ID: 1165831029

View in Genome Browser
Species Human (GRCh38)
Location 19:38730374-38730396
Sequence GTGGAGGTGGGCTGATGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 523}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831016_1165831029 19 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831029 19:38730374-38730396 GTGGAGGTGGGCTGATGGCCTGG 0: 1
1: 0
2: 5
3: 57
4: 523
1165831013_1165831029 22 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831029 19:38730374-38730396 GTGGAGGTGGGCTGATGGCCTGG 0: 1
1: 0
2: 5
3: 57
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831029 Original CRISPR GTGGAGGTGGGCTGATGGCC TGG Exonic
900132912 1:1096822-1096844 GCTGAGGTGGGAGGATGGCCTGG - Intronic
900188427 1:1343445-1343467 GTGCAGGTGGCCTGATGCCCTGG - Intronic
900319654 1:2076267-2076289 AGGGAGGTGGGGAGATGGCCAGG - Intronic
900338133 1:2174877-2174899 GTGTTGGTGGGCAGAGGGCCAGG + Intronic
900401548 1:2474859-2474881 CAGGAGGTGGCCTGAGGGCCTGG - Intronic
900411817 1:2516012-2516034 GTGGAGGAGGGGTGATGGGAGGG - Intronic
900498517 1:2987969-2987991 GTGGAGGTGGGCTGGCGGTGGGG - Intergenic
900646129 1:3709497-3709519 GTGGTGGTGGTGTGCTGGCCTGG + Intronic
901105183 1:6749929-6749951 GTTGAGGTGGGAGGATGGCTTGG - Intergenic
901542042 1:9924586-9924608 GTGGAGGTGGGCGGATCACAAGG - Intronic
902232263 1:15035654-15035676 GTAGAGATGGGCTTTTGGCCAGG - Intronic
902353695 1:15879902-15879924 GTCGAGGCGGGCGGATGGCGAGG - Intronic
902434302 1:16387603-16387625 GTGGAGTTTGGCTGCTTGCCTGG + Intronic
902887511 1:19416554-19416576 GTGGAGGTGGGCTGAGGTTGAGG - Intronic
903025772 1:20429073-20429095 GTGGGGGAGGGCTGATGGTCAGG - Intergenic
903801530 1:25972330-25972352 GTTGAGGTGGGAGGATGGCTTGG - Intronic
903862636 1:26374176-26374198 GGGGAGGCGGGCTTGTGGCCTGG - Intronic
903929241 1:26852928-26852950 GGGGAGGTCGGCTGATATCCAGG - Intronic
905394685 1:37659622-37659644 GTGGAGGTGGGAGGACGGCTTGG - Intergenic
905613539 1:39376813-39376835 CTTGAGGTGGGCTGATTGCGTGG - Intronic
905626532 1:39493242-39493264 GTGGAGGGAGGCTGGTGGCTGGG - Intronic
905662005 1:39734904-39734926 GCCGAGGTGGGCGGATTGCCTGG - Intronic
905664287 1:39753195-39753217 GTGGAAGTGGGCAAATGGGCAGG + Intronic
905670362 1:39787214-39787236 GTGGAGGGAGGCTGATGGCCGGG + Intronic
905775972 1:40667349-40667371 GGGGAGGTGGGATGGAGGCCAGG + Intergenic
905864367 1:41368647-41368669 GTGGAGGTGGGAGGGGGGCCAGG + Intronic
906182362 1:43833198-43833220 GGGGAAGTGGGGTGATGGCCAGG - Intronic
906533876 1:46540679-46540701 GTGGAGATGAGCTGCTGCCCTGG + Intergenic
910792961 1:91070011-91070033 GCCGAGGTGGGCAGATGGCTTGG - Intergenic
911904749 1:103552525-103552547 GTGGAGGTGGGCGGATCACAAGG + Intronic
912740979 1:112197177-112197199 GTGGGGCTGGGGTGAGGGCCTGG + Intergenic
912777323 1:112513849-112513871 GTGGAGCTGGGCTGTTGAGCTGG + Intronic
913966855 1:143383736-143383758 GTGGAGATGCGCTGAGGGACTGG + Intergenic
914061231 1:144209343-144209365 GTGGAGATGCGCTGAGGGACTGG + Intergenic
914117919 1:144757026-144757048 GTGGAGATGCGCTGAGGGACTGG - Intergenic
914837237 1:151217679-151217701 GCTGAGGTGGGAAGATGGCCTGG - Intronic
914915013 1:151814322-151814344 GAGGAGGTAGGATGAAGGCCAGG + Intronic
915682525 1:157595454-157595476 GTGCAGGTGGCCCTATGGCCAGG + Intronic
917838277 1:178957892-178957914 CTGGAGCTGGGCTCATGTCCTGG + Intergenic
917943412 1:179945965-179945987 GTGGAGGTGGAAGGATGGCTTGG + Intergenic
918097077 1:181344669-181344691 GTGGAGGTGGGCTGTTAGGCAGG - Intergenic
918121805 1:181546963-181546985 GAGGATGTAGGCTGGTGGCCAGG - Intronic
919870482 1:201817146-201817168 GTCTTGTTGGGCTGATGGCCAGG - Exonic
919912205 1:202118620-202118642 GTGGAGGTGGGCGGATCACGAGG - Intergenic
920022983 1:202969416-202969438 GTGGGAAGGGGCTGATGGCCTGG + Intergenic
921262207 1:213394431-213394453 GTGGAGGTGGGGTGAGGGGTAGG - Intergenic
921488389 1:215743592-215743614 GTTGAGGTGGGCTGATCACAAGG + Intronic
922987073 1:229874154-229874176 GTGGGGGTGGCCTGATGGGAAGG + Intergenic
923587859 1:235291160-235291182 GCGGAGGTGGGCAGATCACCAGG + Intronic
923755255 1:236785812-236785834 GTGGAAGGGGGCTGATGCCCAGG + Intergenic
923928348 1:238662054-238662076 GTAGAGATGGGTTGTTGGCCAGG - Intergenic
1063163705 10:3440533-3440555 GTGGAGGTGGGCGGATCACGAGG + Intergenic
1063603330 10:7501263-7501285 GTGGAGCTGTGCTGGTGGACTGG + Intergenic
1063958453 10:11286195-11286217 ATGGAGCTGTGTTGATGGCCTGG - Intronic
1064001576 10:11667963-11667985 GAGGAAGTGGGCTGGTGGCTGGG + Intergenic
1064269093 10:13849166-13849188 CAGGAGGTGGCCTGGTGGCCTGG + Intronic
1064818950 10:19301716-19301738 GTGGAGGTGGGAGGAGGGCGAGG + Intronic
1065911722 10:30312344-30312366 GTTGAGGTGGGCTGATCACGAGG + Exonic
1067084517 10:43230729-43230751 GTGGAGGTGGGGTGAGGGTATGG - Intronic
1067204489 10:44201337-44201359 GCCGAGGTGGGCGGATTGCCTGG + Intergenic
1067343137 10:45419943-45419965 GAGGAGGGGGCCTGCTGGCCTGG + Intronic
1067549669 10:47225613-47225635 ATGGGGGTGTGCAGATGGCCAGG - Intergenic
1069606297 10:69740833-69740855 GTGGAGGTGGGTGCATGGCTAGG - Intergenic
1069752354 10:70752577-70752599 CTGGTGGAGGGCTCATGGCCAGG + Intronic
1070169769 10:73924115-73924137 GTGGAGAGAGGCTGATGGCAGGG - Intergenic
1070239784 10:74667765-74667787 GTGGAGGTGGGCAGATCACGAGG - Intronic
