AACCCTCCAGAGGTGTGTGTGGG + Intronic
907162949 1:52384821-52384843 GACCCTTGAAATGTGGAGGTGGG + Intronic
907552071 1:55313065-55313087 GACCCAACAGAGGAGGAGGGGGG - Intergenic
908260378 1:62335646-62335668 GACTCTCCAGTGTTGGAGGTGGG - Intergenic
908267039 1:62389761-62389783 GCCACTCCAGAGGTTGAGGCAGG - Intergenic
909460944 1:75913319-75913341 AACCCTCCAGTGTTGGAAGTGGG - Intergenic
910238747 1:85063354-85063376 GATTCTCCAGAGAGGGAGGTGGG + Intronic
915150700 1:153828956-153828978 GCTCCTCCAGAGGCTGAGGTGGG + Intronic
915287536 1:154862497-154862519 GGCCCTCCAGGGGTGGAAGGTGG + Intronic
915895983 1:159811322-159811344 GCCCCTGCAGAGGAGGAAGTGGG - Intronic
916049443 1:161025429-161025451 GCTACTCCAGAGGTTGAGGTGGG + Intronic
916060003 1:161091839-161091861 AACTGTCCAGAGGTGGAGTTAGG + Intergenic
917433348 1:174994423-174994445 GACAAACCAGAGATGGAGGTAGG - Intronic
918315784 1:183321628-183321650 GCTGCTCCAGAGGTTGAGGTAGG + Intronic
919033695 1:192278326-192278348 GCCTCTCCAGAGGCTGAGGTAGG + Intergenic
919061886 1:192643838-192643860 GCTACTCCAGAGGTTGAGGTGGG + Intronic
919230647 1:194769030-194769052 TAACCTCCAGTGTTGGAGGTTGG - Intergenic
919747330 1:201017030-201017052 GACACTCAAGAGGAGGGGGTGGG - Intronic
919893800 1:201995606-201995628 GAGCCCCAGGAGGTGGAGGTTGG + Intronic
920068965 1:203288982-203289004 GCTACTCCAGAGGTTGAGGTGGG + Intergenic
922904028 1:229160206-229160228 GACTCCCCAGTGTTGGAGGTGGG + Intergenic
923835684 1:237608588-237608610 GATCCTCCAGAGGCTGAGGTGGG + Intronic
923884213 1:238137242-238137264 GACACTCCGGAGGCTGAGGTGGG + Intergenic
924064230 1:240207503-240207525 TACCCTGCAGAGGAGGAGGTTGG - Exonic
924626768 1:245702175-245702197 GATCCTCCATGGCTGGAGGTAGG + Intronic
1062831794 10:610751-610773 AACCCCCCAGTGTTGGAGGTGGG + Intronic
1062831832 10:610873-610895 AACCCCCCAGTGTTGGAGGTGGG + Intronic
1062831872 10:610995-611017 AACCCCCCAGTGTTGGAGGTGGG + Intronic
1062996941 10:1874801-1874823 GAGCCTCCGGGGGAGGAGGTGGG - Intergenic
1063657718 10:8008726-8008748 GACTCAGCAGAGGTGGGGGTGGG + Intronic
1064341232 10:14487378-14487400 TCACCTCCAGAGGTGGAGCTCGG - Intergenic
1065242101 10:23716582-23716604 GAGCCTCCAGAGGGAGAAGTTGG - Intronic
1065951877 10:30659732-30659754 GTCCCTCGGGAGGTTGAGGTTGG + Intergenic
1066001920 10:31112510-31112532 TAACCTCCAGTGTTGGAGGTGGG - Intergenic
1066488081 10:35867741-35867763 GAATCTCCAGTGTTGGAGGTGGG + Intergenic
1066652957 10:37677119-37677141 GAACCACCAGAAGTGGAGGGAGG - Intergenic
1067216306 10:44307045-44307067 GAACCCCCAGTGTTGGAGGTGGG - Intergenic
1067254067 10:44617992-44618014 TACCCCCCAGTGTTGGAGGTGGG - Intergenic
1067781589 10:49211367-49211389 GATACTCCAGAGGTTGAGGTGGG + Intergenic
1067914680 10:50384557-50384579 AACACTCCAGAGGCTGAGGTGGG - Intronic
1070731080 10:78828682-78828704 GACCCTCCAGAGATGGAGTGGGG + Intergenic
1071721649 10:88152682-88152704 GACACACCAGAGGTGGAAGTGGG - Intergenic
1072614030 10:97037795-97037817 GCACCACCAGAGGTGGAGATGGG - Intronic
1073100032 10:101001681-101001703 CAGCCTCCAGAGGTGAAGGCAGG + Exonic
1074233523 10:111561815-111561837 GCCCCACCAGAGGAGGAGGAAGG - Intergenic
1074998592 10:118778742-118778764 GACCCAACTGAGGTGGATGTCGG - Intergenic
1076154705 10:128194761-128194783 TGCTCTCCAGAGGGGGAGGTAGG - Intergenic
1076657136 10:132032095-132032117 GACCCTGTGGAGGTAGAGGTCGG + Intergenic
1076874369 10:133208468-133208490 GACCCTCTAGAGAGGGACGTGGG + Intronic
1078746752 11:14123040-14123062 GATACTCCAGAGGCTGAGGTGGG - Intronic
