ID: 1165831028

View in Genome Browser
Species Human (GRCh38)
Location 19:38730369-38730391
Sequence CAGAGGTGGAGGTGGGCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1030
Summary {0: 1, 1: 0, 2: 13, 3: 92, 4: 924}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831010_1165831028 30 Left 1165831010 19:38730316-38730338 CCTTGCTGATGCTCCTCCGGGTC 0: 1
1: 0
2: 2
3: 10
4: 143
Right 1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG 0: 1
1: 0
2: 13
3: 92
4: 924
1165831016_1165831028 14 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG 0: 1
1: 0
2: 13
3: 92
4: 924
1165831013_1165831028 17 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG 0: 1
1: 0
2: 13
3: 92
4: 924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831028 Original CRISPR CAGAGGTGGAGGTGGGCTGA TGG Exonic
900015183 1:143844-143866 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
900045451 1:502453-502475 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
900067649 1:744183-744205 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
900122002 1:1052216-1052238 CAGTGGTGGGGGTTGGCTGTGGG - Intronic
900124035 1:1061760-1061782 CAGAGGAGGAGGAAGGTTGAGGG - Intergenic
900421714 1:2558638-2558660 CAGAGGTGGACGGGGGCCGGAGG - Intronic
900498520 1:2987974-2987996 TAGAAGTGGAGGTGGGCTGGCGG - Intergenic
900610106 1:3541111-3541133 CAGAGCTGGAGGGTGGCAGAGGG - Intronic
900780556 1:4614926-4614948 GAGCGGTGGATGAGGGCTGAAGG + Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
900978948 1:6035404-6035426 CGGGGGTGGAGGTGGGCGCAGGG + Intronic
901145443 1:7061706-7061728 CAGAGGAGGGGGTGGGGTGGCGG + Intronic
901177572 1:7315843-7315865 CAGAGGAGGAGATGGCATGAAGG - Intronic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901606881 1:10466041-10466063 GAGAGGTTGAGGTGGGAGGATGG + Intronic
901660604 1:10796000-10796022 CAGAGAAGGAGGCGGGGTGAGGG - Intronic
901696510 1:11012168-11012190 CAGGTTTGGAGGTGGGCTGGCGG + Intergenic
902036472 1:13461785-13461807 GGGAGGTCGAGGTGGGCAGATGG + Intergenic
902705947 1:18204570-18204592 CAGAGGTGGAGGGGAGATGAAGG + Intronic
903185147 1:21624658-21624680 CTGAGGTGGGGGTGGGCTGTCGG + Intronic
903416593 1:23187685-23187707 CACAGGAAGAGGTGGACTGAGGG - Intergenic
903460126 1:23515076-23515098 TAGAGGTAGAGCTGGGCTGATGG - Intronic
903614199 1:24640413-24640435 CAGAGGTTGAGGTGGGAGGATGG + Intronic
903666159 1:25008941-25008963 CAGAGGAGGAGGTGGGCAACCGG - Intergenic
904066171 1:27753091-27753113 CAGAGGTTGTGGTGAGCTGGAGG + Intronic
904445679 1:30571463-30571485 CAAAAGTGGTGCTGGGCTGAAGG + Intergenic
904833863 1:33322521-33322543 CAGGGGTGGGGGTGGTTTGAGGG - Intergenic
904983821 1:34528147-34528169 CAGAGGAGGAAGTAGGCTGGAGG + Intergenic
905062587 1:35152477-35152499 GGGAGGCAGAGGTGGGCTGATGG + Intergenic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905410849 1:37766879-37766901 CAGAGGTGGAGGCAGGGGGAGGG - Intergenic
905687991 1:39922464-39922486 CAGAGGTGGGGGTCGGCAGCCGG + Intergenic
906063614 1:42964085-42964107 CAGGGGTGGAGGGGGGTAGAGGG - Intergenic
906135714 1:43499324-43499346 CAGAAAAGGAAGTGGGCTGAAGG - Intergenic
906519192 1:46457291-46457313 CAGAGGTGGTGGTAGGCAGCTGG - Intergenic
906790845 1:48657510-48657532 CAGAGGTGGAGGTAGGGTGCAGG + Intronic
907043235 1:51282127-51282149 CAGTGGTGGATTTGGCCTGACGG - Intergenic
907097004 1:51791181-51791203 CTGGGCTGGAGGTGGGGTGAGGG - Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
908191289 1:61706306-61706328 GAGAGGCTGAGGTGGGATGATGG - Intronic
908728766 1:67204646-67204668 CAGAGGTGGAGGTGGGTGACAGG + Intronic
908837389 1:68241517-68241539 CAGAGGTGGAGGGTGGGTGGAGG + Intergenic
910079785 1:83327972-83327994 AAGGGGTGGAGGAGGGCTGAAGG - Intergenic
910792962 1:91070016-91070038 GAGAGGCCGAGGTGGGCAGATGG - Intergenic
911964687 1:104351488-104351510 GAGAGGTTGAGGTGGGAGGATGG - Intergenic
912346290 1:108966179-108966201 CAGAGGTGGGGGTGGGGGGATGG - Intergenic
912566796 1:110593175-110593197 CAGAGGTGGGGGTGGGTTTGAGG + Intergenic
912681959 1:111734487-111734509 TAGAGGTGGAGGTGGAGGGAGGG - Intronic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915462060 1:156076226-156076248 CAGCGGGGGAGGTGGGCAGAGGG + Exonic
915552126 1:156641457-156641479 CTGGGGTGGGGGTGGGGTGAGGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915771157 1:158426184-158426206 CAGAGGTAGAGATGTGATGATGG + Intergenic
915897525 1:159823451-159823473 CTGAAGTGAAGGTGGGCTAATGG + Intergenic
915911079 1:159915961-159915983 CAGAGGTGGTGGTGGGTGGCAGG - Intergenic
915950468 1:160186856-160186878 CAGAGGATGAGGTGGGCTGAAGG + Exonic
915989589 1:160500534-160500556 CAAGGGTGGATGGGGGCTGATGG - Intronic
916068058 1:161152352-161152374 CAGAGGCCGGGGTGGGCAGATGG - Intergenic
916077773 1:161212470-161212492 CAGAGATGAAGGTTGGCTGCAGG + Exonic
916421910 1:164645516-164645538 CAGAGGAGAAGGGGGGCTTAGGG + Intronic
916550429 1:165844679-165844701 GAGAGGGAGAGGGGGGCTGAAGG + Intronic
916711620 1:167415702-167415724 CAGAGGTGGAGGTGGCGTGAAGG - Exonic
917720546 1:177782929-177782951 CAGATGCAGAGGTGGACTGATGG - Intergenic
917806451 1:178618155-178618177 CAGAGGTGGGTGGGGGCTGGAGG + Intergenic
918474275 1:184906136-184906158 CAGTGGTGGGGGTGGGGTGAGGG + Intronic
918963316 1:191307082-191307104 CTGAGGTGGAGCTGGGCCCAGGG - Intergenic
919207673 1:194437789-194437811 CTGGGGTGGAGGTGGGGGGAAGG - Intergenic
919328321 1:196137402-196137424 CAGAGGTGTGTGTGGGCTGGGGG + Intergenic
919398135 1:197075952-197075974 GAAAGGTGGAAGGGGGCTGAGGG + Intergenic
919860087 1:201734077-201734099 TAGAAGTGGAGGTGGGGAGAAGG + Intronic
919937637 1:202265174-202265196 CAGAGGTGGGGTGGGGGTGATGG - Intronic
920058766 1:203213377-203213399 CACAGGTGGAGATGCGCTGGAGG + Intronic
920116662 1:203626563-203626585 TAGGGGTGGAGGAGGGGTGAGGG - Exonic
920500084 1:206480268-206480290 GAGAGGGGGAGGCGGGCTGGAGG + Intronic
920563838 1:206958417-206958439 CACAGGTGGAGGAAGGATGATGG + Exonic
920615295 1:207486394-207486416 CAGAGATGGGGGTGGGATGTGGG + Intronic
920628987 1:207633139-207633161 CAGAGCTGGAGCTGGGTTCAGGG - Intronic
920767546 1:208847914-208847936 AAGAGATGGAGATGGGCAGATGG - Intergenic
921158579 1:212456844-212456866 CAGAGGTGAAGTTGGGATGAGGG + Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
922044357 1:221928902-221928924 CTGAGGTGGTGGTGGCCTGGGGG + Intergenic
922103012 1:222489577-222489599 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
922182359 1:223245447-223245469 CACATGTGAAGGTGGGCTGGAGG + Intronic
922263333 1:223962065-223962087 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
922541574 1:226424155-226424177 CAGAGGTTGAGGTGGGAGGATGG + Intergenic
922641243 1:227234071-227234093 CAGTGGTGGAGGTGGGTTCCAGG + Intronic
922742335 1:228020981-228021003 CACTGGTGGAGGTGGGTGGAGGG - Intronic
923316676 1:232787013-232787035 CGGAGGTGGAAGTGGGTTGAGGG + Intergenic
923472390 1:234303573-234303595 CAAAGGTGGAGGTAGATTGAAGG - Intronic
923782908 1:237042132-237042154 CAGCGGTGGGGGTGGGGTGTGGG - Intergenic
924345173 1:243067079-243067101 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
924626079 1:245697629-245697651 TAGAGGTGGAGGTGGGTGGTGGG + Intronic
1062830779 10:604034-604056 CAGAGGGGGTGTGGGGCTGAGGG - Intronic
1063443146 10:6089393-6089415 CAGAGGCGGCGGCGGGCGGAGGG - Exonic
1063447741 10:6130208-6130230 CTGAGGTGGAGGTGGGAGCAGGG + Intergenic
1063572897 10:7232883-7232905 CAAAGCTGGAGGAAGGCTGAGGG - Intronic
1063662527 10:8044073-8044095 CAGAGGTGGAGGTGGTTTGAGGG - Intergenic
1063690840 10:8285422-8285444 CGGGGGTGGTGGTGGGCTGGGGG + Intergenic
1063881809 10:10539445-10539467 CAGAGGTGGGGGTGGGGTGGCGG - Intergenic
1064014819 10:11763579-11763601 CAGAGGGGAAGGTGGGCTCCTGG - Exonic
1064200656 10:13282144-13282166 GAGAGGTTGAGGTGGGAGGATGG + Intronic
1065102588 10:22345576-22345598 CAGAGCTCGAGGAGGGCAGACGG + Exonic
1065371085 10:24987178-24987200 GAGAGCTGGAGCTGGGCTGAGGG - Intronic
1065675002 10:28164802-28164824 CAGAAGTGGGGCAGGGCTGAGGG + Intronic
1065813116 10:29460667-29460689 GAGAGGCTGAGGTGGGCAGATGG + Intronic
1066426466 10:35311879-35311901 GAGAGGTTGAGGTGGGACGATGG + Intronic
1066731163 10:38437730-38437752 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1067027970 10:42860209-42860231 CAGAGGCGGTGGTGGCCTGGTGG + Intergenic
1067084518 10:43230734-43230756 TGGGGGTGGAGGTGGGGTGAGGG - Intronic
1067155557 10:43778793-43778815 CAGAGTAGGAAGTGGGCTGTGGG - Intergenic
1067570187 10:47365914-47365936 CACAGGTGGCAGTGGGCAGAGGG - Exonic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067665061 10:48270693-48270715 AAGAGGAGGAGGTGGGGGGAAGG - Intronic
1067715202 10:48685277-48685299 CAGAGGTCGAGGAGTGCTGCTGG - Intronic
1067762367 10:49057775-49057797 CTCAGGTGGATGTGGGCAGAGGG + Intronic
1068434975 10:56978713-56978735 GAGAGCTGGAGATGGACTGATGG + Intergenic
1068818087 10:61341108-61341130 CAGAGATGGTGGTGGGGTGGAGG + Intergenic