1070930368 10:80256707-80256729 GTGGAGGGGGGCAGATGGCCTGG + Intergenic
1071507474 10:86241351-86241373 GTGGAGGGGTCCTGATGGCCAGG - Intronic
1072188549 10:93063152-93063174 GTGGCGGTGGGCTCTGGGCCTGG + Intronic
1072608812 10:97003489-97003511 GCGGAGCTGGGCTGAGGCCCAGG + Intronic
1072676772 10:97472707-97472729 GTGGAGGTGGGAGGATGGCTTGG - Intronic
1073116413 10:101094241-101094263 GGGGAGGTGGGCTGACAGCTGGG - Intronic
1073274210 10:102294608-102294630 GCCGAGGTGGGCAGATGGTCAGG - Intronic
1074782383 10:116811367-116811389 GCGGAGGTGGCCTGGGGGCCAGG - Intergenic
1075560371 10:123463836-123463858 CTGGAGGCAGGCAGATGGCCTGG + Intergenic
1075576712 10:123582957-123582979 GGGTAGGTGGGTTGTTGGCCAGG - Intergenic
1075900542 10:126039666-126039688 GGGTAGGTGGGGTGATGGTCTGG + Intronic
1075941347 10:126392894-126392916 GTCGAGGTGGGCGGATCGCGAGG + Intergenic
1076518867 10:131067028-131067050 GTGGAGGTGGGCAGATCACGAGG - Intergenic
1076573161 10:131445756-131445778 GTGCAGGTGGGCGGGTGCCCTGG + Intergenic
1077042204 11:529826-529848 CTGGAGCTGTGCTGATGGGCAGG - Intergenic
1077061793 11:620811-620833 GGGGAGGTGGGCTGGGGCCCTGG - Intronic
1077241300 11:1511855-1511877 GTGGAGATGGGCTGGGGGGCTGG + Intergenic
1077288817 11:1779451-1779473 GTGGAGGTGAGCTGCAGCCCTGG + Intergenic
1077461685 11:2714018-2714040 GTGGGGGAGGGCTGCAGGCCTGG - Intronic
1077985765 11:7349502-7349524 GTTGAGGTGGGCTGCGGGCAGGG + Intronic
1078081652 11:8208662-8208684 GTGGAGGTGGGCAGATCACAAGG - Intergenic
1078316102 11:10294288-10294310 GTGGAGGTGGGCTCGCCGCCCGG - Intergenic
1078594798 11:12676266-12676288 GTTCAGGTGGTCTGATGGCTTGG + Intronic
1079830898 11:25266543-25266565 GTGGGGGTGGGCTGTGGGGCGGG - Intergenic
1080330305 11:31129763-31129785 GTGGAGGTGACCTAATGGCATGG - Intronic
1080652165 11:34231443-34231465 GTGGACGTGGCCTGAGGGGCGGG + Intronic
1081199365 11:40198076-40198098 GTGGAGATGGGGTGAGAGCCAGG + Intronic
1081338810 11:41902470-41902492 GTGGTGGTTGGCAGATGGCAAGG + Intergenic
1081670356 11:44938998-44939020 CTGGTGGGGGGCTGATGGCCGGG - Intronic
1081798561 11:45840475-45840497 GCCGAGGTGGGCAGATCGCCAGG - Intergenic
1081856929 11:46309915-46309937 GAGGAGGTGGGTAGATGGCATGG + Intronic
1081861589 11:46336110-46336132 GCGGAAGCGGGCTGAAGGCCTGG + Intronic
1082784331 11:57308679-57308701 GTGGAGTGGGGCAGATGGACTGG - Exonic
1083224184 11:61274203-61274225 GCCTAGGTGGGTTGATGGCCGGG - Intronic
1083320863 11:61845556-61845578 GCGGAGGTGGGCGGATCACCTGG + Intronic
1083476117 11:62916766-62916788 GTGGAGGTGGGATTCTGACCCGG + Intronic
1083594357 11:63911908-63911930 GTGGGTGGGGGCTGAGGGCCAGG + Exonic
1083648538 11:64186629-64186651 GTGGAGGTGGGCCGGGGGCCGGG + Intronic
1084276298 11:68052687-68052709 GTGGAGGAGGGCTGATGATGGGG + Intergenic
1084318277 11:68358490-68358512 GTTGGGGAGGGCTTATGGCCCGG + Intronic
1084451132 11:69239454-69239476 CTGGAGGTGGGTGGATGGCGAGG + Intergenic
1084532689 11:69738074-69738096 GGGGAGGTGGGGTGGTGGCCTGG + Intergenic
1084657301 11:70527068-70527090 GTGGAGGAGGCCTGGAGGCCAGG - Intronic
1084682362 11:70673776-70673798 GTGGAGGGAGGTTGGTGGCCAGG - Intronic
1084765993 11:71308838-71308860 GTGGAGGTGGGCTGATCTCGAGG + Intergenic
1084958630 11:72704436-72704458 GGGAAAGTGGGCAGATGGCCTGG - Intronic
1086462311 11:87018017-87018039 GTGAAGGTGGGGTGATGGTGGGG + Intergenic
1087097026 11:94328897-94328919 CTGGAGGTGGCCTGATGCCAAGG + Intergenic
1088743581 11:112786360-112786382 GAGAAGGTGGGATGTTGGCCCGG - Intergenic
1088796941 11:113272850-113272872 GAGGAGGAGGGCTGAAGCCCAGG - Intronic
1089073348 11:115717748-115717770 GTTGAGGGGGGCTGAAGGCGAGG - Intergenic
1089146849 11:116335492-116335514 GTGGGAGTGGTCTGATGTCCTGG + Intergenic
1090228709 11:125086758-125086780 GTGCTGGTGGTCTGATGGTCGGG + Intronic
1090666543 11:128918412-128918434 GTGGAGGGGGGCAGATTGTCAGG + Exonic
1091058209 11:132438629-132438651 GTGGAGATGGGCTGGTGTCCAGG + Intronic
1091205583 11:133818657-133818679 GTGGTGGTGGGGTGTTGCCCTGG - Intergenic
1091589822 12:1836452-1836474 GGTGAGGTGGGCTGGGGGCCTGG + Exonic
1091746506 12:2996212-2996234 GTGGGGGTGGGCAGCTGGTCTGG - Intronic
1091794793 12:3291919-3291941 GTGGAGGTGAGTAGATGTCCAGG + Intergenic
1092138672 12:6167668-6167690 GTGGATGTGGGCTGGTGTTCGGG - Intergenic
1092476336 12:8822143-8822165 GTTGAGGTGGGCAGATCACCAGG - Intergenic
1093454324 12:19349876-19349898 GTGGAGGCGGGCAGATCGCAAGG + Intronic
1094783293 12:33818029-33818051 GTGGTGGTGGGGTGCTGGCAAGG + Intergenic
1095880577 12:47131899-47131921 GTGGAGGTGGGCGGATCACGAGG - Intronic
1096197467 12:49657886-49657908 CTGGAGGTAGGCGGATGGACTGG - Intronic
1096386444 12:51197923-51197945 CTGGGGCTGGGCTGGTGGCCGGG + Exonic
1098913855 12:76237519-76237541 GTGGAGGTGGGAGGATCGCTTGG - Intergenic
1099088048 12:78271530-78271552 GTGGAGGTGGGCGGATCACAAGG - Intergenic
1101489840 12:105200458-105200480 GGGTAAGTGGGCGGATGGCCTGG + Intronic
1103442567 12:120974191-120974213 GACGAGGTGGGCAGATGGCTTGG + Intergenic
1103515981 12:121508674-121508696 GTGGAGCTGGGATGAGGACCCGG - Intronic
1103931727 12:124454154-124454176 GTGGAGGTGTGCTGAGCCCCTGG - Intronic
1104548710 12:129735959-129735981 GTGGAGGTGGGCAGGTGTGCTGG - Intronic
1104844217 12:131838736-131838758 GTGGAGGTGGGTGTGTGGCCAGG + Exonic