1079303257 11:19298278-19298300 GACCCTGCAAAGCTGGAGATGGG + Intergenic
1081111411 11:39138166-39138188 GACCCTGGAGAGGAGAAGGTGGG - Intergenic
1083898625 11:65632989-65633011 GAACTTCGGGAGGTGGAGGTGGG - Intronic
1084152966 11:67299750-67299772 TAGGCTCCAGGGGTGGAGGTGGG + Intronic
1086062905 11:82718548-82718570 AATCCTCCCGAGGTGGAGGCAGG - Intergenic
1086455288 11:86954769-86954791 GTCCCGCCAGGGGTGGGGGTGGG + Intronic
1086649360 11:89268770-89268792 GAGCCCAGAGAGGTGGAGGTGGG - Intronic
1089198855 11:116711282-116711304 AACCCTCTGGAGGTGGAGGCCGG - Intergenic
1089874225 11:121704542-121704564 GGTCCTGCAGAGGTGGAGGCTGG - Intergenic
1091781347 12:3216299-3216321 GACCTTCCAGATGTGGGAGTAGG + Intronic
1095431196 12:42136883-42136905 GCTACTCCAGAGGTTGAGGTGGG - Intronic
1095626923 12:44326049-44326071 GCTCCTCCAGAGGCTGAGGTGGG + Intronic
1096470328 12:51871585-51871607 GACCCTCCAGAGTGGGGGGCTGG + Intergenic
1099324494 12:81196885-81196907 GACCCCCCAGTATTGGAGGTGGG - Intronic
1099886564 12:88538268-88538290 GACCCTCCAAATGTTGAGCTAGG + Intronic
1100222060 12:92515962-92515984 AACCCCCCAGTGTTGGAGGTGGG - Intergenic
1101286438 12:103318175-103318197 GCTACTCCAGAGGTTGAGGTAGG + Intronic
1102114901 12:110395534-110395556 GCACTTCCAGAGGCGGAGGTAGG - Intronic
1102456938 12:113077006-113077028 GGCCCTGGAGAGGTGGAGGGTGG + Intronic
1102630524 12:114274755-114274777 TAACCTCCAGTGTTGGAGGTGGG - Intergenic
1103547667 12:121713300-121713322 GACCCTGCAGAGGTGGGGGCTGG - Intronic
1103711156 12:122913708-122913730 GACACTCCAGAGGCTGAGGCAGG + Intergenic
1103822699 12:123711631-123711653 GCTCCTCCAGAGGCTGAGGTGGG + Intergenic
1103992974 12:124811671-124811693 GACCACCCAGAGGGGCAGGTGGG - Intronic
1105203787 13:18202317-18202339 GACCCTGCAGGGGCAGAGGTGGG + Intergenic
1106186248 13:27412506-27412528 GGCCCTCCAGAGGTGCTGGAGGG - Intergenic
1106353837 13:28959786-28959808 TACCCTCCAATGTTGGAGGTAGG - Intronic
1106808370 13:33334585-33334607 GACCCTCAAGAGGTGGGAGTGGG + Intronic
1107074307 13:36305308-36305330 GATTGTCAAGAGGTGGAGGTGGG - Intronic
1107088583 13:36451507-36451529 GCCACTCCAGAGGCTGAGGTGGG - Intergenic
1107915584 13:45146385-45146407 GCCACTCCAGAGGCTGAGGTGGG + Intronic
1108834992 13:54533196-54533218 GACTCTCCAGCTGTGGAGTTGGG - Intergenic
1110494360 13:76149008-76149030 GCCCCACCAGAGATGGGGGTTGG - Intergenic
1110644588 13:77867545-77867567 GAACCACCAGAGCTGAAGGTAGG - Intergenic
1110833123 13:80054249-80054271 CAGCCCCCAGAGGTGGAGGTTGG - Intergenic
1111041526 13:82756140-82756162 GATCCTGCAGAGAAGGAGGTGGG + Intergenic
1112464449 13:99631208-99631230 GCTACTCCAGAGGTTGAGGTGGG + Intronic
1114082464 14:19213255-19213277 GACCCTGTGGAGGGGGAGGTGGG + Intergenic
1115995245 14:39188997-39189019 GCTACTCCGGAGGTGGAGGTGGG + Intergenic
1118084945 14:62404047-62404069 GACCCCCCAGTGTTGGAGGTGGG + Intergenic
1118795372 14:69139037-69139059 GCTACTCCAGAGGTTGAGGTGGG + Intronic
1118864595 14:69693105-69693127 CACCATCTGGAGGTGGAGGTAGG + Intronic
1119783919 14:77298292-77298314 CACCCTCCAGAGATGGAGCCTGG - Intronic
1120084975 14:80262060-80262082 GCCACTCCAGAGGTTGAGGCAGG - Intronic
1120535650 14:85691872-85691894 GCCCTTCCAGTGGTGGAGGGTGG + Intergenic
1120934773 14:89884013-89884035 GCTACTCCAGAGGCGGAGGTGGG + Intronic
1122662206 14:103303947-103303969 GATACTCCAGAGGCTGAGGTGGG + Intergenic
1122836027 14:104431568-104431590 GCCCATCCTGGGGTGGAGGTGGG - Intergenic
1124949395 15:34302702-34302724 GCACTTCCGGAGGTGGAGGTGGG + Intronic