1068866583 10:61901785-61901807 CAGAGGTGTGGGTGAGCTGGGGG - Intronic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069707401 10:70467399-70467421 CAGTGGTGGAGGTGGGGGGTGGG + Intergenic
1069828146 10:71266659-71266681 CAGGGGTGGAGGTGAGGTGTGGG + Intronic
1069857513 10:71449659-71449681 CAGAGGTAGAGTTGGGCTACAGG + Intronic
1069870921 10:71532438-71532460 CAGGGGTGGAGGGGAGCTGGTGG + Intronic
1070577838 10:77693202-77693224 CAGAAGCTGAGATGGGCTGAGGG - Intergenic
1070656353 10:78274348-78274370 CAGAGCTCCAGGTGGGCTTAGGG - Intergenic
1070676650 10:78416358-78416380 CAGAGGTGGAGGTCAGAGGAGGG - Intergenic
1070930367 10:80256702-80256724 AGGAGGTGGAGGGGGGCAGATGG + Intergenic
1071507475 10:86241356-86241378 CAGAAGTGGAGGGGTCCTGATGG - Intronic
1072249815 10:93572628-93572650 GGGAGGAGGAGGTGGGCAGAAGG + Intronic
1072449702 10:95530213-95530235 CTGAGCTGGAGCTGGGATGAAGG - Intronic
1072530386 10:96313246-96313268 CTGAGGTTGAGGTTGGCTGCCGG + Intronic
1072676773 10:97472712-97472734 GGGAGGTGGAGGTGGGAGGATGG - Intronic
1073001808 10:100291284-100291306 GAGAGGGTGAGCTGGGCTGATGG - Exonic
1073119433 10:101112554-101112576 CTGAGGTGGAGGTGGGCAGGAGG + Intronic
1073183452 10:101600895-101600917 CTGAGGTGGGGGTGGGCTGTGGG + Intronic
1073316175 10:102582494-102582516 GGGAGGTGGGGGTGGGGTGATGG + Intronic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1073682501 10:105719428-105719450 CACAGATGGAGGTGGGCATAGGG + Intergenic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074445867 10:113520516-113520538 CTGGGCTGGAGGCGGGCTGAGGG - Intergenic
1074698805 10:116075113-116075135 CACAGGTGCAGGTGGCCTAATGG + Intronic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074769719 10:116725345-116725367 CAGAGGTGGAGCTGGGTCCATGG - Intronic
1075078920 10:119369885-119369907 CAGGGGTGGGGGTGGACTGAGGG - Intronic
1075083682 10:119400232-119400254 CAGTGGTGGAGCTGTGCTCAGGG + Intronic
1075288176 10:121205017-121205039 CAGAGGTGGAGGTGGCAGGCAGG - Intergenic
1075533897 10:123254530-123254552 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533940 10:123254790-123254812 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075671567 10:124266940-124266962 CTGAGGCAGAGGTGGGCTCAGGG - Intergenic
1076028767 10:127140447-127140469 CAGATGGGGAGATGGGCTGGGGG - Intronic
1076297758 10:129400493-129400515 CAGAGGTAGAGGTGAGGTGGGGG - Intergenic
1076769018 10:132652985-132653007 CCGATGTGCAGGTGGGCGGAGGG + Intronic
1076930794 10:133530453-133530475 CAGGGGTGCAGCTGGACTGAGGG - Intronic
1076971777 11:138944-138966 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
1077117036 11:889877-889899 CAGAGGGGGAGGGGAGCTGTGGG - Intronic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077393168 11:2309079-2309101 CTCAGGAGGGGGTGGGCTGAGGG - Intronic
1077736590 11:4798187-4798209 CAGGGGTGGGGATGGGGTGAAGG + Intronic
1077751455 11:4974952-4974974 CAGGGGTTGAGGTGGGGGGAGGG + Intronic
1077997802 11:7468955-7468977 CAGAGTTGCAAATGGGCTGAGGG - Exonic
1078076375 11:8165517-8165539 TAGGGCTGGAGGTGGGCTGGGGG + Intronic
1078109854 11:8383487-8383509 CTGAGGAAGAGTTGGGCTGAAGG + Intergenic
1078847130 11:15128531-15128553 CAGAGCTGGGGCTAGGCTGAAGG + Intronic
1079344156 11:19637371-19637393 CAGAGGTAAATGGGGGCTGAAGG - Intronic
1079390924 11:20021678-20021700 CAGAGGTGGGGGTGGGCAGTGGG - Intronic
1079451612 11:20603800-20603822 CTGAGGAGGAGGTGTGGTGAAGG + Intronic
1080803554 11:35631471-35631493 CAGTGTTGGAGGTGGCCTGGGGG + Intergenic
1080804132 11:35636331-35636353 GAGAGGAGGGGGTGGGCTGGGGG + Intergenic
1081011103 11:37812860-37812882 CAGCGGGGGAGGTGCGATGAGGG - Intergenic
1081338809 11:41902465-41902487 GAGAGGTGGTGGTTGGCAGATGG + Intergenic
1081662493 11:44896618-44896640 CAGAGGTAGAGATGGGAAGATGG - Intronic
1082770092 11:57201187-57201209 CAGAGATGAGGGTGGGCAGAAGG - Intergenic
1083026227 11:59553442-59553464 CGGAGGTTGCGGTGAGCTGAAGG - Intergenic
1083172960 11:60933866-60933888 CCAGGGTGGAGGTGGGCAGAAGG - Intronic
1083324310 11:61865717-61865739 AAGGGGTGCAGGTGGGGTGATGG + Exonic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1083619567 11:64042270-64042292 CAGAGGTGGGGGTGAGATGTGGG - Intronic
1083752480 11:64768103-64768125 CACCGGTGGAGGTGGGTTGTTGG + Exonic
1083887255 11:65578952-65578974 AGGAGGGGGAGGTGGGCAGAAGG + Intronic
1083937751 11:65879242-65879264 CACAGGTGCAGCTGGGCTGAAGG + Intergenic
1084720036 11:70899626-70899648 CTGAGTTGGAGGTGGGCTATAGG - Intronic
1084941045 11:72613509-72613531 CAGAGGTGGACGTCGGCCGGGGG - Intronic
1086366884 11:86116175-86116197 CAGAGGTAGAGGTGAGCCGTGGG - Intergenic
1086883860 11:92180783-92180805 CAGCTGTGGCGGTGGGGTGAAGG + Intergenic
1087038184 11:93774200-93774222 CTGAGGTGGAGCTGGGCTCCAGG - Intronic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088922600 11:114272064-114272086 TAGAGGTGGAGCTGGGCTTGCGG + Intronic
1089180471 11:116579996-116580018 CCGAGGTGGAGGGGCGCTGCGGG - Intergenic
1089517693 11:119044304-119044326 AAGAGGTGGGGGTGGGGTGAGGG + Exonic
1089627306 11:119759589-119759611 CAGGGTTGGAGGAGGGTTGAGGG + Intergenic
1090177880 11:124667650-124667672 CAGAGGTGGAGGTGGAGTTCAGG - Intronic
1090320441 11:125838580-125838602 TAGTGGTGGAGGTGGGGTGTGGG - Exonic
1090626278 11:128611574-128611596 CAGTGCTGGAGGTCGGCCGAGGG + Intergenic
1090858310 11:130630972-130630994 GGGAGGTGAGGGTGGGCTGATGG + Intergenic
1090903159 11:131050299-131050321 ATGAGGTGGAGGTGGGGTGACGG - Intergenic
1090993378 11:131840899-131840921 CAGAGGTGGAGGATGACAGAAGG + Intronic
1091232262 11:133996378-133996400 CAGAGGTGAAGGCTGGGTGAAGG + Intergenic
1091353090 11:134913371-134913393 CAGAGAAGGAGGAGAGCTGAGGG + Intergenic
1091401032 12:180823-180845 CAGAGGAGGAGGTGGACAGCAGG - Intergenic
1091650830 12:2308001-2308023 CATGGGTGGAGGTGGGAAGAGGG - Intronic
1091871049 12:3891608-3891630 CGGAGGCTGAGGTGGGTTGAGGG - Intergenic
1092179225 12:6433935-6433957 GAGAGATGGAGGCGGGCAGATGG - Intergenic
1092255547 12:6925067-6925089 CAGAGAGGGAGCTGGGGTGAGGG + Intronic
1093442126 12:19211393-19211415 TAGAAGGGGAGGTGGGCAGAGGG + Intronic
1094403921 12:30094350-30094372 GAGATGTGGAGGTGGGCAAATGG - Intergenic
1095246807 12:39932871-39932893 TAAAGGTGGGGGTGGGATGATGG + Intronic
1095329347 12:40939011-40939033 CAGAGGCTGAGGTGGGCAGATGG - Intronic
1095424438 12:42060456-42060478 GAGTGGTGGGGGTGGGATGAAGG - Intergenic
1095825838 12:46530487-46530509 CTGAGGTGGAGGTGGGCCCGGGG + Intergenic
1095956291 12:47808321-47808343 CAGAAGTGGAGGTGGGGTGGGGG - Intronic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1097046107 12:56189063-56189085 CTGAGGGGAAGGTGGGCTAATGG + Intronic
1097093462 12:56526065-56526087 GGGAGGTGGAAGTGGGCAGATGG + Intronic
1097186960 12:57201162-57201184 CAGAGGTGGTGGTGGGCCGGTGG + Intronic
1097222708 12:57460238-57460260 CAGTGGGGGAGGGGGCCTGAGGG + Intronic
1097226168 12:57477915-57477937 CTGAGGTGGGGGTGGGGTGGGGG - Intronic
1097563750 12:61240515-61240537 CAGGGATGGAGGTGGGCAGGGGG + Intergenic
1097882381 12:64698126-64698148 CCGAGGTGCAGGTGCGCAGAGGG - Intergenic
1097922826 12:65095035-65095057 CAGAGGTTGAGGTGAGAGGATGG - Intronic
1097973320 12:65658445-65658467 TAGTGGTGGAGGTGGGAAGAAGG - Intergenic
1098228372 12:68348058-68348080 GGGAGGTTGAGGTGGGCAGATGG - Intergenic
1098411451 12:70188675-70188697 AGGAAGTGGAGGTGAGCTGAAGG - Intergenic
1098901813 12:76118782-76118804 CAAAGGTGGATGGGGGCTGTTGG + Intergenic
1099089425 12:78286340-78286362 CCGAGCTGCAGGTGGGCGGAGGG - Intergenic
1100000861 12:89833443-89833465 CAGATGAGGAGTTGGGCTAAGGG + Intergenic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1101421868 12:104557217-104557239 CAGGGGCGGAGTTGGGCTGAAGG + Intronic
1101545285 12:105706655-105706677 CAGATGGGGAGGAGGGATGAGGG - Intergenic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102139037 12:110599314-110599336 GAGAGGCTGAGGTGGGCAGATGG + Intergenic
1102647749 12:114414692-114414714 CACAGGTGGAGGAGGGTGGAGGG - Intergenic
1102975076 12:117200965-117200987 CAGAGGATGAGGTGGGATAACGG + Intergenic
1103349129 12:120271138-120271160 GGGAGGTAGAGGTGGGCAGATGG - Intergenic
1103611004 12:122124229-122124251 CTGAGGTGGGGGACGGCTGAGGG - Intronic
1103611019 12:122124263-122124285 CTGAGGTGGGGGACGGCTGAGGG - Intronic
1103611073 12:122124398-122124420 CTGAGGTGGGGGACGGCTGAGGG - Intronic
1104036247 12:125098958-125098980 CACAGGTGCAGGTGGGCTGGGGG + Intronic
1104151392 12:126087288-126087310 CAGTGTTGGAGGTGGCCTGGTGG - Intergenic
1104617811 12:130285014-130285036 CTGAGGTGGAGGTGGGGGGATGG + Intergenic
1104642173 12:130474497-130474519 AACAGGTGGAGGTGGGCAGTCGG + Intronic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104745909 12:131210425-131210447 CAGAGGGGAATGTGGGCAGAGGG + Intergenic
1105578909 13:21675569-21675591 CGGAGGAGGAGGAGGGCCGAAGG - Intronic
1105606628 13:21931496-21931518 CAGCACTGGAAGTGGGCTGATGG - Intergenic
1106012303 13:25836591-25836613 CAGAAGTGGAGGAGGGCAGTGGG - Intronic