1104844231 12:131838777-131838799 GTGGAGGTGGGCGCGTGGCCAGG + Intronic
1104844244 12:131838818-131838840 GTGGAGGTGGGCGCGTGGCCAGG + Intronic
1104844271 12:131838900-131838922 GTGGAGGTGGGCGCGTGGCCAGG + Intronic
1105253810 13:18726270-18726292 GCGGAGGTGGGCTGATCACGAGG - Intergenic
1105264955 13:18807823-18807845 CTGGGGGTGGGCTCAGGGCCAGG + Intergenic
1105654878 13:22425487-22425509 ATGGAGGTGGCCTGCTGGCTTGG + Intergenic
1106140119 13:27005076-27005098 GAGGAGGTGGGGTGATGGGGAGG - Intergenic
1107857359 13:44629346-44629368 GTTGAGGTGGGCAGATGACAAGG - Intergenic
1108447927 13:50527863-50527885 TAGGAGGAGGTCTGATGGCCGGG + Intronic
1108591252 13:51914744-51914766 GTAGATGTGGGCTGGTGCCCAGG - Intergenic
1108834809 13:54530016-54530038 GTGGAGGTGGGCGGATCACAAGG + Intergenic
1109416951 13:62052351-62052373 GTGGAGGGGGGCTGCTGGGAAGG + Intergenic
1109781924 13:67122538-67122560 GTCGAGGTGGGCGGATGACGAGG + Intronic
1111030567 13:82592279-82592301 GTGGAGGTGGGATGATTCTCAGG - Intergenic
1111123485 13:83882340-83882362 GTGGAGGGGGGCGGAGGGCGGGG + Exonic
1112399263 13:99061673-99061695 GTGGGGGTGGGGAGAGGGCCAGG - Intronic
1113469020 13:110531271-110531293 TTTGAGGTGGGCTGCTGGGCAGG + Intronic
1113567088 13:111325579-111325601 GTGGAGGAGGGTGGAGGGCCGGG + Intronic
1113578825 13:111414010-111414032 GTGGAGCTGGGAAGAGGGCCTGG - Intergenic
1113610526 13:111641852-111641874 CTGGAGGTGAGCAGCTGGCCAGG - Intronic
1113711257 13:112466856-112466878 GTGGCGCTGGGCTGGTGTCCTGG - Intergenic
1113884623 13:113652119-113652141 GGGGAAGGGGGCTGAAGGCCCGG - Intronic
1118771581 14:68946177-68946199 GGTGAGGTGGGCTGGTGGGCTGG - Intronic
1119090043 14:71772944-71772966 CTGAGGGTGGGCTGTTGGCCTGG - Intergenic
1121600127 14:95197147-95197169 GTGGAGGTGGGAGGATTGCTTGG + Intronic
1121725048 14:96141242-96141264 GTGGAGGAAGGCGGATGTCCTGG + Intergenic
1122486710 14:102086940-102086962 GTGGAGGTGGACTGGGGACCGGG - Intronic
1202833509 14_GL000009v2_random:60291-60313 CTGGGGGTGGGCTCAGGGCCAGG - Intergenic
1124126343 15:26941184-26941206 GTGGAGGTTGGCTGGTGGCCAGG + Intronic
1124949397 15:34302714-34302736 GTGGAGGTGGGATGATTGCTTGG + Intronic
1125845259 15:42846371-42846393 GTAGAGACAGGCTGATGGCCAGG + Intronic
1126197895 15:45952254-45952276 GTCAAGGAGGGCTGATGGGCAGG - Intergenic
1126467425 15:48973477-48973499 CCGCAGGTGGGCTGAGGGCCAGG - Intergenic
1126783404 15:52157476-52157498 GTGGAGGTGGGTTGATCACGAGG - Intronic
1127014231 15:54665507-54665529 GTGGGGGTGGGGTGGAGGCCGGG + Intergenic
1127596908 15:60493999-60494021 ATGGGGGTGGGCTGAGGGTCAGG - Intronic
1128780575 15:70356302-70356324 GTGCAGCAGGGCAGATGGCCAGG - Intergenic
1129033991 15:72638921-72638943 GTGGAGGAGGGGTGTTGGGCTGG + Intergenic
1129159516 15:73739576-73739598 GTGGAGTCTGGCTGATGGCCAGG - Exonic
1129215891 15:74098295-74098317 GTGGAGGAGGGGTGTTGGGCTGG - Intergenic
1131226043 15:90624956-90624978 GGGGACGTGGACTGAGGGCCAGG + Intronic
1131510474 15:93047165-93047187 GAGGAGGAGGGCCGGTGGCCAGG + Intronic
1131860617 15:96649593-96649615 GGGGAGGAGGGATGATGGCAGGG - Intergenic
1132626597 16:894373-894395 GGACAGGTGGGCGGATGGCCAGG - Intronic
1133008364 16:2896931-2896953 TTGGAGGTCGGCGGATGCCCAGG - Intronic
1133170319 16:3978947-3978969 GTGGAGGTGGGCAGATCACAAGG - Intronic
1133317762 16:4894788-4894810 ATGGAGGTGGGTTGCTGGGCCGG - Intronic
1133517780 16:6526594-6526616 GTGGAGGTGGGCAGATCACGAGG + Intronic
1135573671 16:23568390-23568412 GCTGAGGTGGGCGGATCGCCAGG - Intronic
1135792329 16:25408587-25408609 ATGGAGCAGGGTTGATGGCCAGG - Intergenic
1136341644 16:29647902-29647924 GCCGAGGTGGGCTGATCACCTGG - Intergenic
1136459935 16:30403807-30403829 GTAGAGATGGGGTGTTGGCCAGG + Intergenic
1138350869 16:56345596-56345618 GTGGACTTGGGCTGATGGGGTGG - Exonic
1138600074 16:58048924-58048946 GGGGAGGAAGGCTGATGGGCAGG - Intergenic
1138680716 16:58681920-58681942 GTCGAGGTGGGCAGATCACCTGG + Intronic
1139249918 16:65485505-65485527 AGGGTGGTGGGCTCATGGCCTGG - Intergenic
1139372814 16:66479303-66479325 GTGGAGGTGCACAGATGCCCTGG + Intronic
1139469838 16:67172201-67172223 GTGGGGGTGGGCTGAGGGCATGG + Intronic
1140222710 16:73055748-73055770 GTGGAGCTGGTCCCATGGCCTGG - Intronic
1140833534 16:78772923-78772945 GTGGAGGTGGGAGGATTGCTTGG + Intronic
1141993489 16:87623006-87623028 GTGGAGGTCGGCTGTGGGCAGGG + Intronic
1142404333 16:89878873-89878895 GCAGAGGTGGGCAGATGGCGAGG - Intronic
1142411954 16:89921426-89921448 GTGCAGGTGGGCTGGGGGCTGGG + Intronic
1142428120 16:90011461-90011483 GTGGTTGTGGGCAGGTGGCCTGG + Intronic
1142492934 17:290287-290309 GAGGAGGTGGGGTGGTGGCCAGG + Intronic
1142800955 17:2345360-2345382 GTGGAGGTGGGCGGATCACGAGG + Intronic
1143019235 17:3908076-3908098 GTGGAGGTGGGCTGAGTCCTGGG - Intronic
1143103069 17:4514658-4514680 GAGGCGTTGGGCTCATGGCCTGG - Intronic
1143257475 17:5572523-5572545 GTAGAGATGGTCTGTTGGCCAGG - Intronic
1143448640 17:7022975-7022997 GTGGAGGTGGGGTGAACGCCTGG - Intergenic
1143612231 17:8025413-8025435 GTGGAGGTGGGCCAGAGGCCTGG + Intergenic
1144520971 17:15951970-15951992 CTGGAGGTGGCCTGGTGCCCTGG + Intronic
1145102008 17:20085243-20085265 GTGGAGGTGGCTTCATGGCATGG + Intronic
1145796537 17:27658781-27658803 GTGGGGGTGTGGTGATGTCCAGG + Intergenic