1125685594 15:41561441-41561463 GACCTTCCAGAAGTGGGGGCAGG + Intronic
1125723629 15:41857036-41857058 GAACCTGCAGCGGTGGAGGGTGG + Exonic
1126100214 15:45114193-45114215 CACCCTCCTGCCGTGGAGGTGGG + Intronic
1126457356 15:48878255-48878277 GACCTTCCGCAGATGGAGGTAGG + Exonic
1126739581 15:51764203-51764225 GCTACTCCAGAGGTTGAGGTGGG + Intronic
1126741114 15:51777057-51777079 GAGCCTCCAGAGTTGCTGGTAGG + Intronic
1127008482 15:54596641-54596663 GATCCCCCAGTGTTGGAGGTGGG + Intronic
1127136310 15:55927410-55927432 GACCCTCAGGAGGCTGAGGTGGG - Intronic
1128225988 15:66001671-66001693 GGTCCTGAAGAGGTGGAGGTGGG + Intronic
1128521952 15:68381183-68381205 GACCCTCTAGAGGTGGTGCCTGG - Intronic
1128901750 15:71429085-71429107 GAACCTTCAGAGGAGGAAGTGGG - Intronic
1129182470 15:73885983-73886005 GAGCCTCCAGAAGTGAAGCTGGG + Intronic
1130043711 15:80427927-80427949 GACCCTTCAGAGCTGGAGTCAGG - Intronic
1132051543 15:98611672-98611694 GCTACTCCAGAGGTTGAGGTAGG - Intergenic
1132393835 15:101458025-101458047 GTCCCTCCAGAGGTGGAGCTGGG + Intronic
1132472213 16:111526-111548 GAGCCTTGGGAGGTGGAGGTTGG - Intronic
1132675376 16:1119211-1119233 GGCCCTCGAGAGGTGCAGGGAGG + Intergenic
1132945864 16:2531196-2531218 GACCCTCCAGCCAGGGAGGTGGG - Exonic
1133239170 16:4404412-4404434 GAGCCTGCAGGGGAGGAGGTGGG - Intronic
1133416433 16:5610754-5610776 GCCACTCCAGAGGCTGAGGTGGG + Intergenic
1134078425 16:11308512-11308534 GACCCTCCCTGGGTGAAGGTGGG + Intronic
1134340940 16:13345258-13345280 GGCCTTTCAGAGGTGGAGGATGG - Intergenic
1134378188 16:13699210-13699232 CACACTCAAGAGGTGGAGTTAGG - Intergenic
1134468993 16:14505363-14505385 GCTCCTCCAGAGGCTGAGGTGGG + Intronic
1135305035 16:21360432-21360454 GAGCCTCCTGACGCGGAGGTGGG + Intergenic
1135531282 16:23256876-23256898 GAGACTTCAGAGGTGGAAGTGGG - Intergenic
1135673182 16:24392095-24392117 GACAGTCCAGAGGTGTTGGTGGG + Intergenic
1136301780 16:29339625-29339647 GAGCCTCCTGACGCGGAGGTGGG + Intergenic
1136531702 16:30874503-30874525 GACACTCCTGAGGTTGAGGTGGG + Intronic
1136622203 16:31436688-31436710 GACCCGCCAGTGCTGGAGGAGGG + Exonic
1137245212 16:46697236-46697258 GCTACTCAAGAGGTGGAGGTGGG + Intronic
1138054733 16:53820831-53820853 GACCATCCAGGTGTGGAGTTGGG + Intronic
1139702448 16:68716507-68716529 GATACTCCAGAGGCTGAGGTGGG + Intronic
1139959895 16:70711414-70711436 GACTCTGCACAGGTGGGGGTGGG - Intronic
1141462157 16:84184027-84184049 GAGCCAGCACAGGTGGAGGTCGG - Intronic
1141613826 16:85198888-85198910 GCCACTCCAGAGGCTGAGGTGGG - Intergenic
1141727078 16:85796738-85796760 GACCCTCAGGAGGTGGGGGATGG - Intronic
1142063474 16:88046178-88046200 GAGCCTCCTGACGCGGAGGTGGG + Intronic
1142419517 16:89961853-89961875 GAGCCTCGAAAGGTGGGGGTTGG + Exonic
1142670274 17:1484889-1484911 GACGCTCTACCGGTGGAGGTGGG - Intronic
1142691018 17:1606130-1606152 GACCCTCCAGAGCTGGCCGGGGG + Intronic
1142691035 17:1606174-1606196 GACCCTCCAGAGCTGGCCGGGGG + Intronic
1144124342 17:12188680-12188702 GCCCTTCCTGAGGTGGGGGTGGG - Intergenic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1146887055 17:36478702-36478724 GCTACTCCAGAGGTTGAGGTGGG - Intergenic
1147403223 17:40193242-40193264 GACCCTCCAGAATTGGAGACTGG + Intronic
1148152386 17:45404440-45404462 AGCCCTCCAGAGGAGAAGGTAGG - Exonic
1148245359 17:46026584-46026606 GCCCCTCCAGAGGGCGAGCTTGG - Exonic
1149420856 17:56510003-56510025 GAGACTCCAGTGGTGGAAGTTGG - Intronic
1149434263 17:56619836-56619858 TGCCCTCCAGAGTTGGACGTAGG - Intergenic
1149574172 17:57699751-57699773 AACCCTCCAAAGGTGGATGGGGG + Intergenic