1106396051 13:29382041-29382063 CAGAGCTGGAGGTGTGTTGGAGG + Intronic
1106402742 13:29445362-29445384 CTGAGGTGGAGGTGGTCTTGTGG - Intronic
1106688728 13:32090385-32090407 CAGAGGTGGATGTGTGGTCAAGG + Intronic
1106765845 13:32913426-32913448 CAGAGGTGGATGAGGACTGAAGG - Intergenic
1107048965 13:36027176-36027198 CAGAAATGGGGGTGGGGTGATGG + Intronic
1107074306 13:36305301-36305323 AAGAGGTGGAGGTGGGCATGTGG - Intronic
1107807144 13:44164138-44164160 CAGAGAGGAAGGTGGGCCGATGG - Intergenic
1107949670 13:45450818-45450840 CAGAGGTTGCAGTGAGCTGATGG - Intergenic
1107955471 13:45506991-45507013 CAGACGTGCAGGAGGGCTGTGGG + Intronic
1108446278 13:50511989-50512011 CATAGGTGGAGGGTGGCCGAAGG + Intronic
1110565415 13:76952891-76952913 CAGAGGCCAAGGTGGGCAGACGG + Intronic
1110643778 13:77856842-77856864 CAGGGGTGGTGGTGGGGTGGGGG + Intergenic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1112566205 13:100553012-100553034 CAGAGGGGACGGTGGGCTGTTGG + Intronic
1113632531 13:111897873-111897895 AAGACGTGGAGGAGGGCTGTGGG + Intergenic
1113634818 13:111912355-111912377 GAGAGGTTGAGGTGGGAGGATGG - Intergenic
1114495204 14:23127276-23127298 CCGAGGTGGAGCGGGGCTCAGGG - Exonic
1114539308 14:23443056-23443078 CAGAGGCTGAGGTGGGCTGACGG - Intergenic
1114635452 14:24184447-24184469 AGGAGGTGGAGGTGGGCTACGGG + Intronic
1114657398 14:24324290-24324312 CTGATGGTGAGGTGGGCTGAGGG - Exonic
1115123771 14:29969520-29969542 TAGAGGTGGAGATTGGTTGAGGG + Intronic
1115515013 14:34176405-34176427 CAGAGGTTGGGGTGGGGTGGGGG - Intronic
1116052106 14:39816743-39816765 CAGAGGTTGAAGTGGGAGGAAGG - Intergenic
1116933748 14:50716280-50716302 CAGAGGTGGATGTGGGCAGATGG - Intergenic
1117065440 14:52009213-52009235 CTAAGGTGGAGGTGGCCAGAGGG + Exonic
1118636183 14:67750724-67750746 CAAAGATGGAGGTGAGGTGAGGG + Intronic
1118764771 14:68902392-68902414 GAGAGGTGGAGGCGGGCAGGAGG + Intronic
1118879801 14:69816376-69816398 CAGAGATGAAGGTGGCTTGAGGG + Intergenic
1118989073 14:70781734-70781756 CAGAGGAGGAAATGGGCTCAGGG + Intronic
1119136343 14:72224311-72224333 AAGAGGTTGAGGTGGGAGGATGG + Intronic
1119233445 14:72999480-72999502 CAGAGGCTGAGGTGGGAAGATGG + Intronic
1119441587 14:74632002-74632024 CAGAGGTGGGGTGGGGGTGAGGG - Intergenic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119608827 14:76044576-76044598 CAGGAGAGGAGATGGGCTGAAGG - Intronic
1119727547 14:76930966-76930988 TGGAGGCGGAGGTGGGGTGATGG - Intergenic
1119842059 14:77800487-77800509 CAGAGCTGGAGGAGGGCCGGAGG + Intronic
1119947758 14:78712964-78712986 CAGAGGTGAAGGCTGACTGATGG + Intronic
1120806274 14:88754380-88754402 CAAAGGTGGAGGTGGGTAGGTGG - Intronic
1121169581 14:91842222-91842244 GAGAGGCCGAGGTGGGCAGATGG - Intronic
1121191215 14:92032037-92032059 GGGAGGTGGAGGTGGGAGGATGG - Intronic
1121386354 14:93530329-93530351 GGGAAGTGGAGGCGGGCTGATGG + Intronic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1121894796 14:97636934-97636956 GAGAGATGGAGGTGGACGGAGGG - Intergenic
1121989265 14:98539539-98539561 CAGAGGCGGAGCTGTTCTGATGG + Intergenic
1122142976 14:99673679-99673701 CAGAGGGGGTGGTGCACTGAGGG + Intronic
1122209353 14:100165138-100165160 CAGAGGAGGTAGTGGGCTGTGGG - Intergenic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122577041 14:102749276-102749298 CAGAGGATGAGCTGGGCAGAGGG - Intergenic
1122619386 14:103046159-103046181 CTGAGGTGGAGGAGGGCTGGTGG - Intronic
1122692318 14:103537225-103537247 CAGAGGTAGAGCTGGGCCCATGG + Intergenic
1122738475 14:103857109-103857131 CAGATGTGGAGGTGCCCTGTGGG - Intergenic
1122956443 14:105073689-105073711 CAGAGGTGGAGAGAGGCTGGGGG - Intergenic
1123123390 14:105928443-105928465 CAGGGGTGGGGTGGGGCTGAGGG + Intronic
1123406035 15:20019947-20019969 CAGGGGTGGGGTGGGGCTGAGGG + Intergenic
1123427627 15:20185041-20185063 CAGAGGCGGTGGTGGCCTGGTGG + Intergenic
1123536864 15:21191591-21191613 CAGAGGCGGTGGTGGCCTGGTGG + Intergenic
1123578366 15:21695041-21695063 CCGAGCAGGAGCTGGGCTGAGGG + Intergenic
1123614991 15:22137523-22137545 CCGAGCAGGAGCTGGGCTGAGGG + Intergenic
1123662224 15:22574428-22574450 CAGAGGGGCAGATGGGCTCAGGG + Intergenic
1123787062 15:23684677-23684699 CAGAGGATGGGGTGGGCTGCGGG - Intergenic
1124165267 15:27320402-27320424 CAGAGGTGTGGGTGGCATGAAGG + Intronic
1124261994 15:28201079-28201101 CAGAGGGGCAGATGGGCTCAGGG - Intronic
1124316026 15:28668710-28668732 CAGAGGGGCAGATGGGCTCAGGG + Intergenic
1124581333 15:30957902-30957924 CAGAGGTGGAGCTGGGTTTGTGG + Intronic
1124816637 15:33000539-33000561 GAGAGGCTGAGGTGGGCAGATGG + Intronic
1126596963 15:50392763-50392785 CAGAGGTTGTAGTGGGCTGAAGG - Intergenic
1126666279 15:51078467-51078489 CAGAGGAGGAGGAGGCCTGGAGG - Intronic
1126887273 15:53164427-53164449 CTCAGATGGAGTTGGGCTGAGGG - Intergenic
1128304274 15:66587887-66587909 AAGAGGTGGAGCTGCGCTGCCGG - Intronic
1128582799 15:68820734-68820756 GAGAGATGGAGATGGGCAGACGG - Exonic
1128695667 15:69760589-69760611 GAGAGGTGGAGATGGGGAGAGGG + Intergenic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129161083 15:73748304-73748326 CAGAGGAGGAAGATGGCTGAGGG + Intronic
1129465374 15:75721729-75721751 CAGAGGTGGGGGTGGGTGGCAGG + Intergenic
1129606851 15:77029180-77029202 CAGAGAGGGAAGTGGCCTGAGGG + Intronic
1129706666 15:77798371-77798393 CTCAGGTGGAGCTGGGCTCAGGG - Intronic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1130342864 15:83013826-83013848 CAAAGGTGGAGAGGGGTTGAGGG + Intergenic
1131103672 15:89714750-89714772 GATAGGTGGTGGTGGGTTGAGGG + Intronic
1131615863 15:94016823-94016845 CCGAGGTGGAGGAGGGTGGAAGG + Intergenic
1131740071 15:95379655-95379677 CAGAGGTGGAGGTTGGGAGGAGG + Intergenic
1132358281 15:101189896-101189918 AAGTGGTGGAGCTGGGCTGCGGG - Intronic
1132418447 15:101642669-101642691 CTGGGGTGGAGGTGGTCTCATGG - Intronic
1202987236 15_KI270727v1_random:429286-429308 CCGAGCAGGAGCTGGGCTGAGGG + Intergenic
1132525450 16:411960-411982 CAGAGGAGGGGCTGGGCTGCAGG - Exonic
1132703526 16:1231656-1231678 AAGCGGAGGAGGTGGGCTGGAGG - Intergenic
1132704985 16:1239705-1239727 AAGCGGAGGAGGTGGGCTGGAGG + Intergenic
1132790927 16:1687224-1687246 GAGAGGCCGAGGTGGGCAGATGG - Intronic
1132804137 16:1767957-1767979 CAGAGGTGTACGTGGGTTCACGG + Intronic
1132871419 16:2117301-2117323 CAGAGGTGGACATGAGCTGGGGG - Intronic
1132887740 16:2189901-2189923 CAGGGGTGGGGCTGGGGTGAGGG - Intronic
1133119320 16:3596495-3596517 CAGAGCAGGATGTGGGCTGTGGG + Intronic
1133299320 16:4772603-4772625 CAGAGGCTGAGGCGGGCAGATGG + Intergenic
1133664390 16:7951907-7951929 CAGAGGTGAAGGTGAGCATAAGG + Intergenic
1133834900 16:9359119-9359141 GAGAGGCTGAGGTGGGCAGAGGG - Intergenic
1134075138 16:11285528-11285550 CAGACGTGGGGGTCGGCAGAGGG - Intronic
1134203980 16:12222249-12222271 CAGGGGTGAGGGTGGGTTGAGGG + Intronic
1134333555 16:13272465-13272487 CTGAGGTCGAGGTGGGAGGATGG - Intergenic
1134464799 16:14465734-14465756 CAAAGTTGGAGGAAGGCTGAGGG + Intronic
1134521109 16:14919593-14919615 CAGAGGTGGACGCGAGCTGGGGG + Intronic
1134550462 16:15136379-15136401 CAGAGGTGGACGCGAGCTGGGGG - Intronic
1134689234 16:16180184-16180206 CACAGCAGGAGGTGGGCAGAGGG - Intronic
1134708785 16:16318244-16318266 CAGAGGTGGACGCGAGCTGGGGG + Intergenic
1134755958 16:16667575-16667597 GGGAGGTGGAGGTGGGAGGATGG + Intergenic
1134950820 16:18350401-18350423 CAGAGGTGGACGCGAGCTGGGGG - Intergenic
1134990110 16:18691589-18691611 GGGAGGTGGAGGTGGGAGGATGG - Intergenic
1135808968 16:25570056-25570078 CAGAGCTGGAGGTGGGCCAAGGG + Intergenic
1135998722 16:27273407-27273429 GAGAGGTTGAGGTGGGAGGATGG + Intronic
1136180482 16:28548512-28548534 CAAAGGTGGAGTTCTGCTGAAGG + Intergenic
1136397851 16:30002812-30002834 GAGAGATGGGGATGGGCTGAGGG + Intronic
1137781903 16:51104268-51104290 CTGTGGTGGGGGTGGCCTGAAGG + Intergenic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138350872 16:56345601-56345623 CAGAGGTGGACTTGGGCTGATGG - Exonic
1138438518 16:57020477-57020499 CTGAGGGGGAGGTGAGCTGGGGG - Intronic
1139349193 16:66324811-66324833 AAGAGGTGGAGGTGGGAGCAGGG + Intergenic
1139481594 16:67233891-67233913 TAGAGGTGGAGGTGGTGGGAAGG + Exonic
1140199975 16:72887181-72887203 GAGAGGAGCAGGTGGGCAGAGGG + Intronic
1140348995 16:74243595-74243617 GACAAGTGCAGGTGGGCTGAGGG + Intergenic
1141017354 16:80463109-80463131 CAGAGCAGGAGGCGGGCTGGTGG + Intergenic
1141107580 16:81246191-81246213 CAGAGGAGGAGGTGTGAGGATGG - Intronic
1141362160 16:83405965-83405987 CCGAGATCCAGGTGGGCTGAGGG - Intronic
1141610174 16:85176818-85176840 CAGATGTGCACGTGGCCTGATGG - Intronic
1141818896 16:86431708-86431730 CAGCCTTGGAGGTGGGCTGACGG + Intergenic
1141829461 16:86501692-86501714 CAGGGGTGGGGGTGGGGGGATGG - Intergenic
1142203831 16:88773393-88773415 CAGAGGTGGCTGGGGGCCGAGGG + Intronic
1142210991 16:88808398-88808420 CAGAGGCAGATGTGGGCTGCAGG + Exonic