1146194783 17:30802352-30802374 GTGGAGGTGGGCGGATCATCAGG - Intronic
1146326281 17:31888835-31888857 GTGGAGGCGGGCGGATGACCAGG + Intronic
1146389884 17:32412151-32412173 GTTGAGGTGGGCTGATCACGAGG + Intergenic
1146940672 17:36842389-36842411 CTGGAAGGGGGCTGTTGGCCAGG - Intergenic
1147167681 17:38602133-38602155 GGGGAGGTGGGCAGAGGGGCAGG - Intronic
1147427776 17:40354501-40354523 GCGGAGGTGGGCAGGGGGCCTGG + Exonic
1147559297 17:41499174-41499196 GAGGAAGGGGGCAGATGGCCAGG + Intergenic
1147846364 17:43406855-43406877 GCGGAGGTGGGCAGATGGTGAGG + Intergenic
1148024431 17:44576485-44576507 GCTGAGGTGGGAGGATGGCCTGG + Intergenic
1148845766 17:50528911-50528933 GTGGAGGTGGGCATGTGCCCAGG + Intronic
1150057326 17:62030281-62030303 GGGGAGGTGGGCTGAGGGCAAGG + Intronic
1150682369 17:67294023-67294045 GTCGAGGTGGGCGGATCACCTGG + Intergenic
1150968416 17:69998538-69998560 GTCGAGGTGGGCAGATGACGAGG - Intergenic
1151368379 17:73631519-73631541 GGGCAGGTGGGCTGCCGGCCAGG + Intronic
1151685883 17:75646371-75646393 GGTGAGGCGGCCTGATGGCCTGG + Intronic
1151984297 17:77532168-77532190 GTGGAGGTGGGCAGGAGGCAAGG + Intergenic
1152019127 17:77771363-77771385 GTGAAGGTGGAATGATGCCCTGG + Intergenic
1152344566 17:79743214-79743236 GTGCAGGTGGGTGGCTGGCCTGG - Intergenic
1152758776 17:82097907-82097929 GAGTAGGTGGGCGGATGGCGGGG - Intronic
1152913664 17:83020607-83020629 GGGCAGGTGGGCTGGTGGCCTGG - Intronic
1153057683 18:963432-963454 CTGGAGTGGGGCTGGTGGCCTGG + Intergenic
1153459522 18:5318221-5318243 GTGAGGGTGGGCTGCTGGCTAGG - Intergenic
1154009772 18:10564761-10564783 GTGGAGATGGGCTGAGAGCCAGG - Intergenic
1154423438 18:14253720-14253742 CTGGGGGTGGGCTCAGGGCCAGG - Intergenic
1155079296 18:22391881-22391903 AAGGTGGTGGGTTGATGGCCTGG + Intergenic
1155246532 18:23915769-23915791 GTTGAGGTGGGCAGATCACCTGG + Intronic
1157134345 18:45039329-45039351 GTGGAGGTGGGCACAGGGGCTGG - Intronic
1157326321 18:46671438-46671460 GTGGAGGTGGGCAGAGGGCTGGG + Intronic
1158250900 18:55486355-55486377 GCTGAGGTGGGCAGATGGCTTGG + Intronic
1158601008 18:58855608-58855630 GTGGAGGCGGGCGGATCACCAGG - Intergenic
1158892822 18:61889037-61889059 CTGGGGTTGGGCTGAGGGCCAGG - Intronic
1159186512 18:64982893-64982915 CTGGAGTTAGGCTGCTGGCCTGG - Intergenic
1159916559 18:74193668-74193690 GTGGAGGGGGGATGATGGAGGGG - Intergenic
1160032466 18:75274338-75274360 GTGGAGGTGGGGTGATGGTGGGG + Intronic
1160654621 19:258153-258175 TTAGAGGTGGGGTCATGGCCAGG - Intergenic
1161167392 19:2795648-2795670 GTGGAGGTGGGAGGATTGCGTGG - Intronic
1161199888 19:3008812-3008834 GAGGAGGTGGGGGGCTGGCCCGG + Intronic
1161523087 19:4736711-4736733 CTGGAGGGGAGCTGAGGGCCAGG - Intergenic
1161607414 19:5222632-5222654 GTGGGGGTGGGCGCAAGGCCCGG + Intronic
1162128539 19:8511961-8511983 CTGGAGGTGGGCAGAGGGCTGGG + Intronic
1162907819 19:13833882-13833904 GTGGAGGTGGGTGGAGAGCCCGG + Intergenic
1163349748 19:16768917-16768939 CTGGCCCTGGGCTGATGGCCAGG - Intronic
1163360498 19:16842986-16843008 ATGCAGGTGGGCTGGTGGCGAGG + Intronic
1163438610 19:17310128-17310150 GTGGAGGTGGGGTCAGGGCCCGG - Intronic
1163699890 19:18781804-18781826 CTGGGGGTGGGGTGCTGGCCAGG - Exonic
1164778058 19:30869744-30869766 GTAGAGGTGGGCTGTTTTCCAGG + Intergenic
1164862434 19:31572785-31572807 GGAGAGGTGGGCTGCTGGCCCGG - Intergenic
1165165290 19:33849666-33849688 GCAGAGGTGGGCTGATCCCCAGG - Intergenic
1165593127 19:36988186-36988208 GTGGAGGTGGGAGGATCGCTTGG - Intronic
1165831029 19:38730374-38730396 GTGGAGGTGGGCTGATGGCCTGG + Exonic
1165845070 19:38812846-38812868 TTGTAGGTGGGCTGGTAGCCCGG + Exonic
1165870127 19:38965874-38965896 GCTGAGGTGGGCAGATTGCCTGG - Intronic
1166229201 19:41415879-41415901 GTGGAGGAGGGCGGATCGCAAGG - Intronic
1166415089 19:42589408-42589430 GTGGATTTGGGCTGGTGGCCTGG + Intronic
1166679058 19:44756499-44756521 ATGGAGGAGGGCTGCGGGCCTGG + Intronic
1166872467 19:45879225-45879247 GTGGAGGTGGGCGGGCGGCAGGG - Intergenic
1166884907 19:45954396-45954418 CTGGGGGTGGGCTGAGGACCCGG - Intronic
1167368530 19:49066941-49066963 GGGGAAGAGGGCAGATGGCCGGG - Intergenic
1202639161 1_KI270706v1_random:67404-67426 CTGGGGGTGGGCTCAGGGCCAGG + Intergenic
1202700639 1_KI270712v1_random:161231-161253 GTGGAGATGCGCTGAGGGACTGG + Intergenic
925856632 2:8135186-8135208 GTGGAGCCGGGCTTATGGCACGG - Intergenic
926209167 2:10856215-10856237 GTGGAGGTGGGGTGGGGGCCGGG + Intergenic
926322290 2:11757386-11757408 GGGGAGGTGGGTTGATTGGCTGG + Intronic
926341628 2:11909151-11909173 CTGCAGGTGGGCTTAGGGCCAGG - Intergenic
926539137 2:14153034-14153056 GTGGAAGTGGGCTTATAGCAAGG - Intergenic
927152199 2:20202659-20202681 GGGGAGGTGGCCTGGTGGCAGGG + Exonic
927922213 2:26981782-26981804 GTGGAGGAGGGCTGCTGGCTGGG - Intronic
928128344 2:28631237-28631259 GTGGAGGTGGGGAGATGGAAGGG - Intronic
929271871 2:39981522-39981544 GTGGAGCTGGTCTTATGGTCAGG + Intergenic
929703619 2:44187982-44188004 GCCGAGGTGGGCAGATGGCGAGG - Intronic
929777869 2:44939635-44939657 GTGGAGAAGGACTCATGGCCAGG + Intergenic
930641790 2:53860307-53860329 GAGGAGGTGGGCTGCGGGCAGGG - Intergenic
931353583 2:61514356-61514378 GCTGAGGTGGGCTGATTACCAGG + Intronic
932198940 2:69808894-69808916 GCGGAGGTGGGCAGATTGCTTGG - Intronic