1150161413 17:62901289-62901311 GCCGCTCCAGAGGTGGCTGTGGG + Intergenic
1150556671 17:66261051-66261073 GCCACTCCAGAGGTTGAGATGGG - Intergenic
1151772130 17:76170644-76170666 GTCCCTCTAGAAGTTGAGGTGGG - Intronic
1151887562 17:76932242-76932264 GACACTCGAGAGGCTGAGGTGGG - Intronic
1152631942 17:81414385-81414407 GACCCCACAGAGGCGGAGCTCGG + Intronic
1152773114 17:82182795-82182817 GATACTCCAGAGGCTGAGGTGGG - Intronic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1154942208 18:21125910-21125932 GCTACTCCAGAGGTTGAGGTGGG - Intergenic
1155010740 18:21775349-21775371 GCTACTCCAGAGGTTGAGGTGGG - Intronic
1155510879 18:26575483-26575505 GTCTCTCCAGGGGTGGAGGGAGG + Intronic
1156228640 18:35132922-35132944 CAGCAGCCAGAGGTGGAGGTGGG + Intronic
1157613858 18:48975728-48975750 GACCCTCCCGGGGTGGGGGTGGG + Intergenic
1158374256 18:56846196-56846218 GACCCTCCATTGTTGGAGGTGGG + Intronic
1158968093 18:62640988-62641010 GATACTCCAGAGGCTGAGGTAGG - Intergenic
1159940521 18:74403650-74403672 GCTACTCCCGAGGTGGAGGTGGG - Intergenic
1161399247 19:4060152-4060174 GCCCCTCCTGGGCTGGAGGTGGG + Intronic
1162003619 19:7763715-7763737 GGACCTACAGAGGTGGGGGTTGG + Intronic
1163319987 19:16568945-16568967 GAGCCTCCCAAGGTGGAGGTGGG - Intronic
1163735426 19:18977373-18977395 GCCACTCCAGAGGCTGAGGTGGG - Intergenic
1163773278 19:19203458-19203480 GACGCTCCAGAGGTGGGGTTTGG + Intergenic
1165057427 19:33186724-33186746 GGCCCTCCAGTGTTGGAGGTGGG - Intronic
1165402927 19:35613277-35613299 TCACATCCAGAGGTGGAGGTGGG - Intronic
1165831024 19:38730362-38730384 GACCCTCCAGAGGTGGAGGTGGG + Exonic
1166300654 19:41910357-41910379 CAGCATCCAGAGGTGGAGTTGGG + Intronic
1166356295 19:42229471-42229493 GACACCCCAGAGGTGGAAGGGGG - Intergenic
1167189887 19:47978214-47978236 GCTACTCCAGAGGTTGAGGTGGG - Intronic
1168177050 19:54633673-54633695 GACTCACCAGATGTGGAGGTGGG - Exonic
1168614945 19:57830086-57830108 GATACTCCTGAGGTGGAGCTGGG + Intronic
925072609 2:983064-983086 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072628 2:983216-983238 GAAGCTGCAGAGGTGGAGGTTGG + Intronic
925072633 2:983245-983267 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072644 2:983322-983344 GAAGCTGCAGAGGTGGAAGTCGG + Intronic
925072649 2:983351-983373 GAAGTTGCAGAGGTGGAGGTCGG + Intronic
925132668 2:1504506-1504528 GGACATCCGGAGGTGGAGGTGGG - Intronic
925258514 2:2509866-2509888 AAACCTCCAGTGTTGGAGGTGGG - Intergenic
926350643 2:11991118-11991140 TAATCTCCAGAGTTGGAGGTGGG + Intergenic
927569280 2:24144323-24144345 GCCACTCGGGAGGTGGAGGTGGG + Intronic
927640629 2:24843342-24843364 GCTACTCCAGAGGTTGAGGTGGG - Intronic
928536545 2:32246885-32246907 GATACTCCAGAGGCTGAGGTGGG - Intronic
931502652 2:62887210-62887232 TAGCCTCCCTAGGTGGAGGTTGG - Intronic
932074525 2:68650674-68650696 GACCATCTAGAGTTGGGGGTAGG + Intronic
935637681 2:105262215-105262237 TAACCTCCAGTGTTGGAGGTGGG + Intergenic
935954428 2:108361675-108361697 GATCCACCAGTGGTGGTGGTAGG - Intergenic
937843032 2:126545541-126545563 GTCACTCCAGAGGCTGAGGTGGG + Intergenic
937980399 2:127611389-127611411 CACCCTTCAGAGGTGCTGGTTGG - Intronic
938211101 2:129466312-129466334 GACCCTCTAGTGAAGGAGGTAGG - Intergenic
938494120 2:131783348-131783370 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
943898113 2:193393928-193393950 GCCACTCCAGAGGCTGAGGTGGG + Intergenic
944707663 2:202307653-202307675 GCTACTCCAGAGGTTGAGGTAGG - Intergenic
946186647 2:217984598-217984620 GATACTCCAGAGGCTGAGGTGGG - Intronic