1142237947 16:88931509-88931531 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142237961 16:88931550-88931572 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142237975 16:88931591-88931613 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142237989 16:88931632-88931654 CAGAGGTGGAGAAGGGCCGTGGG + Intronic
1142315683 16:89343519-89343541 CAGAGCTCGAGGTGGGCTGGAGG + Intronic
1142448470 16:90158578-90158600 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1142459015 17:76711-76733 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
1142671860 17:1491302-1491324 CAGAGGCGGAGCAGGGCTGCGGG + Intronic
1142806745 17:2375424-2375446 CCGAGGAGGCGGTGGGCTGCGGG + Intronic
1143282644 17:5766306-5766328 CTGAGCTGCAGGTGGGATGAAGG - Intergenic
1143479334 17:7219643-7219665 GAGGGATGGAGGTGGACTGAAGG - Exonic
1143565044 17:7716097-7716119 CAGAGGTGGAGGTAGGGGGAAGG - Intergenic
1143872846 17:9969920-9969942 CAGAGCTGGAAATGGGTTGAAGG + Intronic
1144095906 17:11900528-11900550 CAGAGATGGAGGTAGAGTGAAGG - Intronic
1144130227 17:12239541-12239563 CAGAGGTGCCGGTGGGGTCAGGG + Intergenic
1144194118 17:12874361-12874383 CAGAGGTGGAGATGAGCTTTAGG + Intronic
1144452218 17:15390592-15390614 CAGAGGTGCAGCTGGATTGATGG + Intergenic
1144641728 17:16940788-16940810 CAGCGCTGGAGATGGGCTGATGG + Intronic
1144932919 17:18874673-18874695 CAGAGCTGGAGGTGGGGGCACGG + Intronic
1144994871 17:19260507-19260529 CACAGGTGGACCTGGGCTGGTGG + Intronic
1145828892 17:27898877-27898899 TGGAGGTTGAGGTGGGCAGAGGG + Intergenic
1145932823 17:28698157-28698179 CAGAGGTGGAGGTTGGAGGTGGG + Intronic
1145990703 17:29077769-29077791 CAAGGGTGATGGTGGGCTGAGGG + Exonic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146663438 17:34680782-34680804 CAGAGGTGTGGGTGGTCTTATGG + Intergenic
1146667639 17:34715606-34715628 TGGAGGTGGAGGAGGGCAGAGGG - Intergenic
1146721264 17:35125332-35125354 AGGAGGTGGAGGTGGACGGATGG + Intronic
1147214715 17:38892485-38892507 CAGAGGTGGAGGGGCTCAGAAGG + Intronic
1148351918 17:46947282-46947304 GAGAGGTCGTGGTGGGCTGTGGG + Intronic
1148491808 17:48028220-48028242 CAGGAGATGAGGTGGGCTGATGG + Intronic
1148684643 17:49494835-49494857 ATGGGGTGGAGGTGGGGTGATGG + Intergenic
1148736579 17:49868533-49868555 CAGGGGTGGAGGAGGACTGGGGG + Intergenic
1148748623 17:49932027-49932049 GAGAAGTGGAGGAGGGCAGACGG + Intergenic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148861378 17:50606038-50606060 CAGAGGTGGGGCTGTGGTGAAGG + Intronic
1149451179 17:56751264-56751286 CAGAGGTAGAGCTGGCCTGGAGG - Intergenic
1149506088 17:57195146-57195168 GGGAGGTGGAGGTGGGAGGATGG - Intergenic
1151346755 17:73507154-73507176 CAGAGGTGGTGTTGGGCACAGGG - Intronic
1151356242 17:73560277-73560299 CAGGGCTGGAGCTGGGCTGGAGG + Intronic
1151385614 17:73753537-73753559 CAGAGGGGGAGGAAGGCTGGGGG + Intergenic
1151394390 17:73812412-73812434 CAGAGGTAGAGTTTGGCAGAGGG + Intergenic
1151496644 17:74462030-74462052 TAGAGGTGGTGGTGGGAAGAGGG - Intergenic
1151557490 17:74854035-74854057 CAGAGAAGCAGGTGGGATGAAGG - Intronic
1151767355 17:76139294-76139316 CAGAGGTTGAGGTGGGGGGCTGG + Intronic
1151790438 17:76302298-76302320 CAGAGGTGGGGGTGGGGTGGGGG - Intronic
1151873631 17:76853513-76853535 GGGAGGTGGAGGTGGGAGGATGG - Intergenic
1152005338 17:77676899-77676921 CAGAGGAGGACGTGAACTGATGG - Intergenic
1152100774 17:78300733-78300755 CTGAGGAGGAGGTGGCCTTAGGG - Intergenic
1152110571 17:78355573-78355595 GGGAGGTCGAGGTGGGCTAAGGG - Intergenic
1152217162 17:79040358-79040380 GAGAGGTTGAGGTGGGCAGATGG + Intronic
1152379063 17:79933073-79933095 CACAGGTGGCGGAGGGGTGAAGG + Exonic
1152408255 17:80109442-80109464 CAGAGGAGGAGGTGGGAGGCAGG + Intergenic
1152574388 17:81133690-81133712 TACAGCTGGAGGTGGGCTGGGGG + Intronic
1153200575 18:2643444-2643466 CAGTGGTGGAGCTGAGCAGAAGG - Intergenic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153316888 18:3731646-3731668 GGGAGGTGGAGGTGGGAGGATGG - Intronic
1153414547 18:4832210-4832232 CAGAGGTGTAGGCAGGATGAAGG - Intergenic
1153627775 18:7038273-7038295 GAGAGGTGGAGATGGTGTGATGG - Intronic
1153825832 18:8874034-8874056 CAGAGGTGGAGGTGGGGGATTGG - Intergenic
1153912503 18:9716526-9716548 AAGAGGTGGGAGTGGGCTGGCGG + Intronic
1154357571 18:13633498-13633520 CTGAGGCAGGGGTGGGCTGAGGG - Intronic
1154957168 18:21270267-21270289 CACAGGCAGAGATGGGCTGATGG + Intronic
1155096218 18:22559208-22559230 CGGCGGTGGAGGAGGGCTGGTGG + Intergenic
1155311580 18:24529549-24529571 GAGAGGTAGAAGTGGGCTCAAGG - Intergenic
1155556150 18:27021243-27021265 CAGGGCTGGAGGTTAGCTGATGG + Intronic
1156495670 18:37523845-37523867 CAGAGGTGAAGGTGGGAGGAGGG + Intronic
1156596638 18:38554976-38554998 CAGAGGTAGAGGTGGGAGAATGG + Intergenic
1156783461 18:40880732-40880754 CAGAGAAGGAGGTGGGGGGAGGG - Intergenic
1157166051 18:45359370-45359392 CAGAGGAGGAGGAGGGGTGCTGG - Intronic
1157326319 18:46671433-46671455 CAGATGTGGAGGTGGGCAGAGGG + Intronic
1157464277 18:47930733-47930755 CGGAAGCGGAGGTGGGCTGGCGG - Intronic
1157712626 18:49860265-49860287 CCGAGGTGAGGTTGGGCTGAGGG + Intronic
1158020151 18:52832215-52832237 CAGATGTGGAGGTTGGATGTGGG + Intronic
1158113250 18:53965178-53965200 CAGAGGTGGCTGTTGGCTGCAGG - Intergenic
1159139110 18:64370995-64371017 GGGAGGCTGAGGTGGGCTGATGG - Intergenic
1159334310 18:67043774-67043796 GAGAGGCCAAGGTGGGCTGAGGG + Intergenic
1159556225 18:69947891-69947913 CAGAGGCTGAAGTGGGCGGAGGG + Intronic
1159686983 18:71434769-71434791 TAGTGGTGGAGGTGGGTGGAGGG + Intergenic
1159858000 18:73612794-73612816 CAGAGGTGTGGGTGGGGTTAAGG + Intergenic
1160032463 18:75274333-75274355 ATGAGGTGGAGGTGGGGTGATGG + Intronic
1160049132 18:75415354-75415376 CAGAGCAGGAGTGGGGCTGAAGG + Intronic
1160297981 18:77655147-77655169 CAGCGAAGGATGTGGGCTGAAGG + Intergenic
1160324891 18:77936971-77936993 CAGAGCTGGAGGTGGGGTGAGGG + Intergenic
1160522410 18:79515441-79515463 CAGTGGTGGTGGTGGGCGGGTGG + Intronic
1160648734 19:209224-209246 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
1160872022 19:1282044-1282066 CAGACCTGAAGGTGGGATGAGGG + Intergenic
1161072934 19:2271293-2271315 CAGGGGTGGGGATGTGCTGAAGG + Intronic
1161497401 19:4594568-4594590 CAGAGGCCGAGGTGGGTTGGGGG + Intergenic
1162128536 19:8511956-8511978 CACACCTGGAGGTGGGCAGAGGG + Exonic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162315910 19:9937706-9937728 CAGAGGTGGAGGAGGGGGGCGGG + Intergenic
1162396913 19:10422654-10422676 CAGAGGTGGGGGTGGCCTGGAGG - Intronic
1162476883 19:10905581-10905603 CAGGGCTGGAGATGGTCTGAAGG + Intronic
1162529480 19:11227644-11227666 TAGCAATGGAGGTGGGCTGAAGG + Intronic
1162577238 19:11506130-11506152 CCGAGGAGGCGGTGGACTGAAGG - Exonic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162726103 19:12690425-12690447 CAGAGCTGGAGCGGGGCTGCGGG - Intronic
1163106284 19:15124892-15124914 CAGAATGGGAGGTGGGCTGGGGG - Intronic
1163169628 19:15521903-15521925 GGGAGGTGGAGGTGGGTGGATGG + Intronic
1163184597 19:15628861-15628883 CTGAGGTGGGCATGGGCTGAGGG + Intronic
1163236677 19:16034088-16034110 CAGAGGTGGGGGAGGGGTGAGGG + Intergenic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163427481 19:17247108-17247130 CAGAGGAGGGGGTGCGCAGAAGG - Intronic
1163491700 19:17620614-17620636 CAGAGGTGGAAGGGGGCACAGGG + Intronic
1163519159 19:17781619-17781641 CAGAGGTGTGGTTGGGCGGAGGG + Intronic
1164158772 19:22612765-22612787 GAGGGGTGGAGGTGGGATCATGG + Intergenic
1164551931 19:29219263-29219285 CAGAGGTGGAGGTGGGAGAGGGG - Intergenic
1164940967 19:32252034-32252056 CAATGTTGGAGGTGGGCAGAGGG + Intergenic
1165118558 19:33544575-33544597 CGGAGCTGGATGTGGGCTGGGGG - Intergenic
1165151940 19:33766197-33766219 TAGAGGTGGAGGAGGGGAGAAGG - Intronic
1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG + Exonic
1165931915 19:39364775-39364797 TAGATGTGGAGATGGCCTGAAGG + Intronic
1166196260 19:41207667-41207689 CAGATGTGGAGCTGGGAGGAGGG + Intergenic
1166213679 19:41322696-41322718 CAGAGCTGGATGGGGACTGATGG + Exonic
1166321609 19:42022375-42022397 CAGGGGTGGAGGGGGACAGAGGG + Intronic
1166607629 19:44159280-44159302 CAGAGGGAGAGATGGGCAGATGG - Exonic
1166824587 19:45601093-45601115 CTCAGGAGGAGGGGGGCTGATGG + Intronic
1167251494 19:48400718-48400740 AGCAGGTGGAGGTGTGCTGAGGG - Intronic
1167456830 19:49600789-49600811 CAGAGGTTGCGGTGAGCGGAAGG - Intronic
1167633241 19:50638847-50638869 GAGAGGTGGATGTGGGGAGAGGG + Intronic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1168025024 19:53637620-53637642 CAGAGGTTGCAGTGAGCTGAGGG + Intergenic
1168448812 19:56446945-56446967 AAGATGGGGAGATGGGCTGAGGG - Intronic
924978703 2:200739-200761 CAGAGCTGGAGCTCGGCTGTCGG - Intergenic
925068928 2:951080-951102 CGGAGGTGAAGGGGCGCTGAGGG - Intronic
925180380 2:1813519-1813541 TACAGGTGGAGGTGGGCAGTGGG + Intronic
925275357 2:2644815-2644837 CAGAGGTGGAGGGGAGGTGGTGG - Intergenic
925275384 2:2644905-2644927 CAGAGGTGGAGGGGAGGTGGTGG - Intergenic
925275399 2:2644950-2644972 CAGAGGTGGAGGGGAGGTGGTGG - Intergenic
925275441 2:2645085-2645107 CAGAGGTGGAGGGGAGGTGGTGG - Intergenic