933333892 2:80929472-80929494 GCCGAGGTGGGCAGATTGCCTGG + Intergenic
933433581 2:82215449-82215471 CTGGAGGAGCACTGATGGCCAGG + Intergenic
933793791 2:85904192-85904214 TTGGGGGTGGACTGATGGCCTGG + Intergenic
933997314 2:87679389-87679411 GTGGAGGTGGGCACATGACAGGG + Intergenic
934171567 2:89544703-89544725 GTGGAGATGCGCTGAGGGACTGG + Intergenic
934281875 2:91619021-91619043 GTGGAGATGCGCTGAGGGACTGG + Intergenic
934494640 2:94787033-94787055 CTGGGGGTGGGCTCAGGGCCAGG + Intergenic
934515213 2:94982005-94982027 GTGGAGGTGTGCTGGGGGCTTGG + Intergenic
935023694 2:99256147-99256169 GTGGAGGTGGTTTTATTGCCAGG - Intronic
935229660 2:101084630-101084652 GTGCAGGTGGGCAGAGGGCTAGG - Intronic
935550428 2:104447373-104447395 TAGGAGGTGGGGTGATGGACGGG + Intergenic
936076131 2:109402932-109402954 GTGGAGATGGGCTGCTTGCTGGG + Intronic
936296538 2:111271521-111271543 GTGGAGGTGGGCACATGACAGGG - Intergenic
936664759 2:114581415-114581437 GCCGAGGTGGGCTGATCACCAGG - Intronic
937397885 2:121554528-121554550 GTTGAGGTGGGAGGATGGCGTGG + Intronic
937425625 2:121796257-121796279 GTGAAGATTGGATGATGGCCGGG + Intergenic
938072482 2:128316019-128316041 GCGGAGGTGGGCTGCCAGCCTGG - Intronic
938229256 2:129644171-129644193 GCTGAGTTGGGCTGATGGCGAGG - Intergenic
938296996 2:130184625-130184647 GTGGAGAGGGGCTGAGGGACAGG + Intronic
938338386 2:130518927-130518949 GAGGAGAAGGGCTGATGGCCAGG - Intergenic
938351453 2:130601823-130601845 GAGGAGAAGGGCTGATGGCCAGG + Intergenic
939372099 2:141314555-141314577 GTGGAGGTGGGCGGGTCACCAGG + Intronic
939984239 2:148814326-148814348 GTGGAGGTGGGAGGATCACCTGG + Intergenic
940240875 2:151562032-151562054 GTGTCAGTGGGCTGATGGGCAGG - Intronic
940635759 2:156294639-156294661 GCTGAGGTGGGCGGATTGCCTGG - Intergenic
940774677 2:157874494-157874516 CTGGAGGTGGGTTGCTGGCCAGG - Intronic
941964128 2:171283803-171283825 GTGGAGGTGGGCAGATCACGAGG - Intergenic
943686734 2:190826093-190826115 GTGGAGGTGGGCAGATCACAAGG + Intergenic
944474177 2:200087050-200087072 GCGGAGGTGAGCAGATGGACCGG + Intergenic
946166912 2:217869926-217869948 GTGGAGGTGAGCTGAGGGCCAGG - Intronic
946310010 2:218878113-218878135 CTGGGGCTGGGCTGAGGGCCAGG + Intergenic
946320769 2:218953266-218953288 CTGCAGGTGGGCTGAGGGCTAGG + Intergenic
946663435 2:222025644-222025666 GTCGAGCTGGGCTGTTGCCCTGG - Intergenic
948408366 2:237739969-237739991 GGGGAGGTGGGCACATGGCCGGG + Intronic
948422095 2:237865850-237865872 GTGGAGGGAGGCAGATGGCAGGG + Intronic
948864061 2:240766556-240766578 GCACAGGTGGGCTGCTGGCCGGG - Intronic
948872529 2:240810781-240810803 GTGGAGGGGGTCTAAGGGCCTGG + Intronic
948963681 2:241359466-241359488 GGGGAGGTGGGGAGGTGGCCTGG - Intronic
1169359342 20:4934951-4934973 GTGGAGGTGGGCAGATCACAAGG + Intronic
1169698430 20:8418354-8418376 GTGGAGGTGGCCTGAAGGTTGGG - Intronic
1170565702 20:17602790-17602812 GTGGAGGTGGGCAGATCACGAGG + Intronic
1172316521 20:33959252-33959274 GTGGAGGTGGGCGGATCACAAGG + Intergenic
1172520083 20:35560523-35560545 GAAGAGGTAGGCTGCTGGCCGGG - Intergenic
1173201083 20:40955495-40955517 GAGGAGGTGGGCAGAGGACCTGG + Intergenic
1173201767 20:40959982-40960004 GTGGAGCTGGGCTGCTGACCAGG - Intergenic
1173247979 20:41349179-41349201 GTCCAGGTGGGCTGCAGGCCAGG + Intronic
1173762910 20:45579482-45579504 CTGTAGGAGGGCTGCTGGCCTGG - Intergenic
1174033573 20:47651161-47651183 TAGGAGGTGGGCTGAAGGCCTGG - Exonic
1174045249 20:47728489-47728511 ATGGGGGTGGGCTGCTGGCGGGG + Intronic
1174198389 20:48789562-48789584 GTGGGGGCTGGCTGATAGCCTGG - Intronic
1174398252 20:50261109-50261131 GTGGAGGCCGGCTGAGGGGCTGG - Intergenic
1174416325 20:50369660-50369682 GGCCAGGTGGGCTGAGGGCCTGG - Intergenic
1174570932 20:51500757-51500779 GTGGAGGTGGGGTGGTGGTGAGG - Intronic
1174754121 20:53141233-53141255 CTGGAGGCTGGCTGCTGGCCTGG - Intronic
1175199046 20:57265827-57265849 GTGGAGGAGGGCGGCGGGCCCGG - Exonic
1175325833 20:58127950-58127972 GTGGAGGTGGGCAGATTTCCAGG - Intergenic
1176139595 20:63539154-63539176 ATGGAGCTGGGCAGGTGGCCAGG + Intergenic
1176218312 20:63958506-63958528 GTGGGAGTGGGCTGAGGGCTCGG - Exonic
1176647484 21:9365013-9365035 CTGGGGGTGGGCTCAGGGCCAGG + Intergenic
1177179746 21:17732188-17732210 GTGGAGGTGGGCGGATCACGAGG - Intergenic
1178761008 21:35402979-35403001 GTGGAGATGGGGTGATGCCAAGG - Intronic
1179233234 21:39524097-39524119 GTGCAGGGAAGCTGATGGCCTGG - Intergenic
1179654181 21:42834928-42834950 GTGGAGGTGGGCAGGTGGTGTGG - Intergenic
1180362789 22:11914460-11914482 CTGGGGGTGGGCTCAGGGCCAGG - Intergenic
1180849764 22:19010574-19010596 GTGGAGGCGGGCGGATCGCAAGG - Intergenic
1181061229 22:20283042-20283064 GCGGATGAGGGCTGCTGGCCAGG - Intronic
1181125180 22:20697922-20697944 CTGGAGGCGGACAGATGGCCTGG - Intergenic
1181398272 22:22636171-22636193 CTGGAGGCGGACAGATGGCCTGG + Intergenic
1181501008 22:23315540-23315562 CTGGAGGCGGACAGATGGCCTGG + Exonic
1181651142 22:24259889-24259911 CTGGAGGCGGACAGATGGCCTGG - Intergenic
1181706238 22:24650850-24650872 CTGGAGGCGGACAGATGGCCTGG + Intergenic
1181934002 22:26427251-26427273 GTGGAGGTGGGCTCTGGGACAGG + Intergenic
1182507797 22:30797514-30797536 GCCGAGGTGGGCTGATCGCGAGG - Intronic
1183173368 22:36204250-36204272 GTGGAGGTGGGGAGGTGACCTGG - Intronic