947050338 2:226035401-226035423 GAACCCCCAGTGTTGGAGGTGGG - Intergenic
948079038 2:235190413-235190435 GACTCACCAGAGGTGGTGGGAGG + Intergenic
948379048 2:237540563-237540585 GACCCTGCAGAGGTAGGGGCAGG + Intronic
948643637 2:239390611-239390633 GCTCCTCCACAGGTGGAGGGTGG - Intronic
948780972 2:240321475-240321497 GACCCAGAAGAGGTGGAGGAAGG + Intergenic
1168946153 20:1759920-1759942 GACTCTACAGAGGTAGAGATTGG + Intergenic
1169242402 20:3995188-3995210 CACACCCCAGAGGTGGATGTGGG - Intronic
1170834443 20:19871694-19871716 GACCCCACAGAAGTGGAGATAGG - Intergenic
1171437278 20:25133415-25133437 GACCCAGCAGAGGTGGCGGGCGG - Intergenic
1171793411 20:29548381-29548403 CCCCCTCCATAGGTGGAAGTCGG + Intergenic
1172221622 20:33278064-33278086 GACCCAACAGAGGTGGATGCAGG - Intronic
1173352449 20:42257495-42257517 TAACCTCCAGTGTTGGAGGTGGG + Intronic
1174625133 20:51907879-51907901 GATACTCCAGAGGTTGTGGTAGG + Intergenic
1175621938 20:60454722-60454744 GTCCCTCCAGGAGTGGAAGTAGG - Intergenic
1175809089 20:61847935-61847957 TGCCCTCCAGTGTTGGAGGTGGG - Intronic
1176198320 20:63848065-63848087 GGGCCTCCTGGGGTGGAGGTGGG - Intergenic
1176263221 20:64194287-64194309 GGCACTCCAGAGGTAGAGCTGGG - Intronic
1176711397 21:10152859-10152881 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1176714181 21:10335769-10335791 GACCCTGCAGGGGCAGAGGTGGG - Intergenic
1177892650 21:26825055-26825077 AATCCTCCAGTGTTGGAGGTGGG - Intergenic
1178115118 21:29408908-29408930 GATACTCCAGAGGCTGAGGTAGG + Intronic
1178844301 21:36161598-36161620 GCTACTCCAGAGGTTGAGGTAGG - Intronic
1179489699 21:41733375-41733397 GAGCCTGGAGGGGTGGAGGTGGG + Intergenic
1179580958 21:42343683-42343705 GACCCCCCAAAGGAGGAGGAAGG + Intergenic
1179962340 21:44775276-44775298 CACCTTGCAGAGGTGGTGGTTGG - Intronic
1180498313 22:15909415-15909437 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1180704108 22:17798250-17798272 GACTTTCAAGAGGTGGAGGCTGG + Intronic
1180720789 22:17906829-17906851 CACTCCCCAGAGGGGGAGGTGGG + Exonic
1180761244 22:18209663-18209685 GACCCTGCAGGGGCAGAGGTGGG - Intergenic
1180774423 22:18414956-18414978 GACCCTGCAGGGGCAGAGGTGGG + Intergenic
1180807576 22:18725773-18725795 GACCCTGCAGGGGCAGAGGTGGG + Intergenic
1181070537 22:20333964-20333986 GACCCTGCAGGGGCAGAGGTGGG + Intergenic
1181081713 22:20419900-20419922 GCTACTCCAGAGGTTGAGGTGGG - Intergenic
1181193522 22:21161906-21161928 GACCCTGCAGGGGCAGAGGTGGG + Intergenic
1181215923 22:21330692-21330714 GACCCTGCAGGGGCAGAGGTGGG - Intergenic
1181574702 22:23786554-23786576 GTCCCTGCAGCTGTGGAGGTGGG - Intergenic
1181780124 22:25186492-25186514 GCTACTCCAGAGGTGGAAGTGGG + Intronic
1183260088 22:36789165-36789187 GCTCCTCCAGAGGCAGAGGTGGG - Intergenic
1183317302 22:37143723-37143745 CACCTGCCAGAGGAGGAGGTGGG + Intronic
1183337814 22:37260646-37260668 GACCACCCAGAGCTGGAGGATGG - Intergenic
1183486856 22:38092748-38092770 GACCCCCCAGTGTTGGAGGTGGG + Intronic
1183594534 22:38802700-38802722 GAACCCCGGGAGGTGGAGGTTGG + Intergenic
1183631320 22:39034593-39034615 GATACCCCAGAGGTGCAGGTAGG - Intergenic
1184841004 22:47052398-47052420 GACCCTCAAGGTGAGGAGGTGGG + Intronic
1185375037 22:50478739-50478761 GCCCCTCCAGAGCTGGCGCTGGG + Intergenic
949117182 3:340823-340845 GACCCTCTTGAAGTGGAGGAGGG + Exonic
949556992 3:5163097-5163119 GCTACTTCAGAGGTGGAGGTAGG - Intronic
950050662 3:9986611-9986633 GACCACCCAGAGGCGGATGTTGG + Exonic
952664905 3:35892594-35892616 TATCCTCCAGAGGTAAAGGTGGG - Intergenic