925275455 2:2645130-2645152 CAGAGGTGGAGGGGAGGTGGTGG - Intergenic
925797197 2:7558583-7558605 CAGGGGTGGAGATAAGCTGAGGG + Intergenic
926365336 2:12128031-12128053 CAGGCTTGGAGGTTGGCTGATGG + Intergenic
926625267 2:15085433-15085455 GAGAGGTGGCCCTGGGCTGAGGG - Intergenic
927511604 2:23647559-23647581 CAGAGGTGACGGTGGCCTGATGG - Intronic
927569283 2:24144330-24144352 GGGAGGTGGAGGTGGGAGGATGG + Intronic
927582559 2:24266830-24266852 AAGAGGTTGAGGTGGGAGGATGG + Intronic
927596667 2:24403233-24403255 GAGTGGTGGAGGGGGGGTGAGGG - Intergenic
927800901 2:26098375-26098397 GAGAGGCTGAGGTGGGCAGATGG - Intronic
927962742 2:27250817-27250839 AAGAGCTGGGGCTGGGCTGAGGG + Intergenic
928128346 2:28631242-28631264 CAGGAGTGGAGGTGGGGAGATGG - Intronic
928152534 2:28845016-28845038 CAGAGGTGGAGGATTGCTTAAGG - Intronic
928233231 2:29518043-29518065 CAGGGTTGGTGGTGGGCTGTAGG + Intronic
928311392 2:30213441-30213463 GAGAGGTGGAGGTGGCCACAGGG + Intergenic
928313942 2:30231924-30231946 CAAAGGTGGGGGTGGGGGGAGGG + Intronic
929503223 2:42507824-42507846 CAGAGGCTGAGGTGGGATGATGG + Intronic
929879506 2:45823757-45823779 CAGAGGTGGAACTGGGCCCAGGG - Intronic
929976323 2:46639069-46639091 TGGAGGTGGAGGTGTGCTGCTGG - Intergenic
930422659 2:51174089-51174111 CAGAGTTTGAGGTGGGGAGAAGG - Intergenic
930630587 2:53749759-53749781 CAGGGGTGGAGCTGGGGAGAGGG + Intronic
930641792 2:53860312-53860334 ACGAGGAGGAGGTGGGCTGCGGG - Intergenic
930816895 2:55607716-55607738 CAGAAGGGGAGAGGGGCTGAGGG - Intronic
931179535 2:59885669-59885691 TAGAAGTGGAGGTGGGGTGTAGG - Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931681105 2:64750705-64750727 CAGAGGAGGAGGCTGGCTGAGGG + Intronic
932016588 2:68034314-68034336 CAGAGGTGGGAGTGGGGAGAGGG + Intergenic
932260345 2:70321562-70321584 AAGAGGTGGCGGGTGGCTGAGGG + Intergenic
932304691 2:70693718-70693740 AAGTGGGGGAGCTGGGCTGAGGG - Intronic
932461309 2:71883660-71883682 CACACGTGGAGGTGGGCTGTGGG + Intergenic
932575232 2:72959086-72959108 GAGAGGTGGAGGAGAGGTGAGGG - Intronic
932636552 2:73394058-73394080 GAGAGGCCGAGGTGGGCAGATGG - Intronic
933009589 2:77042951-77042973 AAGAGTTGGGGGTGGGCAGATGG + Intronic
933036502 2:77406127-77406149 CAGTGGTGGTAGTGGGCTGGGGG + Intronic
933721291 2:85399061-85399083 GAGAGGTGGTGATGAGCTGAGGG - Intronic
933906632 2:86900342-86900364 GAGAGGTCTAGGTGGGCAGATGG + Intergenic
934024841 2:87993293-87993315 GAGAGGTCTAGGTGGGCAGATGG - Intergenic
934847988 2:97675003-97675025 CAGAGGATGAGGTGGAATGATGG - Intergenic
935229661 2:101084635-101084657 AACAGGTGCAGGTGGGCAGAGGG - Intronic
935253099 2:101282849-101282871 CACAGGTGGAGCAGGGCTGTGGG - Intronic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935584163 2:104785524-104785546 CAAAAATGGAGGTGGGCTGGGGG + Intergenic
935775919 2:106471371-106471393 GAGAGGTCTAGGTGGGCAGATGG - Intergenic
936090313 2:109497947-109497969 AAGAGGTGGAGGATGGCAGAAGG + Intronic
936286219 2:111183389-111183411 CAAAGGTGGAGTTGGGAGGATGG - Intergenic
936365536 2:111851340-111851362 GAGAGGTCTAGGTGGGCAGATGG - Intronic
937037107 2:118791350-118791372 CTGAGGTGGTGGGTGGCTGAAGG - Intergenic
937048787 2:118871222-118871244 CAGAGGTTGTGAGGGGCTGAGGG - Intergenic
937150515 2:119682839-119682861 GAGGGGTGGAGGTGGGCAGTGGG + Intronic
937264167 2:120605704-120605726 CTGAGGAGGAGGTGGGGTGGCGG - Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937440061 2:121907902-121907924 CAGAGGCGAAGGTGGGGTGGAGG + Intergenic
938137249 2:128769657-128769679 CTGAGGTGGAGCTGGGCAGGTGG + Intergenic
938286992 2:130127477-130127499 CAGTGGTGGAGGTGCACTTAGGG - Intronic
938338938 2:130522894-130522916 CAGAGGCGCAGGTGGGCACAGGG + Exonic
938350900 2:130597856-130597878 CAGAGGCGCAGGTGGGCACAGGG - Exonic
938399327 2:130975862-130975884 CAGAGGCGGAGGACTGCTGAGGG + Intronic
938428602 2:131211393-131211415 CAGTGGTGGAGGTGCACTTAGGG + Intronic
938469507 2:131545411-131545433 CAGTGGTGGAGGTGCACTTAGGG + Intergenic
938711410 2:133978868-133978890 CTGAGCTGGAGCTGTGCTGATGG + Intergenic
939680785 2:145129515-145129537 CAGAGGTGGAGGAGGTTGGAGGG - Intergenic
940884592 2:158977898-158977920 CAGTGGTGGTGGTAGGGTGAGGG - Intronic
940896862 2:159089403-159089425 GAGGGGTGGAGGTGGGGTGCAGG - Intronic
940900633 2:159123481-159123503 GAGGGGTTGAGGTGGGGTGAGGG - Intronic
941897534 2:170644524-170644546 GGGAGGCCGAGGTGGGCTGATGG - Intronic
942122978 2:172796624-172796646 AGGAGGTTGAGGTGGGCAGATGG - Intronic
942124428 2:172809283-172809305 CAGTGGTGGAGATGGGCAGTGGG + Intronic
942150844 2:173075294-173075316 CAAAGGTGGAGGTGGGCGTTGGG - Intergenic
942301095 2:174563330-174563352 GAGAGGTTGAGGAGGGATGATGG + Intronic
942377443 2:175352252-175352274 CAGAGGTGGAGGTGGCATTCAGG - Intergenic
942454688 2:176129846-176129868 AAGAGGTGGCGGCGGGCAGAGGG + Exonic
944457579 2:199911393-199911415 CGGAGGTGGAGGGTGGCGGAGGG - Exonic
945460291 2:210100075-210100097 CACAGCAGGAGGTGGGCAGAGGG + Intronic
946026187 2:216673255-216673277 CAGAGGTGGTGGTGGGGAGATGG + Exonic
946143701 2:217713123-217713145 AAGAGGGGGAGGTCGGCTGGTGG + Intronic
946144330 2:217717677-217717699 CAGAGGCTGCTGTGGGCTGATGG - Intronic
946166913 2:217869931-217869953 AGGTGGTGGAGGTGAGCTGAGGG - Intronic
946173027 2:217906467-217906489 CAGATGAGGAGGTTGGCAGAGGG + Intronic
946932456 2:224684134-224684156 GGGAGGCTGAGGTGGGCTGACGG - Intergenic
947531950 2:230914918-230914940 CAGACCTGCAGGTGGTCTGAAGG - Intronic
947561722 2:231159999-231160021 CAGAGCAGGAGGTGAGCGGAGGG - Intronic
947792973 2:232878256-232878278 CTGAGGTGGAGCTGGGGCGAGGG + Intronic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
948712872 2:239836195-239836217 CCGAGGTGGAGCTGGGCCCAGGG + Intergenic
948793007 2:240388849-240388871 CAGAGGTGGGGTTGGGCAGGAGG + Intergenic
949081514 2:242104268-242104290 CAGAGCAGGAGGTGAGCAGAGGG + Intergenic
1169284871 20:4299541-4299563 AGGATGTGGTGGTGGGCTGAGGG + Intergenic
1169552406 20:6714581-6714603 AAGAGGTGGATGGGGGATGATGG + Intergenic
1169849884 20:10036823-10036845 CAGAGTGAGAGTTGGGCTGAGGG + Intronic
1170157090 20:13278833-13278855 CAGAGCTAGACGTGGGCTGAGGG + Intronic
1171099274 20:22367413-22367435 TGGGGGTGGAGGTGGGATGAGGG + Intergenic
1171274369 20:23843076-23843098 GAGAGGTGCAGGTAGGATGAGGG + Intergenic
1171382339 20:24743161-24743183 CAGTGGTGGAGGCAGCCTGATGG - Intergenic
1171393161 20:24814535-24814557 GAGAGGAGGAGGTGGGCCGTAGG - Intergenic
1171793416 20:29548388-29548410 CATAGGTGGAAGTCGGCTCAAGG + Intergenic
1172061757 20:32191231-32191253 CAGAGGTGGAGGGGGATTGGAGG - Intergenic
1172316711 20:33961050-33961072 GGGAGGTTGAGGTGGGCAGATGG + Intergenic
1172831331 20:37837721-37837743 CAGTGGTGGAGGTGGGCATGGGG - Intronic
1172844599 20:37922451-37922473 GAGAGGTGGGGCCGGGCTGAGGG + Intronic
1173131722 20:40400210-40400232 CACAGTGGGAGGTGGGCTGTTGG - Intergenic
1173153194 20:40585311-40585333 CTGAGCAGGAGGTGGGCTGCTGG - Intergenic
1173438485 20:43054312-43054334 CGGAGGCTGAGGTGGGCAGATGG + Intronic
1173676499 20:44840335-44840357 TAGAGGTTGAGGTGGGAGGATGG - Intergenic
1173907054 20:46637125-46637147 CCCAGGTGGAGCTGGGATGATGG - Intronic
1174027393 20:47589440-47589462 CAGAGGTTGCAGTGAGCTGAGGG - Intronic
1174033574 20:47651166-47651188 CACATTAGGAGGTGGGCTGAAGG - Exonic
1174045246 20:47728484-47728506 AAGAGATGGGGGTGGGCTGCTGG + Intronic
1174324215 20:49766357-49766379 CATTGGTGGAGGTCTGCTGAGGG - Intergenic
1174404515 20:50294709-50294731 CAGAGGTGGCGGTGAGGTGCAGG + Intergenic
1174590718 20:51642508-51642530 CAGGGGTGGACATGGGATGAGGG + Intronic
1175026506 20:55907960-55907982 CTGAGGAGGAGGGGGGTTGAAGG + Intergenic
1175083088 20:56437470-56437492 CAGATGAGGAGTTGGGCGGAGGG + Exonic
1175137624 20:56836686-56836708 CTGAGTTTGAGGTGGGCTGTGGG + Intergenic
1175178162 20:57126228-57126250 GAGAGGTGGAGGTGCCCTGGTGG - Intergenic
1175918430 20:62438441-62438463 CAGTGGTGCAGGAGGGCTGCCGG + Intergenic
1176179525 20:63742786-63742808 CTGAGGTGCGTGTGGGCTGAGGG + Exonic
1176241833 20:64079075-64079097 CAGATGTGGAGGGTGGCAGATGG - Intronic
1177612729 21:23473699-23473721 CAGAGTTGGAGGTGAGTTCAGGG - Intergenic
1178744776 21:35238264-35238286 CAGGGGTGGAGGGGAGCTGGTGG + Intronic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179043982 21:37829165-37829187 CAGGGGTGGAGGTGGTGGGAGGG + Intronic
1179489702 21:41733382-41733404 GAGGGGTGGAGGTGGGGTGCAGG + Intergenic
1179714670 21:43280732-43280754 GGGAGGTGGAGGTGGGGGGAGGG + Intergenic
1179907702 21:44432784-44432806 CAGAAATGCAGGTGGGTTGAGGG - Intronic
1179925975 21:44534154-44534176 CAGGGGTGGAGCTGGTGTGAGGG + Intronic
1180072250 21:45442425-45442447 CAGAGGTGAGGGTGGGCTCAGGG - Intronic
1180145015 21:45913983-45914005 CAGGGGTGGAGGCGGGCTTTGGG - Exonic
1180352916 22:11818867-11818889 CAGAGCTGGGGGTGAGCTGCTGG - Intergenic
1180385324 22:12173490-12173512 CAGAGCTGGGGGTGAGCTGCTGG + Intergenic
1180818432 22:18807971-18807993 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1180913522 22:19469786-19469808 CAGGGGAAGAGGTGGCCTGATGG + Intronic