1183519812 22:38290399-38290421 CTCCAGGTGTGCTGATGGCCTGG - Intergenic
1183663625 22:39235184-39235206 GTGCAGGGGGGCTGCTGACCAGG + Intronic
1184057683 22:42063261-42063283 AGGGGGGTGGGCAGATGGCCAGG + Intronic
1184127920 22:42500784-42500806 GTGGAGGAGGGCGGATGGAGTGG + Intergenic
1184236358 22:43185352-43185374 AGGCAGGAGGGCTGATGGCCAGG + Intronic
1184580442 22:45413269-45413291 GCTGAGGTGGGGTGATGGGCAGG + Intronic
1184641815 22:45876912-45876934 ATGGATGTGGGCTGCAGGCCAGG - Intergenic
1184671171 22:46012978-46013000 GTGGAGATGGGCACAAGGCCTGG - Intergenic
1184840675 22:47050788-47050810 GTGGAGGTGGGGGGATGGTGAGG + Intronic
1184856481 22:47149242-47149264 GTGGAGGTGAGCTCACGGCCCGG + Intronic
1184973351 22:48043398-48043420 GTGGGCATGGGCTGATGGCAAGG - Intergenic
1185004821 22:48269794-48269816 GAGGAGGCAGGCTGGTGGCCAGG - Intergenic
1185047090 22:48534001-48534023 CTGGAGCTGGGCTGATGACATGG + Intronic
1185066862 22:48636781-48636803 GTGGGTGTGGGCTGGTGCCCTGG + Intronic
1185345801 22:50310034-50310056 GTGGAGGGCAGCTGATGGCAGGG + Exonic
1185362633 22:50417771-50417793 GGTGTTGTGGGCTGATGGCCTGG + Intronic
949470970 3:4396180-4396202 GAGGAGCTGGGCTGAAGGCCAGG + Intronic
949748445 3:7323339-7323361 GTGGAGAGGGGCTGCTAGCCTGG - Intronic
950020914 3:9787131-9787153 GGGGAGGTGGGCTGAAGTTCTGG + Intronic
950256400 3:11510224-11510246 GTGCAGGTGGCCTGATGGGCGGG - Intronic
952301304 3:32106654-32106676 GCGGAGGTGGGCAGCCGGCCAGG + Exonic
953648497 3:44777457-44777479 GTGGAGGTGGGCGGATCACGAGG + Intronic
954067791 3:48120548-48120570 GTAGAGGTGAGCTGAGTGCCTGG - Intergenic
956745945 3:72311124-72311146 GTGGAGATGGGGTGGGGGCCTGG - Intergenic
957966272 3:87324827-87324849 CTGCAGGTGGGCTGAAGGCTAGG - Intergenic
959175549 3:102904839-102904861 GTGGAGGCGGGCTTGTCGCCAGG + Intergenic
959216687 3:103459228-103459250 GCAGAGGTGGGCTGATCGCGAGG - Intergenic
959992613 3:112645514-112645536 GTGGAGGTGGGCAGATCACGAGG - Intronic
960587501 3:119334089-119334111 CTGGAGGGGGACTGATGCCCAGG + Intronic
960811554 3:121631904-121631926 GTGGACGAGGGCTGGTGGCGGGG - Exonic
961037540 3:123652998-123653020 GTGGATGTGGGATGAGGGCTAGG + Intronic
961217291 3:125169605-125169627 GTGGAGGTGGGCAAAGGGGCTGG - Intronic
961393721 3:126571485-126571507 GTGGAGGAGGGCTGGTGGTGGGG + Intergenic
962359927 3:134730346-134730368 GTGGAAGTGGTCTGAAGGCATGG - Intronic
962426118 3:135270731-135270753 GTAGAGGTGGGCCGGTAGCCTGG - Intergenic
963988965 3:151630983-151631005 GTGGAGGTGGGGGGATAGACAGG + Intergenic
965266663 3:166552305-166552327 GTGGAGGTGGGCGGATCACAAGG + Intergenic
966381939 3:179353298-179353320 GTCGAGGTGGGCGGATTGCCTGG - Intronic
966793801 3:183695949-183695971 CTTGTGGTGGGCTGATGGCCAGG - Intergenic
966839451 3:184076783-184076805 AGGGAGGTGGCCTGCTGGCCTGG + Intergenic
967915076 3:194572606-194572628 GTGGAGGTGGGCAGAGGGGAAGG + Intergenic
967933342 3:194706647-194706669 GTCCAGGTGGGATGAAGGCCTGG + Intergenic
1202739395 3_GL000221v1_random:39974-39996 CTGGGGGTGGGCTCAGGGCCAGG - Intergenic
968521375 4:1036140-1036162 GTGGAGGAGGAGTGAGGGCCGGG - Intergenic
968641261 4:1716286-1716308 GGGGAGGGGGGATGTTGGCCAGG - Exonic
969028194 4:4191184-4191206 GTGGAGATGCGCTGATGGACTGG - Intronic
969327344 4:6451675-6451697 GTGGAGGTTTGGGGATGGCCAGG + Intronic
969371229 4:6732808-6732830 CTGGGCGTGGGCTGATGGCTGGG + Intergenic
969760133 4:9175525-9175547 GTGCCTGGGGGCTGATGGCCTGG - Exonic
970203432 4:13632418-13632440 GCCGAGGTGGGCGGATTGCCTGG - Intergenic
971237250 4:24854025-24854047 GGGGAGGCTGGCTGATGGACTGG - Intronic
972291737 4:37695998-37696020 GGGAAGGTGGGCTGATGGTGAGG - Intergenic
975259023 4:72274284-72274306 GACGAGGTGGGCTGGGGGCCAGG + Intergenic
975920461 4:79380334-79380356 GTGGGGGTGGGGTGATCCCCAGG - Intergenic
976313167 4:83632911-83632933 GTGCAGGTGGGTGGATGGGCAGG - Intergenic
976603868 4:86964306-86964328 GTAGAGATGGGGTGTTGGCCAGG + Intronic
980122206 4:128739455-128739477 ATCGAGGTGGGATGAGGGCCTGG + Intergenic
980137875 4:128877445-128877467 GTGGAGGTGGGCAGATCACGAGG + Intronic
980661741 4:135868990-135869012 GTGGAGGTGGGAGGATGGAGAGG + Intergenic
980773543 4:137409753-137409775 GTGGAGGTGGGCGGATCACGAGG - Intergenic
985246234 4:187982417-187982439 GTGGAGGTGGTGTGGTGGCTGGG + Intergenic
1202766511 4_GL000008v2_random:153274-153296 CTGGGGGTGGGCTCAGGGCCAGG + Intergenic
985607362 5:865210-865232 GCGGAGCTGGGATGCTGGCCTGG - Intronic
985880833 5:2637895-2637917 GTGGAGATGGACGGAGGGCCGGG - Intergenic
985958388 5:3281525-3281547 AAGGACGTGGGCTGATGACCAGG + Intergenic
986009378 5:3698523-3698545 GAGGAGCTGGGCTCAGGGCCGGG - Intergenic
986049543 5:4076177-4076199 GCTGAGGTGGGATGATGGCTTGG + Intergenic
986587135 5:9330154-9330176 GCCGAGGTGGGCGGATCGCCAGG + Intronic
987024446 5:13910217-13910239 GTGGAGTTGGGGTGAAAGCCAGG - Intronic
990828970 5:59935020-59935042 GTGGTTGTGGGCAGATGGCTTGG + Intronic
990900387 5:60743423-60743445 CTGAAGGTGGGCTGAGGGCTAGG + Intergenic
991066632 5:62431211-62431233 GTCGAGGTGGGCGGATCACCTGG - Intronic
992443889 5:76817913-76817935 GCGGAGGTGGGCTGATCACGAGG + Intergenic
992444770 5:76823672-76823694 GAGAAGTTGAGCTGATGGCCAGG - Intronic
992614428 5:78535270-78535292 GAGGAGGTGGGTGGAAGGCCAGG - Intronic