952966344 3:38623427-38623449 GGCCTTGCAGAGGTGGAGGAGGG - Intronic
954033124 3:47834579-47834601 GTTACTCCAGAGGTTGAGGTGGG - Intronic
954618913 3:51984701-51984723 GCTACTCCAGAGGTTGAGGTGGG + Intronic
954804852 3:53211997-53212019 GAATCTCCAGTGTTGGAGGTGGG - Intergenic
959592228 3:108092834-108092856 CAACCTTCAGAGGTGGAGATCGG + Intergenic
961438201 3:126933702-126933724 GACTCCCCAGTGTTGGAGGTGGG - Intronic
961974110 3:131004767-131004789 GCCTCTGCAGAGGTGGTGGTAGG + Intronic
963108161 3:141664202-141664224 GGCCTTCCAGATGTGGAGGAGGG - Intergenic
963814092 3:149811183-149811205 GCTACTCCAGAGGTTGAGGTGGG + Intronic
964738747 3:159943581-159943603 GACCCTGCAGAGATGGAGTCTGG + Intergenic
966646602 3:182252508-182252530 GTCCCTGGAGAGGTGGAGGGAGG + Intergenic
966807090 3:183816195-183816217 GAGCCACCAGACGTGCAGGTGGG - Exonic
967217827 3:187225292-187225314 TGCCCTGCAGAGGTGGAGGTAGG + Intronic
967348385 3:188484608-188484630 AATCATCTAGAGGTGGAGGTGGG - Exonic
968665053 4:1816457-1816479 AAGCCAACAGAGGTGGAGGTTGG + Intronic
968829726 4:2926925-2926947 GACCCTCAAAGGCTGGAGGTAGG - Intronic
969043175 4:4317156-4317178 GACCCTGCAGTGGAGGAAGTGGG + Intronic
969515291 4:7644366-7644388 CACCCTCCAGAGGTGGAGGGTGG + Intronic
969865621 4:10075350-10075372 GTCCATCCAGAGGCGGGGGTGGG + Exonic
970176637 4:13346189-13346211 CAACCTCCAGTGTTGGAGGTGGG + Intergenic
970528233 4:16954793-16954815 GACCCCCCAGTGTTGGAGGTGGG - Intergenic
970665593 4:18333059-18333081 TACTCTCCAAAGTTGGAGGTGGG - Intergenic
971181975 4:24337233-24337255 GACCCTCCACAGGTGGAATTGGG - Intergenic
971274654 4:25184121-25184143 GATACTCCAGAGGTGGAGGTGGG + Intronic
971770473 4:30889067-30889089 GCCACTCCAGAGGCTGAGGTGGG + Intronic
971780539 4:31028541-31028563 GCTACTCCAGAGGTTGAGGTGGG + Intronic
972265107 4:37452566-37452588 GGCACTCCAGAGGCTGAGGTGGG + Intergenic
972355362 4:38275485-38275507 GAGCCTGCAGTGGTGAAGGTGGG - Intergenic
976086500 4:81412129-81412151 GCTACTCCAGAGGTTGAGGTGGG + Intergenic
977915799 4:102591306-102591328 GACTCTCAGGAGGTTGAGGTGGG + Intronic
978573424 4:110164948-110164970 GCTCCTCGAGAGGTTGAGGTGGG - Intronic
981635001 4:146867025-146867047 GAGGCAACAGAGGTGGAGGTGGG - Intronic
982973724 4:162024762-162024784 GTCCCTCTAGAGGCTGAGGTTGG - Intronic
983648900 4:170019430-170019452 GCTACTCCAGAGGTTGAGGTAGG + Intronic
984765219 4:183395189-183395211 GACCCTCCAGATTTGCATGTAGG + Intergenic
985528995 5:422813-422835 GACCCTCCCCAGGTGGTGTTTGG + Exonic
985847136 5:2358692-2358714 GCTCCTCGGGAGGTGGAGGTTGG + Intergenic
988337970 5:29930640-29930662 GAGTCTCCAGAGGTCGAGATAGG + Intergenic
988487479 5:31678716-31678738 GACACTCGAGAGGCTGAGGTGGG - Intronic
990615972 5:57508747-57508769 GGGACTCCAGAGGTGGAGCTTGG + Intergenic
990671412 5:58134529-58134551 GCTACTCCAGAGGTTGAGGTAGG - Intergenic
992398508 5:76389576-76389598 GCTACTCCAGAGGTTGAGGTAGG + Intergenic
992819583 5:80482981-80483003 GAGCCTCCAGAGGAGTAGCTGGG + Intergenic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
996397375 5:123026833-123026855 GGCCCTACAGAAGGGGAGGTGGG - Intronic
997323651 5:133001571-133001593 GCTACTCCAGAGGTTGAGGTGGG - Intronic
997909613 5:137857450-137857472 TGCCCTCCAGAGGTGGAGGACGG - Intergenic
999048825 5:148499714-148499736 TAATCTCCAGAGTTGGAGGTTGG + Intronic
999278694 5:150350069-150350091 TACCCTCCACAGGTGGAGGAGGG + Intergenic
999872219 5:155764663-155764685 CACCCTACAGATGCGGAGGTTGG - Intergenic
1000038333 5:157465984-157466006 GACCCTGCAGTGGAGGAGGGAGG + Intronic