1181204654 22:21242426-21242448 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181480618 22:23196854-23196876 CAGAGCTGGAGGTGAGCGGTAGG - Intronic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181886832 22:26028176-26028198 CAGAGGTTGCAGTGAGCTGAGGG + Intronic
1181908038 22:26215362-26215384 CTGAGTGGGAGGTGGGGTGAGGG - Intronic
1181916476 22:26285096-26285118 CAGAGGTGGTGGTGGCCTTGGGG - Intronic
1182558504 22:31141626-31141648 CAGAGGGGGAAGGGGGCTGCAGG + Intergenic
1182733576 22:32514380-32514402 CAGAGCTGGAAGAGGCCTGAGGG - Intronic
1182920786 22:34077067-34077089 CAGAAGTGGGGGTGGGCAGGTGG - Intergenic
1183059068 22:35324245-35324267 CACAGGTGGAGCTGGCCTGAAGG - Intronic
1183305651 22:37081721-37081743 CAGTGGTGGAGATGGGCTTCAGG - Intronic
1183464262 22:37971755-37971777 AAGAGGAGGAGGTGGGCTGAGGG - Intronic
1183528205 22:38336540-38336562 CAGGGGTGGAGGTGGGGTGGGGG - Intronic
1183596657 22:38816758-38816780 CAGACTTGGTGGTGGGGTGATGG + Intergenic
1183728017 22:39600219-39600241 CCCAGGTGGGGGTGGGGTGAGGG - Intronic
1183756201 22:39768137-39768159 CAGGGGTGGATGAAGGCTGATGG - Intronic
1184422914 22:44392188-44392210 CAGAGTTGAAGGTTGGCAGATGG + Intergenic
1184571177 22:45325931-45325953 GAGATGTGGGGGTTGGCTGATGG + Intronic
1184840674 22:47050783-47050805 CATCGGTGGAGGTGGGGGGATGG + Intronic
1203222270 22_KI270731v1_random:52989-53011 AAGTGGGGGAGGGGGGCTGATGG - Intergenic
949943685 3:9173747-9173769 CAGGGGTGGAGGTGGGTGGCTGG - Intronic
949987732 3:9553424-9553446 CAGGGCTGGAGGTAGGCTGGAGG + Intronic
950474157 3:13205280-13205302 CCCAGGTGGAGGTGAGCTTATGG - Intergenic
950649328 3:14397451-14397473 CAGGAGTGGAGATGGGCTGTCGG + Intergenic
950723006 3:14898135-14898157 CAGGGGTTGAGGTGGGCGAAGGG + Intronic
951053945 3:18125959-18125981 CAAAGGTGGAGGTGGGGTGTTGG - Intronic
952183979 3:30948349-30948371 GAGAGGTGGAAGTGGGGTGAGGG + Intergenic
952189669 3:31009412-31009434 CTTAGGTGGAGGTGGAATGAGGG - Intergenic
952221615 3:31328997-31329019 GAGAGGTGGGGATGGGGTGAGGG - Intergenic
952341478 3:32451187-32451209 AAGAAGTGGATGTGGGCTGGTGG + Intronic
952877381 3:37957717-37957739 CAGAAGTGGGGGTGGCCTCAGGG - Intronic
952966342 3:38623420-38623442 CAGAGGTGGAGGAGGGCGATTGG - Intronic
953830141 3:46289951-46289973 CAGAGATGGAGGGAGGCAGAAGG + Intergenic
953882986 3:46701208-46701230 CTGAGGTGGGGGTGGGCGGGAGG - Intergenic
954156697 3:48688981-48689003 CAGATGTTGAGGTGGGGTGCTGG - Intronic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954417439 3:50400243-50400265 CAGAAGTGCAGGTGGGGTTAGGG + Intronic
955341714 3:58130177-58130199 CAGGGCTGGATGTGGGCTGCAGG + Intronic
955488296 3:59457086-59457108 CAGAGGTGGAGAGGGGGTGGTGG - Intergenic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
955518511 3:59751970-59751992 GAAAGGTGGTGGTGGGCTGGGGG + Exonic
956276705 3:67509953-67509975 GAGAGATGGAGGTGGGAAGAAGG + Intronic
957397809 3:79665866-79665888 CAGAGGAGTAGGTAGGCTGAAGG + Intronic
958085972 3:88807592-88807614 CAGAGGTGGAGGTGGGGCAGGGG - Intergenic
958765885 3:98367619-98367641 TAGAGTTGGAGGAGGGGTGATGG + Intergenic
959107067 3:102076772-102076794 GAGAGTGGGAGGTGGGGTGAGGG - Intergenic
959526616 3:107384283-107384305 CAGAGGCAGAGGTGGGGTGGGGG + Intergenic
959531438 3:107438656-107438678 CAGCCGTGGAGGTGCCCTGAGGG - Intergenic
959897048 3:111617127-111617149 AGCAGGTGGAGATGGGCTGAGGG + Intronic
960492611 3:118334937-118334959 CAGGGGTGGGGTTGGGGTGAGGG - Intergenic
960968288 3:123120795-123120817 GAGAGGTGGAGGTGGGGGGTGGG - Intronic
961033825 3:123628700-123628722 CAGAGTGGGAGGTTGGCTGAAGG - Intronic
961042638 3:123688204-123688226 CAGAGTTGGAGGTGGGATACAGG - Intronic
961066830 3:123883475-123883497 CAGATGTGAAGATGGGCTGATGG - Intronic
961312737 3:126014054-126014076 CAGATGCGGGGGCGGGCTGATGG + Intronic
961364554 3:126390996-126391018 CACAGGTGGGGGTGGGGTGCAGG - Intergenic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
961415846 3:126756168-126756190 CCGAGGTAGGGGTGGGCAGAGGG - Intronic
961512123 3:127409545-127409567 CAGTGGTGGATGTGGGGTGAAGG - Intergenic
961742393 3:129040839-129040861 CAGAGGAGGAGGTGGAGGGAGGG + Intergenic
961814621 3:129543122-129543144 GAGTGGTGGGGGTGGGCTGCTGG + Intergenic
962053222 3:131841428-131841450 CAGAGCAGGAGGTGAGCAGAGGG + Intronic
962223354 3:133583418-133583440 CAGAGAAGAAGGTGAGCTGAAGG - Intronic
964376368 3:156052213-156052235 CAGGGGAGGAGGTGGGGTGGCGG - Intronic
964470833 3:157053936-157053958 CCTAGGTGGAGGCAGGCTGAGGG - Intergenic
964514135 3:157488957-157488979 AAGAGGGGGAGGTGGGGGGAAGG - Intronic
964620708 3:158717722-158717744 CAGAGCAGGAGGCTGGCTGAGGG + Intronic
964672695 3:159244442-159244464 CAGGGGAGAAGGTGGGCTCAGGG + Intronic
964747635 3:160026947-160026969 CAAAGGTGGATGTGGCCTGCTGG + Intronic
964803565 3:160581354-160581376 CTGAGGTGAAGCTGGGCTTAAGG + Intergenic
965377155 3:167939449-167939471 CAGAAGTGGAGATGGGTAGATGG + Intergenic
965759469 3:172060339-172060361 TAGTGGTGGTGGTGGGCAGAGGG + Intronic
966942923 3:184758231-184758253 CTAGTGTGGAGGTGGGCTGAGGG + Intergenic
967297874 3:187983224-187983246 CTGGGGTGGAGATGGGCAGATGG - Intergenic
967708817 3:192682396-192682418 CAGAGGTGGAGCTGGAGTCAGGG - Intronic
967807175 3:193726134-193726156 GGGAGGCGGAGGTGGGCAGATGG + Intergenic
967816635 3:193804688-193804710 CATTGGTGCAGGTGGGCTGCAGG - Intergenic
967983369 3:195078519-195078541 AAGAGGGGGAGGTAGGCTGGAGG - Intronic
968066368 3:195761787-195761809 CAGCGGTGGAGGAGGGCGGGAGG + Intronic
968291995 3:197546329-197546351 CAGAGGTGGTGGTGGCCTTGAGG - Intronic
968292670 3:197550737-197550759 CAGGGGTGGAGGTGGAGGGAGGG + Intronic
968369116 3:198210891-198210913 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
968527851 4:1073242-1073264 CTGAGGTGGATGTGTGCTGAGGG + Intronic
968534046 4:1112881-1112903 CGGAGGTGGTGGGGGGCTGCAGG - Intronic
969259632 4:6025211-6025233 CAGAGGTGGGGGTGGCCACAGGG - Intergenic
969285247 4:6198972-6198994 CAGAGGAGGAGGTGGGGAGGAGG - Intronic
969474311 4:7412666-7412688 CAGGGGTGGGGAGGGGCTGATGG - Intronic
969564539 4:7970328-7970350 CAAAGGTGCTGGTGGGCAGAGGG + Intronic
969837936 4:9858689-9858711 CAGAGGCAGAGGTGGAATGATGG + Intronic
970342127 4:15118492-15118514 CAGACGTGGAGGTGGGGAGCTGG - Intergenic
970606160 4:17683834-17683856 GGGAGGTGGAGGTGGGTGGATGG + Intronic
971167485 4:24198961-24198983 CTGAAGTCAAGGTGGGCTGAAGG + Intergenic
971432910 4:26587470-26587492 GAGAGGTTGAGGTGGGAGGATGG + Intronic
972734892 4:41830810-41830832 CAGAGGTGGGTGTGGGAGGAAGG + Intergenic
972745189 4:41925234-41925256 CTGAGGTGGAGGTGGACTCCTGG - Intergenic
972950029 4:44309276-44309298 GAGAGGCCGAGGTGGGCAGATGG - Intronic
973846017 4:54914097-54914119 CAGGGGTGGAGGTGGGGAGTCGG - Intergenic
974312061 4:60225167-60225189 CACAGCAGGAGGTGAGCTGAGGG - Intergenic
974616812 4:64296770-64296792 CAGAGGATGAGGTGGGGTCATGG + Intronic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975582605 4:75920486-75920508 CAGAGCTGGTGGTGGGCTCTAGG + Intronic
975798758 4:78036447-78036469 CATGGATGGAGGTGGGGTGAGGG + Intergenic
976597135 4:86904994-86905016 GAGAGGCTGAGGTGGGCGGATGG + Intronic
976869518 4:89774183-89774205 CAGAGGTGGAGCTGGGAAGCTGG - Intronic
977293960 4:95191915-95191937 CAGGGGAGGAGGTGGGCAGGGGG - Intronic
977432747 4:96952799-96952821 CACAGGTGGAGGTGGGGTGGTGG + Intergenic
977588342 4:98800052-98800074 GGGAGGTGGAGGTGGGAGGATGG + Intergenic
977942403 4:102873374-102873396 AAGAGGTTGAGGTGGGAGGATGG - Intronic
978590410 4:110318095-110318117 TAGACGTGGAGATGGGCAGAAGG + Intergenic
978749201 4:112228139-112228161 CGGAGGCTGAGGTGGGCAGATGG - Intergenic
979007255 4:115315407-115315429 CAGAGCAGGAGGTGAGCGGAAGG + Intergenic
979257542 4:118620600-118620622 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
979276891 4:118824383-118824405 GAGAGGTCGAGTTGGGCAGATGG - Intronic
979330808 4:119419947-119419969 CAGAGCTGGAGGTGAGCAGCAGG - Intergenic
979672894 4:123379834-123379856 CTGAGGTGGTGCTGGGCTGGGGG - Intergenic
979847266 4:125531484-125531506 GGGAGGTGGAGGTGGGTGGATGG - Intergenic
980126703 4:128781371-128781393 GAGAGGCTGAGGAGGGCTGATGG + Intergenic
981927382 4:150154679-150154701 CAGAAATGGAAGTGGGGTGATGG + Intronic
982001592 4:151025812-151025834 GAGAGGCTGAGGTGGGCAGATGG + Intergenic
982039777 4:151385255-151385277 CTGGGGTGGAGGTGGGGGGATGG + Intergenic
982689243 4:158529497-158529519 GAGAGGCTGAGGTGGGCGGATGG - Intronic
983144588 4:164197694-164197716 GAGAGATGGAGATGGGCAGACGG - Intronic
984779787 4:183514686-183514708 CTGAGGCGGAGGTGAGCTAAGGG + Intergenic
984856363 4:184199321-184199343 CAGGGGTTGAAGTGGGCTGGGGG + Intronic
986680505 5:10228867-10228889 GAGAGGCTGAGGTGGGCAGATGG - Intronic
986717397 5:10533884-10533906 CAGAGGTGGAGGGGGCGTGGAGG + Intergenic
987057079 5:14203816-14203838 AAGGGGTGGGGGTGGGCTGATGG + Intronic