993141020 5:84033602-84033624 GTTGAGGTGGGAGGATGGTCTGG + Intronic
993457328 5:88141544-88141566 CTGGTGATTGGCTGATGGCCGGG + Intergenic
996814690 5:127562013-127562035 GTGAAGGTAGACTGATGGACAGG + Intergenic
997342838 5:133159189-133159211 GTGTAGTTGGTCTGATGGCCTGG + Intergenic
999758886 5:154685009-154685031 GTGGAGGTGGGCAGATCACAAGG + Intergenic
1000329662 5:160196805-160196827 GTCGAGGTGGGCAGATCACCAGG - Intronic
1000357643 5:160416126-160416148 GCCAAGGTGGGCAGATGGCCTGG - Intronic
1001055804 5:168448851-168448873 GTGGAGGTGGGCAGATCACGAGG - Intronic
1001528553 5:172446153-172446175 GAGGAGGGGTGCTGCTGGCCTGG - Intronic
1002144933 5:177172722-177172744 GTTGAGGTGGGAGGATGGCTTGG + Intronic
1002325879 5:178405213-178405235 GTGGAGGTGGCCTCAGAGCCGGG - Intronic
1002511395 5:179721014-179721036 GTTGAGGTGGGCGGATCGCGAGG - Intronic
1002691952 5:181055990-181056012 CTGGAGACGGGCTGAAGGCCAGG + Exonic
1002849643 6:982439-982461 GCGGAGGTGGGCGGATCACCTGG - Intergenic
1003172715 6:3732895-3732917 GTGGATGTGGGCTCTCGGCCGGG + Intronic
1003333374 6:5148027-5148049 GTGGGGGAGGGCAGGTGGCCTGG - Intronic
1003419012 6:5938953-5938975 GTGGAGGTGGGTGGATGGGGAGG - Intergenic
1003631341 6:7790416-7790438 GTTGAGGTGGGGGGATGACCTGG + Intronic
1003795807 6:9601595-9601617 GTAGAGGTGGGATGTTGCCCGGG + Intronic
1003876996 6:10446772-10446794 GCGGAGGTGGGAGGATGGCTTGG - Intergenic
1005813342 6:29532168-29532190 CTGGAGCTGGGCTGTGGGCCAGG - Intergenic
1006181224 6:32154500-32154522 GAGGAGGTGGCTTGATTGCCGGG + Intronic
1006927136 6:37663164-37663186 GAGGAGGTGGGCTGAAGGGATGG - Intronic
1007089527 6:39173476-39173498 CTGGAGGTGGGAGGATGGTCAGG + Intergenic
1007093579 6:39199752-39199774 GTGGAGCTGAGCTGATTCCCAGG - Intronic
1007166177 6:39830612-39830634 GGGGAGGTGGGCCCAAGGCCTGG - Intronic
1007646918 6:43389993-43390015 GGGGAGGTGGGCAGAGGGACCGG + Intergenic
1007836101 6:44674898-44674920 GAGGAGGTGGCCTGTTTGCCAGG - Intergenic
1007860085 6:44899451-44899473 GTGGAGGTGGGCAGATCACGAGG + Intronic
1007983307 6:46181261-46181283 GTGGGGAAGGGCTGAAGGCCAGG + Intergenic
1008429446 6:51398469-51398491 GGAGAGCTTGGCTGATGGCCAGG - Intergenic
1010843881 6:80680844-80680866 GAGGAGTTGGGTTGATGGCAGGG - Intergenic
1010999642 6:82573266-82573288 GTGGAGGTTGGAGGATGGGCAGG - Intergenic
1011243193 6:85294796-85294818 GTGGGAGTGGGCTGATAGCTGGG - Intergenic
1013194713 6:107834843-107834865 GCTGAGGTGGGCAGATCGCCAGG + Intergenic
1014935352 6:127379505-127379527 GTGGAGGTGGGCAGATCACGAGG - Intergenic
1017103467 6:150866966-150866988 GAGGAGGTGGTCCGCTGGCCGGG - Intronic
1018036331 6:159885311-159885333 GTCGAGGTGGGCAGATCACCAGG - Intergenic
1018442986 6:163830413-163830435 GTGGAGCTGGGTTGAGGGGCTGG + Intergenic
1018492768 6:164312651-164312673 GTTGAGGTGGGCAGATCACCAGG + Intergenic
1019382206 7:729651-729673 GTGGAAGTGGTCTGAGGGACAGG - Exonic
1019408982 7:898466-898488 GTGGAGGTGGGGGGAGGGCGGGG + Exonic
1019410479 7:904577-904599 CTGGAGGTGGGCTGGTGGCTGGG - Intronic
1019447434 7:1078732-1078754 GGGCAGGTGGGCACATGGCCTGG - Intronic
1019511002 7:1417269-1417291 GAGGAGTTGGGGTGGTGGCCAGG - Intergenic
1019580320 7:1758675-1758697 GTGGAGGCTGGCTGGTGTCCCGG + Intergenic
1019600309 7:1879962-1879984 GTCGAGGTGGGCGGATCACCAGG - Intronic
1019654996 7:2187566-2187588 GTTGAGGTGGGAGGATGGCTTGG - Intronic
1020061170 7:5153679-5153701 GTCGAGGTGGGCAGATCACCAGG - Intergenic
1020188229 7:5974716-5974738 GTGGAGCTGAGCTCATAGCCGGG - Intronic
1020294688 7:6750052-6750074 GTGGAGCTGAGCTCATAGCCGGG + Intergenic
1022423800 7:30248440-30248462 ATGGAGGTGGGAGGAGGGCCAGG - Intergenic
1023882257 7:44327012-44327034 GTGCAGGTGGGTCGATGGCAGGG - Intronic
1024046522 7:45589306-45589328 GTGGTGGTGTGCAGATGGCCCGG + Intronic
1024238043 7:47413184-47413206 GTGGAGGTGGGCTGATCACAAGG - Intronic
1025254305 7:57373086-57373108 GGCCAGGTGGGCTGAGGGCCTGG + Intergenic
1026107569 7:67433220-67433242 GAGGAGATGGGGTTATGGCCAGG - Intergenic
1026839461 7:73661525-73661547 GTGGAGGCGGGCAGATCGCTTGG - Intergenic
1027026829 7:74858749-74858771 GCTGAGGTGGGAGGATGGCCGGG + Intergenic
1027060923 7:75085360-75085382 GCTGAGGTGGGAGGATGGCCGGG - Intergenic
1027247005 7:76374204-76374226 ATGGATGTGGGCTGAAGCCCAGG + Intergenic
1027336726 7:77158750-77158772 GTGGAGGTGGGCGGATCACGAGG - Intronic
1028463708 7:91125052-91125074 GTTGAAGTGGGCTGATGGTCTGG + Intronic
1028889012 7:95966170-95966192 AAGGAGGTGGACTGATGGACAGG + Intronic
1029114969 7:98232078-98232100 GGGGAGCTGGGCTGACAGCCGGG - Intronic
1029584316 7:101460546-101460568 GTGGAGGTGGGCGGATCACGAGG + Intronic
1029779064 7:102712361-102712383 GTGGAGGTGGGCGGATCACGAGG + Intergenic
1029808725 7:103023978-103024000 GTGGAGGTGGGAGGATGGTGAGG + Intronic
1029978750 7:104858571-104858593 GTGGAGGTGTGCTGAAGGCTTGG - Intronic
1032675782 7:134128782-134128804 GCAGAGGTGGGCGGATGGCGAGG - Intronic
1032727960 7:134609673-134609695 GCGGAGGTGGGCTGATCACGAGG + Intergenic
1033628968 7:143138952-143138974 GTGGAGGTGGGCCTAGGGCAAGG - Intronic
1033975158 7:147091971-147091993 GTGGAGGTGGGCAGATCACGAGG - Intronic
1036409803 8:8488998-8489020 GTGGAGGTAGGGGGATGGCGAGG - Intergenic
1036637845 8:10564038-10564060 GAGGAGGGGTGCTGATTGCCAGG - Intergenic