1000536107 5:162480049-162480071 GATACTCAAGAGGTTGAGGTAGG - Intergenic
1000561264 5:162792137-162792159 TACCCTCCAGTGTTGGAGGTGGG - Intergenic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1002490776 5:179575604-179575626 GACCCCCCAGAGTTGAAGGTTGG + Intronic
1003877000 6:10446784-10446806 GCTACTCCAGAGGCGGAGGTGGG - Intergenic
1004434001 6:15572841-15572863 GCTCCTCCAGAGGCTGAGGTGGG - Intronic
1005049930 6:21675363-21675385 GACCCTGCAGGGGAGTAGGTGGG + Intergenic
1005623787 6:27644634-27644656 GACAGTCTAGAGCTGGAGGTGGG - Intergenic
1005625879 6:27661957-27661979 GCCACTCAAGAGGTTGAGGTGGG + Intergenic
1006232597 6:32596770-32596792 GACCGTGGAGAGGTAGAGGTAGG + Intergenic
1006356579 6:33562601-33562623 GCTACTCAAGAGGTGGAGGTGGG - Intergenic
1006427662 6:33976324-33976346 GGGCCTCCAGAGCTGGAGGAGGG - Intergenic
1006561008 6:34912437-34912459 GACCCTACTGAGGTTGAGGTTGG - Intronic
1006780617 6:36629959-36629981 GCTACTCCAGAGGCGGAGGTGGG + Intergenic
1007626330 6:43248251-43248273 AACACTCCAGGGGTGGGGGTCGG - Intronic
1007955110 6:45911073-45911095 GACCCTGCAGAGCTGAATGTCGG - Intronic
1011664015 6:89617761-89617783 GACCCTCCAGTGAGGGAGGTGGG - Intronic
1012602824 6:101119123-101119145 TAATCTCCAGTGGTGGAGGTGGG + Intergenic
1013312763 6:108912695-108912717 GGCCCTCATGGGGTGGAGGTGGG - Intronic
1015434913 6:133173949-133173971 GCTCCTCAAGAGGTTGAGGTGGG + Intergenic
1016032702 6:139354466-139354488 GTCCCTTGTGAGGTGGAGGTGGG - Intergenic
1016300750 6:142628715-142628737 CATTCTCCAGAGGTGGGGGTTGG - Intergenic
1017070259 6:150569892-150569914 TCCCATCCAGAGGTGGTGGTGGG - Intergenic
1017839602 6:158210490-158210512 GAACCCCGGGAGGTGGAGGTTGG - Intergenic
1018429807 6:163713785-163713807 GACCCTCCTGTGGAGGAGCTGGG - Intergenic
1022350562 7:29563762-29563784 CACCCTCCAGGGGAGGAGATTGG - Intergenic
1023243780 7:38178560-38178582 GAGCCTCCAGGGGAGGAGGAGGG + Intronic
1023810376 7:43906680-43906702 CGCGCTCCAGGGGTGGAGGTGGG + Exonic
1025826557 7:65015475-65015497 GCTCCTCCAGAGGCTGAGGTGGG + Intergenic
1025914116 7:65851921-65851943 GCTCCTCCAGAGGCTGAGGTGGG + Intergenic
1026587861 7:71671488-71671510 GACCCTCCTGAGCTGGAATTTGG + Intronic
1026609515 7:71845421-71845443 CAGCCTCTAGAAGTGGAGGTGGG - Intronic
1027399032 7:77788454-77788476 GCCACTCCAGAGGCTGAGGTGGG + Intergenic
1028003735 7:85535331-85535353 GCCACTCCAGAGGCTGAGGTGGG + Intergenic
1028158564 7:87460112-87460134 GACCTTCCAGATGCGGAGCTGGG - Intronic
1029546502 7:101212975-101212997 AGGCCTCCAGGGGTGGAGGTGGG + Intronic
1029617136 7:101666080-101666102 GACCCTCCAAAGCTGGAGCCAGG - Intergenic
1029651548 7:101896241-101896263 GACCTGCAAGAGCTGGAGGTCGG - Intronic
1031752833 7:125598824-125598846 GAGCCCCCAGAGGTGGGGGCAGG + Intergenic
1032519958 7:132536406-132536428 GTGCATGCAGAGGTGGAGGTAGG - Intronic
1034759935 7:153662131-153662153 GATACTCCAGAGGTTGAGGCAGG + Intergenic
1035147043 7:156829329-156829351 GATCCCCCAGTGTTGGAGGTGGG + Intronic
1035797501 8:2372578-2372600 GACTGTCCAGTGGTGGAGGTGGG - Intergenic
1036294177 8:7522013-7522035 GACCCTGCAGAGGAAGGGGTCGG + Intergenic
1036328385 8:7798978-7799000 GACCCTGCAGAGGAAGGGGTCGG - Intergenic
1037279364 8:17219652-17219674 GCCACTCCAGAGGCTGAGGTGGG + Intronic
1037505263 8:19523374-19523396 GCTCCTCCAGAGGCCGAGGTGGG - Intronic
1040641168 8:49335830-49335852 GACCCTTCAGAGGGTGAAGTGGG - Intergenic
1041012602 8:53559140-53559162 GAGCCACCAGAGGGAGAGGTGGG + Intergenic
1044375002 8:91460022-91460044 GACCTCCCAAAGGTGGAGATGGG + Intergenic