989077925 5:37584879-37584901 CAGAGGTGGAGGTGGAATATGGG - Intronic
989987098 5:50713784-50713806 CAGAGAAGGAGATGGGATGAAGG + Intronic
989998181 5:50860770-50860792 AAGATGTGGTGGTGGGCTGGGGG - Intergenic
991038148 5:62149016-62149038 CAGTGGTAGAAGTGGGCTGTGGG - Intergenic
993859988 5:93124418-93124440 CAGAGCAGGAGGTGAGCTGCCGG + Intergenic
994708374 5:103233880-103233902 CAGAGTTGGAGTTGGGGTAAGGG - Intergenic
996013679 5:118507771-118507793 CAGAGGTGATGGTGGGGTGGGGG + Intergenic
996109052 5:119543255-119543277 CAGGGGTGAAGGTGGGAGGAGGG - Intronic
997952384 5:138252778-138252800 CAGAAGTGGAGATGGGGTGGAGG + Exonic
998359634 5:141573807-141573829 CAAAGGAGGAGGTGGGGGGATGG + Exonic
999182940 5:149682834-149682856 CAGAGCAGGAGGGAGGCTGAGGG + Intergenic
1000123422 5:158220151-158220173 CAGGAGTTCAGGTGGGCTGAAGG - Intergenic
1000408840 5:160917219-160917241 CAGAGGTGGAGCTGGGTTGTGGG + Intergenic
1000941948 5:167372428-167372450 CAGAGGTAACAGTGGGCTGAGGG - Intronic
1001308449 5:170593545-170593567 CATAGGTGGAAGGGGGCTGATGG - Intronic
1001314663 5:170633659-170633681 GAGAGATGGCGGTGGGCGGAAGG + Intronic
1001542101 5:172546738-172546760 CAGAGGAGGAGGGGAGGTGATGG + Intergenic
1001897414 5:175393278-175393300 CTGTGATGGAGGTGGGGTGAGGG - Intergenic
1002000500 5:176194105-176194127 CAGAGCTGGAGGAGGAATGAGGG + Intergenic
1002033547 5:176448255-176448277 CAGAGGTGGCGGGGGGCGGGGGG + Intronic
1002144932 5:177172717-177172739 GAGAGGTTGAGGTGGGAGGATGG + Intronic
1002196224 5:177503071-177503093 CTGAGGTGGAGTTGCGGTGAGGG + Intronic
1002253836 5:177944876-177944898 CAGAGCTGGAGGAGGAATGAGGG - Intergenic
1002322102 5:178382415-178382437 CAGAGGAGGAGGAGGGCGAAGGG - Intronic
1002728392 5:181316476-181316498 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1002859876 6:1071209-1071231 CAGAGATTGAGGTGGGAGGATGG - Intergenic
1003141751 6:3477691-3477713 CACAGCAGGAGGTGGGCGGAGGG - Intergenic
1003392048 6:5722794-5722816 TGGAGGTGGAAGTGGGGTGAGGG - Intronic
1003876997 6:10446777-10446799 CAGAGGCGGAGGTGGGAGGATGG - Intergenic
1003962187 6:11219170-11219192 AGGAGTTGGAGGTGGGGTGAGGG - Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004376985 6:15098961-15098983 CAGAAGTGGATTTGGGCTTATGG + Intergenic
1004441374 6:15658451-15658473 CAGGGGTGCAGGTGGGCGGCAGG + Intronic
1004449444 6:15731207-15731229 CAAAGGTTGAGGGAGGCTGATGG + Intergenic
1005030936 6:21508478-21508500 TAGAGGGGGAGAAGGGCTGAAGG - Intergenic
1005255378 6:23997269-23997291 CAGAGGTGGAGGAGGGGGAAGGG - Intergenic
1005735650 6:28743148-28743170 CGGGGGAGGAGGTGGGCAGAAGG + Intergenic
1005913907 6:30335424-30335446 GAGAGGCTGAGGTGGGATGATGG - Intronic
1006188397 6:32192877-32192899 CAGAAGAGGAGGTGGGGTGGAGG - Exonic
1006238197 6:32654197-32654219 CAGAGATTGAGGTGGGAGGATGG + Intergenic
1006470811 6:34227619-34227641 CTGGGGTGGAGGTGGGCTAGGGG - Intergenic
1006644363 6:35505900-35505922 AAGGGGTGGAGGTGAGCTGCAGG + Intronic
1006662452 6:35658964-35658986 CAGAGGCTGAGGTGGGAAGACGG + Intronic
1006841691 6:37032390-37032412 CTGAGGTGGAAGTGTGCTGAGGG - Intergenic
1007061814 6:38947582-38947604 CAGATGTGGAGGAGGCCTGTGGG + Intronic
1007207594 6:40165173-40165195 CTGAGGAGGTGGTGGGGTGACGG - Intergenic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007737766 6:43992426-43992448 CAGAGGAGGGAGTGGTCTGATGG + Intergenic
1007783498 6:44267273-44267295 AAGAGTTGGGGGAGGGCTGAGGG + Intergenic
1007794562 6:44337329-44337351 CAGAGGTGAAGGTGGGGTTTAGG + Intronic
1008194811 6:48505692-48505714 CAGAGTAGGAGGTGGCCTAACGG - Intergenic
1009307067 6:62103542-62103564 CAGAGGTGGGGGTGGGGGGCGGG - Intronic
1009980163 6:70718258-70718280 CAGAGGTCCAGCTGGGATGAGGG + Intronic
1010205242 6:73316615-73316637 CAAAGGTGGAGGCGGGCAGATGG + Intergenic
1010224326 6:73475200-73475222 GAGAGGCTGAGGTGGGCGGATGG - Intronic
1011628156 6:89299990-89300012 CAGGGGAGAAGGAGGGCTGAAGG + Intronic
1011780892 6:90788295-90788317 CAGAGATGGAGGAGTCCTGATGG + Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014091972 6:117414188-117414210 CAGAGTTGGAGTTGGGGTAATGG - Intronic
1014140640 6:117938516-117938538 CAGGGGGGCAGGTGGGCTGGGGG - Intronic
1014769458 6:125444787-125444809 CAGGGGTGGGGGTGGGGAGACGG - Intergenic
1015228254 6:130883138-130883160 GAGAGGTGAAGGTGGGCACATGG + Intronic
1015614312 6:135059149-135059171 GGGAGGTGGAGGTGGGAGGATGG - Intronic
1015986205 6:138886655-138886677 GGGAGGCTGAGGTGGGCTGATGG - Intronic
1015996093 6:138996684-138996706 CAGTGGTTGCGGGGGGCTGAGGG - Intergenic
1016347588 6:143130865-143130887 GAGGGGTGGAGGTGGGAAGAGGG - Intronic
1016543579 6:145195147-145195169 CAGAGGTTGCAGTGAGCTGATGG + Intergenic
1017704361 6:157107379-157107401 CATTGGAGGAGGTGGGCTAAAGG + Intronic
1018280429 6:162179555-162179577 CTGAGTTGGAGGTGGCATGAGGG + Intronic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1018475637 6:164138155-164138177 CAGAGAAGCAGGTGGGCTCAAGG - Intergenic
1018811157 6:167299415-167299437 CTGATGTGGAAGTGGCCTGAGGG - Intronic
1019228867 6:170540367-170540389 CAGAGGAGGAAGGGGGCTGAAGG - Intronic
1019351675 7:556986-557008 CAGAGGTGGGGGTCGGCTGTGGG - Intronic
1019485225 7:1286145-1286167 CAGAGGGGTAGGTGGGGTGGGGG + Intergenic
1020009241 7:4799497-4799519 CAGAGGTGGGGGTGGGCAGGAGG + Intronic
1020106145 7:5423244-5423266 GAGGGGTGGGGGTGGGCTGCTGG - Intronic
1020432082 7:8125026-8125048 AGGAGGCGGAGGTGGGCAGATGG - Intronic
1020807381 7:12807507-12807529 GGGAGGTGGAGGTGGGAGGAAGG - Intergenic
1022334757 7:29411830-29411852 CAGAGACGGGGGCGGGCTGAAGG - Intronic
1022395844 7:29987898-29987920 CAGAGGTGGAGGCAGTCTTAAGG - Intronic
1022577575 7:31513005-31513027 CTGAGGAGGAGGTGAGCTTAGGG - Intergenic
1022830633 7:34062460-34062482 ATGAGGTGGGGGTGGGGTGAGGG - Intronic
1022887493 7:34661572-34661594 CAAGGGTGGAGGTGGGAGGAAGG - Intronic
1023019857 7:36001611-36001633 CAGAGAAGGAGGTGTGATGATGG + Intergenic
1023399526 7:39781875-39781897 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1023864303 7:44231677-44231699 CAGAGGGGCAGGTGCCCTGAGGG - Intronic
1024072464 7:45797664-45797686 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1024481049 7:49863668-49863690 CGGAGGCTGAGGTGGGCGGATGG - Intronic
1024505767 7:50159787-50159809 CAGGGGTGCATGTGGGCTGAGGG + Exonic
1024601836 7:50988823-50988845 CAGTGGTGGTGGTGGGGTGGGGG + Intergenic
1025070847 7:55897518-55897540 GGGAGGTGGAGGTGGGAGGATGG - Intronic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1025715211 7:63949856-63949878 CAGAGGAGAAGGTGAGCTGTGGG + Intergenic
1025932936 7:66010882-66010904 CAGAGGTGGGGATGGGCAGTGGG + Intergenic
1026111082 7:67459386-67459408 AAGACGTGGAGTTCGGCTGAGGG - Intergenic
1026293563 7:69030397-69030419 GGGAGGCGGAGGTGGGCTCATGG + Intergenic
1026622916 7:71966377-71966399 CAGTGATGGAGGTGGGGTGGTGG + Intronic
1026630260 7:72031984-72032006 GGGAGGTGGAGGAGGGCGGACGG - Intronic
1027224442 7:76235132-76235154 CCGAGGAGGAGCTGGGCTGCGGG - Exonic
1027266617 7:76498310-76498332 CAGGCGAGGAGGTGGGCTCAGGG + Intronic
1027297546 7:76793249-76793271 GAGGGGTGGAGGAGGGCTGAAGG - Intergenic
1027317998 7:76996428-76996450 CAGGCGAGGAGGTGGGCTCAGGG + Intergenic
1027399036 7:77788461-77788483 CAGAGGCTGAGGTGGGGAGATGG + Intergenic
1028539897 7:91931232-91931254 CAGTGATGCAGGTGGTCTGAAGG - Intergenic
1028728987 7:94123184-94123206 GAGATGTGGAGGTTGGCTGGTGG + Intergenic
1028835362 7:95368842-95368864 TAGAGGTGGAGGTGGGTTTGGGG - Intronic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1028893339 7:96013170-96013192 CAGAGAAGGAGATGGGATGATGG + Intronic
1029153841 7:98500898-98500920 AAGAGGTGGAGGGTGGCTGGAGG + Intergenic
1029181204 7:98703316-98703338 CAGAGGTTGCAGTGAGCTGAGGG - Intergenic
1029272242 7:99384197-99384219 CAGGGGCTGAGCTGGGCTGACGG + Intronic
1029449073 7:100630842-100630864 CACAGCTGGTGGTGGGCTGGGGG - Intronic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1031372107 7:120981085-120981107 GTGAGGTGGAGGGGGACTGAGGG - Intergenic
1031616148 7:123882717-123882739 CTGAGGATTAGGTGGGCTGATGG - Intergenic
1032049856 7:128641369-128641391 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1032519956 7:132536399-132536421 CAGAGGTGGAGGTAGGCTTAGGG - Intronic
1032998351 7:137474791-137474813 CAGAGGCGGCGGAAGGCTGATGG + Intronic
1033008836 7:137597097-137597119 AAAAGGTGGAATTGGGCTGAAGG - Intronic
1033659913 7:143396076-143396098 CAGAGGTGCTGCTGTGCTGAGGG - Intronic
1033674620 7:143528150-143528172 CAGATGTGCAGGTGGGCAGTTGG + Intergenic
1033697216 7:143801290-143801312 CAGATGTGCAGGTGGGCAGTTGG - Intergenic
1034297332 7:149985975-149985997 AAGAGGTTAATGTGGGCTGAAGG - Intergenic
1034418352 7:150976781-150976803 GAGAGGTGGGGGTGGGCCCAGGG - Intronic
1034457612 7:151179733-151179755 GAGAGGTGGAGCAGGGCTGTGGG + Intronic
1034808692 7:154110879-154110901 AAGAGGTTAATGTGGGCTGAAGG + Intronic
1035413534 7:158665705-158665727 TGGAGGTGGAGGTGGGATGCAGG - Intronic
1035539425 8:421066-421088 CAGAGCAGGAGGTGAGCAGAGGG + Intronic