1036705851 8:11046162-11046184 GTCGAGGTGGGCAGATTGCTTGG + Intronic
1038090440 8:24247294-24247316 GTGGAGGAGTGCTGATGGGTTGG - Intergenic
1038707332 8:29906987-29907009 TTGAAGGTGGGCTGATGAACAGG - Intergenic
1039445748 8:37630526-37630548 GTGGAGTTGTTCTTATGGCCAGG + Intergenic
1039914159 8:41847323-41847345 GTGCAGGTGGATTTATGGCCGGG + Intronic
1040778247 8:51073460-51073482 GCGGAGGTGGGAGGATTGCCTGG + Intergenic
1042694860 8:71545792-71545814 GTGGAGGTGGGCGGATTACGAGG - Intronic
1044692652 8:94895384-94895406 GTGGACGCGGGCAGAAGGCCCGG - Intronic
1047711203 8:127554208-127554230 GTAGAGGTGGGATGAAGGCTTGG - Intergenic
1048302851 8:133264461-133264483 GCCGAGAAGGGCTGATGGCCGGG - Intronic
1048654102 8:136516095-136516117 GTGCAGGTGGGAAGCTGGCCTGG - Intergenic
1048879259 8:138859442-138859464 GTGGAGGTGGGCTCCTGGAATGG + Intronic
1049300617 8:141867588-141867610 GGGGCGATGGGCTGCTGGCCAGG + Intergenic
1049440809 8:142608760-142608782 GTGGAGAGGGGCCGATGGCAGGG + Intergenic
1049472719 8:142783498-142783520 TGGGAGGGGGGCTGAGGGCCAGG + Intergenic
1050543180 9:6687582-6687604 GTTGAGGTGGGAGGATTGCCCGG - Intergenic
1052793907 9:32904492-32904514 CTGGAGGTGTGCTGGTGGCCAGG - Intergenic
1053624929 9:39859743-39859765 GTGGGGGTGGGGGGGTGGCCAGG + Intergenic
1053662483 9:40293338-40293360 CTGGAGGTGGGCTCAGAGCCAGG - Intronic
1053879941 9:42583485-42583507 GTGGGGGTGGGGGGGTGGCCAGG - Intergenic
1053912937 9:42923513-42923535 CTGGAGGTGGGCTCAGAGCCAGG - Intergenic
1054218968 9:62390955-62390977 GTGGGGGTGGGGGGGTGGCCAGG - Intergenic
1054231749 9:62518214-62518236 GTGGGGGTGGGGGGGTGGCCAGG + Intergenic
1054374612 9:64439563-64439585 CTGGAGGTGGGCTCAGAGCCAGG - Intergenic
1054522128 9:66082946-66082968 CTGGAGGTGGGCTCAGAGCCAGG + Intergenic
1055300492 9:74877598-74877620 GTGGAGGTGGGCTGTGGGCAGGG - Intronic
1055471172 9:76612568-76612590 GTGGAGGTGGGCTGTGGGAGGGG + Exonic
1055552581 9:77445104-77445126 CTAGAGGTGGCCTGATGGCGGGG + Intronic
1056037203 9:82619144-82619166 GTGGATGTGGTGTGAGGGCCTGG + Intergenic
1056455003 9:86751613-86751635 GTGGCGGTGGGATGGTGGCAAGG - Intergenic
1056505104 9:87250979-87251001 GTGGAGGTGGGCAGATTACTTGG + Intergenic
1056514651 9:87338501-87338523 GTGCAGGTGGGCTGACAGCATGG + Intergenic
1056575306 9:87851821-87851843 GTGGAGCTGAGCCCATGGCCTGG + Intergenic
1056759610 9:89405314-89405336 CTGCAGGGGTGCTGATGGCCTGG - Intronic
1056762405 9:89424830-89424852 GTGTAGGGGGACTGAAGGCCGGG - Intronic
1058237247 9:102504975-102504997 GCCGAGGTGGGCTGATCACCAGG - Intergenic
1058548770 9:106090280-106090302 GTGGAGGCAGGCTGATAGCTAGG - Intergenic
1059223035 9:112643941-112643963 GCGGAGGTGGGCAGATCACCTGG + Intronic
1059443763 9:114325477-114325499 GTGGAGGTGGGGTGAAAGCCTGG - Intronic
1059444964 9:114332254-114332276 GTGGAGGTGGGGTGAAAGCCTGG - Intronic
1059551680 9:115235544-115235566 GAGGAGGTGAGCTGATGGTGAGG - Intronic
1061302744 9:129715080-129715102 GTGGAGCTGGTCTCATTGCCGGG - Intronic
1061460939 9:130738062-130738084 GTGGAGGTGGGCGGATCACGAGG - Intronic
1062085029 9:134643918-134643940 GTGGAGGTGGGGAGATGGGCAGG - Intronic
1062373252 9:136251074-136251096 GTGGAGGAGGCCTGAGGCCCTGG + Intergenic
1062442251 9:136576073-136576095 GTGGAGGTGACCGGGTGGCCTGG + Intergenic
1203708038 Un_KI270742v1:69923-69945 CTGGGGGTGGGCTCAGGGCCAGG - Intergenic
1203547266 Un_KI270743v1:138152-138174 CTGGGGGTGGGCTCAGGGCCAGG + Intergenic
1186229355 X:7436796-7436818 GCTGAGGTGGGATGATTGCCTGG - Intergenic
1186485054 X:9927848-9927870 CTGGAGGTGGGGTGATGTCAGGG + Intronic
1186844013 X:13512975-13512997 GTGGGGGTGGGGTTATGGCTTGG + Intergenic
1186958440 X:14708700-14708722 GCCGAGGTGGGCGGATGGCCTGG + Intronic
1188526394 X:31092652-31092674 GTTGAGGCTGGCTGTTGGCCAGG - Intergenic
1189021923 X:37349837-37349859 GAGGCGGTGGGCTGTCGGCCCGG + Intronic
1189350360 X:40271200-40271222 TTGGAGATGGGCTGAGGCCCGGG + Intergenic
1189406867 X:40733220-40733242 GTGGAGGTGGGAGGATTGCTTGG - Intronic
1190407651 X:50103612-50103634 GTGAAGTTGGGCAGTTGGCCTGG + Intergenic
1190876453 X:54463708-54463730 GGGGAGGTGGGGTGCTGGACAGG - Intronic
1191718212 X:64207165-64207187 GTGGAGGTGGGGTGATGCCCTGG - Intergenic
1192151485 X:68715374-68715396 AGGTAGGTGGGCTGAGGGCCAGG + Exonic
1192174571 X:68877851-68877873 GAGGAGCTGGGCTGAGGCCCTGG + Intergenic
1192252418 X:69423554-69423576 GCCGAGGTGGGTTGATCGCCTGG + Intergenic
1192583729 X:72304948-72304970 GTGGAGGAGGGCAGAAAGCCGGG - Intronic
1192747603 X:73955402-73955424 GCAGAGGTGGGCTGATCACCTGG + Intergenic
1195469702 X:105218727-105218749 GTAGAAGTGGGGTGGTGGCCAGG - Intronic
1195732038 X:107977964-107977986 GTGGGGGTGGGCTCAGGGTCAGG - Intergenic
1195857971 X:109350936-109350958 GATGAGGTGGGCTGAGGGCATGG + Intergenic
1200066988 X:153508627-153508649 GTGCAGGTGGGCGCAAGGCCCGG + Exonic
1200072850 X:153537538-153537560 GAGGAGGGGGGCTGCGGGCCAGG + Intronic
1200836209 Y:7734324-7734346 GTGGAGGAGAGCTGGTGGCTGGG - Intergenic
1202272593 Y:23085743-23085765 GGGGAGGGGGGGTGATGGCGGGG + Intergenic
1202293433 Y:23334939-23334961 GGGGAGGGGGGGTGATGGCGGGG - Intergenic
1202425590 Y:24719487-24719509 GGGGAGGGGGGGTGATGGCGGGG + Intergenic
1202445199 Y:24950598-24950620 GGGGAGGGGGGGTGATGGCGGGG - Intergenic