1044922711 8:97182673-97182695 GACCCTCAAGAGCAGGAGGTTGG - Intergenic
1045329510 8:101143074-101143096 TGACCTCCAGCGGTGGAGGTGGG - Intergenic
1046767907 8:118090306-118090328 GGCACTCCAGAGGCCGAGGTGGG + Intronic
1048161317 8:132024548-132024570 GACCCTCCACAGGAGGACCTCGG - Exonic
1048260858 8:132943949-132943971 GACCCACAAGAGGTGGAGGTGGG - Intronic
1048502299 8:134989238-134989260 GACACTCCAGAGGAAGGGGTAGG - Intergenic
1048835097 8:138511920-138511942 GAAGCTCCAGAGGTGGAAGACGG + Intergenic
1049171252 8:141162346-141162368 GCCACTCCAGAGGCTGAGGTGGG + Intronic
1050056588 9:1661605-1661627 GACCTTCCAGACTTGGAAGTTGG - Intergenic
1050382132 9:5041890-5041912 GCGCCTGCAGAGATGGAGGTGGG + Intronic
1050854187 9:10330704-10330726 TACTCTCCAAAGGTGGATGTAGG + Intronic
1052990219 9:34514621-34514643 GGTCCTGCAGAGGTGGAGGGTGG - Exonic
1053150662 9:35740764-35740786 GACCATGCTGGGGTGGAGGTGGG + Intronic
1053326985 9:37162491-37162513 GACCCTTCAGGAGTGGAGGAGGG + Intronic
1054329363 9:63736493-63736515 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1055033024 9:71789854-71789876 TACCCTCCAGAAGCTGAGGTGGG - Intronic
1055132667 9:72793640-72793662 GAGCTTCCAGAGGTGGGGGCAGG + Intronic
1056455008 9:86751625-86751647 GCACCTCCAGTGGTGGCGGTGGG - Intergenic
1057551933 9:96057433-96057455 TGCCCTCCAGGGCTGGAGGTGGG + Intergenic
1059453003 9:114382469-114382491 GCTACTCCAGAGGTCGAGGTGGG + Intronic
1060278344 9:122198998-122199020 GTCCCTGCAGTGGTGGAGGAGGG + Intronic
1060403637 9:123362228-123362250 CATCCTCCAGAGGTTGAGGTCGG + Intronic
1060983589 9:127807424-127807446 GACCTGGCAGTGGTGGAGGTGGG + Exonic
1061436495 9:130566169-130566191 GCCACTCCAGAGGCTGAGGTGGG - Intergenic
1061817794 9:133206894-133206916 GACCCTCCAGGGCAGGAGGGTGG - Intronic
1061893149 9:133633318-133633340 TGCCCTCCAGAGGTGGCGGTGGG - Intergenic
1202796150 9_KI270719v1_random:121848-121870 GACCCTGTGGAGGGGGAGGTGGG - Intergenic
1189191951 X:39117277-39117299 AACCCACAAGAGGTGTAGGTGGG + Intergenic
1189949470 X:46213912-46213934 GACCCCCCAGTGTTGGAGGTGGG - Intergenic
1190220597 X:48509933-48509955 GAGCCTCCAGAGGAGGCGGCAGG - Exonic
1190233207 X:48597971-48597993 GACACGCCAGAGGAGGAGGCCGG + Exonic
1190259615 X:48789785-48789807 GACGCAACAGAGGTGGAGGGAGG + Intronic
1190745234 X:53318629-53318651 CTGCCTCGAGAGGTGGAGGTGGG - Intronic
1190790991 X:53699919-53699941 GGCCATGCAGAGGTGGTGGTAGG - Intergenic
1191770185 X:64747165-64747187 TAACATCCAGAGTTGGAGGTGGG - Intergenic
1191843310 X:65528416-65528438 GATCCTGGAGGGGTGGAGGTGGG - Intronic
1192433774 X:71129730-71129752 GAACTTCCAGAGGAGGAGGGAGG + Exonic
1195096934 X:101511735-101511757 GTACCTACAGAGGTTGAGGTGGG - Intronic
1195248164 X:103015578-103015600 CAACCTCCAGTGTTGGAGGTGGG + Intergenic
1195626412 X:107008892-107008914 GCTACTCCAGAGGTTGAGGTGGG + Intergenic
1196037706 X:111164933-111164955 GGCTCTGCAGAGGTGGTGGTAGG + Intronic
1196063644 X:111438710-111438732 GCTCCTCCAGAGGCTGAGGTGGG - Intergenic
1197854750 X:130902920-130902942 TCCCCTGCAGAGGTGGAGCTGGG + Intronic
1199478643 X:148273763-148273785 GAGTTCCCAGAGGTGGAGGTAGG + Intergenic
1199863772 X:151824931-151824953 CTCCATCCAGAGGTAGAGGTTGG - Intergenic
1199871471 X:151902288-151902310 GACCCTGCAGGGGTGGAGAGAGG + Intergenic
1200385649 X:155887817-155887839 GATACTCCAGAGGCTGAGGTAGG + Intronic
1201575773 Y:15460050-15460072 GCTGCTCCAGAGGTTGAGGTGGG - Intergenic
1201901537 Y:19049140-19049162 GTACTTCCAGAGATGGAGGTGGG + Intergenic