1035544252 8:467235-467257 CAGAGGTGGAGGCTGGCTTAAGG + Intronic
1035828299 8:2668209-2668231 CAGGGGCGGGGGTGGCCTGATGG + Intergenic
1035923019 8:3699015-3699037 CAGAGCTTGAGGTGGGATGTGGG - Intronic
1035950089 8:4010487-4010509 CTGAGGTAGAGTTGGGCTGTTGG - Intronic
1036394076 8:8351859-8351881 CAGAGGTAGATGTGTGCTGGGGG - Intronic
1036597883 8:10230420-10230442 CAAAGGTTCAGGTTGGCTGATGG + Intronic
1037432549 8:18828965-18828987 AAGAGGCTGAGGTGGGCGGACGG + Intronic
1037496272 8:19443884-19443906 TGGGGGTGGAGGTGGGCTTATGG + Intronic
1037505259 8:19523367-19523389 CAGAGGCCGAGGTGGGAGGATGG - Intronic
1037751624 8:21686043-21686065 CAGATGTGGAGCTGAGCTGAAGG - Intergenic
1037880449 8:22571098-22571120 CTGAGGGGGAGCTGGGGTGACGG - Exonic
1038207022 8:25476461-25476483 CAGAGATGCAGGAGGGCTTAGGG - Intronic
1038293261 8:26268669-26268691 TAGAGGTGGAGGTGGGGTGGGGG - Intergenic
1038706738 8:29901240-29901262 AAGAGGTTGAGGTGGGAGGATGG + Intergenic
1039001518 8:32985595-32985617 AAGAAGTGGAGGTGGGTTGGGGG - Intergenic
1039119629 8:34131056-34131078 AAGAGGTTGAGGTGGGAGGATGG - Intergenic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1040389837 8:46940500-46940522 CTGGGGTGGAGGTGTGGTGAAGG + Intergenic
1040558849 8:48505948-48505970 CAGATGTGGGGATGGTCTGAAGG + Intergenic
1040978249 8:53217729-53217751 CAGAGCTGGAGGTGGGAGAAGGG - Intergenic
1041864515 8:62554833-62554855 CAGGGGTGGAAGTGGGGTGTGGG - Intronic
1042871507 8:73404405-73404427 CGGGTGTGGAGGTGGGCTGTGGG - Intergenic
1043024724 8:75051618-75051640 CAGAGGTGGTGTGAGGCTGATGG + Intergenic
1044589617 8:93901122-93901144 CAGGGGTGGAGGTTGGGTTAAGG + Intronic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044683208 8:94802336-94802358 GAGAGGTGGAGGCAGGCAGAAGG - Intergenic
1044783066 8:95763349-95763371 TAGAGGTGGAGGTTGACAGAGGG - Intergenic
1045086084 8:98687459-98687481 CACAGCTGGAGGTGGGCGGTGGG - Intronic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045342351 8:101266239-101266261 GATAGGTAGAGGTGAGCTGAGGG + Intergenic
1045800335 8:106094218-106094240 GGGAGGTCGAGGTGGGCAGATGG + Intergenic
1046180747 8:110644194-110644216 GGGAGGTGGAAGTGGGCAGATGG + Intergenic
1047318398 8:123755221-123755243 CAGAGACTGAGGGGGGCTGAGGG - Intergenic
1047436039 8:124836114-124836136 CAGAGGTGGGTGTGGGCTCAGGG - Intergenic
1047436424 8:124838959-124838981 CAGAGGGGGCGGTGGGCTGATGG + Intergenic
1047711204 8:127554213-127554235 AGGAGGTAGAGGTGGGATGAAGG - Intergenic
1047718914 8:127620534-127620556 CTGAGGTGGAGCGGGGATGAAGG + Intergenic
1047961539 8:130015545-130015567 AAGAGGTGGAGGGGTGCGGAGGG - Intronic
1048009652 8:130445286-130445308 GAGAGGTGGAGGTGGGGTGTAGG - Intergenic
1048434945 8:134407467-134407489 CACAGGTGGAGGTGAGGAGAAGG + Intergenic
1048598508 8:135892898-135892920 CTGAGGTTGAGCTGGGCTGAGGG - Intergenic
1049249839 8:141582386-141582408 CCAAGATGGGGGTGGGCTGAGGG + Intergenic
1049646232 8:143737022-143737044 CACAGGAGCAGGTGGGATGATGG + Intergenic
1049662012 8:143823726-143823748 CAGAGGTGGAGCTGGGCCTGTGG - Intronic
1049756178 8:144312191-144312213 CAGGGGTGGAGGTGGGCGGGGGG - Exonic
1049865607 8:144933693-144933715 CAGAGGTAGAGGTGGGGTCTAGG - Intronic
1051288510 9:15521434-15521456 CACAGGGGGAGGTGGGATGGAGG - Intergenic
1051608057 9:18935922-18935944 CAGGGGTGGGGATGGGGTGATGG + Intronic
1051704370 9:19860821-19860843 CCGAGGTGGCAGTGGCCTGAAGG + Intergenic
1051896941 9:21996683-21996705 CAGAGGCGGAGGCCGGCTGAAGG - Intronic
1052546384 9:29886022-29886044 CAGAGGCTGAGGTGGGAAGATGG + Intergenic
1052878443 9:33584863-33584885 CAGAGGAGTAGGTTGGCTGTAGG + Intergenic
1053062702 9:35044311-35044333 AAGAGCTGGGGGTGGGCTGAGGG - Exonic
1053072580 9:35110033-35110055 CAGAGGTGGGGGTGGGGAGCAGG + Exonic
1053152140 9:35749842-35749864 CAGAAGTGGCCGTGGGCGGAAGG - Exonic
1053235063 9:36446106-36446128 CAGAGGTTCAGGTGTGCTCATGG - Intronic
1054464325 9:65484402-65484424 GAGAGGCTGAGGTGGGCGGATGG - Intergenic
1055026077 9:71723032-71723054 CAGGGGAGGAGGTGGGAGGAAGG + Intronic
1055075846 9:72214360-72214382 CAGAGGTTGCAGTGAGCTGAAGG - Intronic
1055471169 9:76612563-76612585 CAAAAGTGGAGGTGGGCTGTGGG + Exonic
1055841753 9:80513595-80513617 CAGAGGTGGGGGTGGGAGGAAGG - Intergenic
1056067314 9:82950051-82950073 CAGAGGTGGAGGTGGCAAGAAGG - Intergenic
1056455004 9:86751618-86751640 CAGTGGTGGCGGTGGGATGGTGG - Intergenic
1056744948 9:89292664-89292686 GAGAGGCTGAGGTGGGCGGATGG - Intergenic
1057143864 9:92745536-92745558 CAAAGCTGGAGGGGTGCTGACGG - Intronic
1057373748 9:94498816-94498838 GAGAGGCTGAGGTGGGCTGATGG + Intergenic
1057951775 9:99374637-99374659 CTGAGGTATAGATGGGCTGAGGG - Intergenic
1058570685 9:106339775-106339797 AAGGGGTGGGGGTGGGATGAAGG - Intergenic
1058688035 9:107495039-107495061 GAGAGGTCGAGGTGGGTGGATGG - Intergenic
1058928460 9:109692899-109692921 GAGAGATGGAGGTGGGGGGAAGG - Intronic
1059154490 9:111977758-111977780 CAGAAGTTGAGATGGGCTGGTGG - Intergenic
1060118790 9:120968247-120968269 CAGAGAAGGAGGTGTGATGATGG + Intronic
1060284434 9:122236439-122236461 AAGTGGTGGGGGTGGGCAGAAGG + Intergenic
1060407608 9:123380657-123380679 CAGAGCTGGATGAGGGCTGGGGG + Exonic
1060431175 9:123552519-123552541 GGGAGGTGGAGGTGGGGTCATGG - Intronic
1060479441 9:124009336-124009358 CAGCGTTGGACGTGGGCTGCTGG + Intronic
1061151648 9:128831934-128831956 CAGAGATGGAGGGGGCCCGATGG + Intergenic
1061681894 9:132246653-132246675 CAGAGGCTGAGGTGGGATGATGG - Intergenic
1061852523 9:133424356-133424378 CAGAGGCAGAGGCGGGCTGCAGG + Exonic
1061903175 9:133683410-133683432 CAGAAGGGGAGGGGGGCTGCGGG - Intronic
1061905542 9:133694807-133694829 CAGATGGGAAGGTGGGCAGATGG + Intronic
1062086543 9:134652086-134652108 CCGCGGTCGAGGTGGGGTGAAGG + Intronic
1062308311 9:135921878-135921900 CAGAGCAGGAGGTGAGCTGGGGG - Intergenic
1062330252 9:136038783-136038805 CAATTGAGGAGGTGGGCTGAGGG + Intronic
1062345946 9:136115374-136115396 CACAGGGGCAGGTGGGCTGGAGG - Exonic
1062475393 9:136724210-136724232 CAGAGGTGTGTGTGGGTTGAAGG - Intergenic
1062490719 9:136803677-136803699 CAGTGCTTGAGCTGGGCTGAGGG + Intronic
1062522053 9:136961971-136961993 CAGGGGGACAGGTGGGCTGAGGG + Intergenic
1062712687 9:137985392-137985414 CAGACCTGGAGGTGGGGTAAAGG - Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1062753457 9:138273575-138273597 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1203575968 Un_KI270745v1:8354-8376 CAGAGCTGGAGGTGAGCAGCAGG + Intergenic
1185667088 X:1774500-1774522 CAGAGCAGGAGGTGGGCAGCAGG - Intergenic
1185873969 X:3687122-3687144 GGGAGGCTGAGGTGGGCTGATGG - Intronic
1186144472 X:6611076-6611098 CAGAGGTGGGGCTGGGATGCAGG + Intergenic
1186156718 X:6733406-6733428 TAGAGGTGGAGGAGGCCTGATGG + Intergenic
1186488342 X:9951483-9951505 CAGAGGTGGGGGTGTGCACAGGG + Intergenic
1186512992 X:10144648-10144670 AAGAGGAGGAGGTGGGCTGGAGG - Intergenic
1186821416 X:13291555-13291577 GGGAGGTTGAGGTGGGCAGATGG + Intergenic
1186867266 X:13733106-13733128 CAAAGGTGGAGGTGGGAGTAAGG + Intronic
1187073937 X:15915371-15915393 GAGAGGCTGAGGTGGGCAGATGG - Intergenic
1187433846 X:19248905-19248927 CAGAGGTGGTGATGGGAGGAAGG - Intergenic
1187548875 X:20281507-20281529 AAGAGGTTGAGGTGGGAGGATGG - Intergenic
1188970357 X:36607535-36607557 CAGAGATGTAGGTGGGATTAAGG - Intergenic
1189052555 X:37661865-37661887 CACCTGTGGAGGTGGGTTGAAGG - Intronic
1189227221 X:39422961-39422983 CAGTGGTGGAGGTGGAAAGAAGG - Intergenic
1189725436 X:43964070-43964092 CAGGGGTGGTGGGGGGGTGAGGG + Intronic
1189741633 X:44123358-44123380 GAGAGGTGGAGGTGGGCAGATGG - Intergenic
1189818421 X:44846821-44846843 CAGAGGTTGGGGTGGTTTGATGG - Intergenic
1190526283 X:51332554-51332576 CAGGGGAGGGCGTGGGCTGAGGG - Intronic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1190728436 X:53208047-53208069 CAAAGGGGAAGGTGGGGTGATGG + Intronic
1190786451 X:53655141-53655163 CAGAGGTAGAAGTGGGTTGCAGG + Intronic
1192056266 X:67776987-67777009 CAGAGGCCCAGGTAGGCTGAGGG + Intergenic
1192152366 X:68720176-68720198 CAGAGGATCAGGTGGGGTGAGGG - Intronic
1192339841 X:70254919-70254941 TAGAGGTGGAGGTTGGGAGAAGG + Intergenic
1193342404 X:80365021-80365043 CATAGGTGAAGCTAGGCTGAAGG - Intronic
1193901314 X:87181396-87181418 CAGAGGTAGACGTGGGATGTGGG - Intergenic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1195172875 X:102286142-102286164 CATCGGTGGAGGAGGGCTGCGGG + Intergenic
1195185991 X:102400953-102400975 CATCGGTGGAGGAGGGCTGCGGG - Intronic
1195732039 X:107977969-107977991 CTGGGGTGGGGGTGGGCTCAGGG - Intergenic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1198371918 X:135997653-135997675 GGGAGGCGGAGGTGGGCGGATGG - Intronic
1199654592 X:149981748-149981770 CAGAGGAAGAGGTGGGGTGTGGG - Intergenic
1200177421 X:154126556-154126578 CAGTGGTGGCTGTGGGGTGAGGG + Intergenic
1200328870 X:155273307-155273329 CAGAAGTGGGGGAGGGCTGGAGG + Intergenic
1201550670 Y:15213548-15213570 TAGAGGTGGAGGAGGCCTGATGG + Intergenic