ID: 1165831030

View in Genome Browser
Species Human (GRCh38)
Location 19:38730382-38730404
Sequence GGGCTGATGGCCTGGCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 464}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831016_1165831030 27 Left 1165831016 19:38730332-38730354 CCGGGTCTGCGTCGGGCGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464
1165831027_1165831030 -9 Left 1165831027 19:38730368-38730390 CCAGAGGTGGAGGTGGGCTGATG 0: 1
1: 0
2: 3
3: 40
4: 505
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464
1165831025_1165831030 -5 Left 1165831025 19:38730364-38730386 CCCTCCAGAGGTGGAGGTGGGCT 0: 1
1: 0
2: 0
3: 29
4: 282
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464
1165831013_1165831030 30 Left 1165831013 19:38730329-38730351 CCTCCGGGTCTGCGTCGGGCGTG 0: 1
1: 0
2: 1
3: 0
4: 47
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464
1165831026_1165831030 -6 Left 1165831026 19:38730365-38730387 CCTCCAGAGGTGGAGGTGGGCTG 0: 1
1: 0
2: 1
3: 46
4: 414
Right 1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG 0: 1
1: 0
2: 5
3: 50
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831030 Original CRISPR GGGCTGATGGCCTGGCTGCC TGG Exonic
900164038 1:1237632-1237654 GGGCTCCTGTCCTGCCTGCCCGG - Intergenic
900174311 1:1285091-1285113 GAGCTCCTGGCCAGGCTGCCTGG + Intronic
900464844 1:2820644-2820666 GGGCTGAGGGGCTGGAGGCCAGG + Intergenic
900610198 1:3541509-3541531 GGGCACCTGGCCTGGGTGCCAGG + Intronic
900662365 1:3791121-3791143 GGGCTCAGGGCTGGGCTGCCGGG - Intronic
900700890 1:4048027-4048049 GGGCTGATGGCCCGGTCACCTGG - Intergenic
900947851 1:5841267-5841289 GGGCTGCTGGCCTGGCCTCTTGG - Intergenic
901022893 1:6263981-6264003 GGGCTCAGGGCCACGCTGCCTGG - Intergenic
901038347 1:6349657-6349679 AGGCTGCAGGCCTGGCTCCCCGG + Intronic
901080006 1:6578806-6578828 GGACTGCTGGCCTGTTTGCCTGG + Exonic
901131344 1:6963698-6963720 GGGCTGCTGACCTGGCTGGGGGG + Intronic
901572446 1:10172481-10172503 GGGTTCAAGGCCAGGCTGCCTGG - Intronic
901764271 1:11490020-11490042 GGGGTGCTGGACTGGCTGCTGGG + Intronic
902300892 1:15502119-15502141 AGGCTGGGGGCCTGGCTGCAGGG + Intronic
902393385 1:16119104-16119126 GGCCTGCTGGCCGGGCTACCTGG + Intergenic
902472308 1:16657335-16657357 AGGCTGATAGCCTGGCGCCCTGG + Intergenic
902486495 1:16750111-16750133 AGGCTGATAGCCTGGCGCCCTGG - Intronic
902504330 1:16929721-16929743 AGGCTGATAGCCTGGCGCCCTGG - Intronic
902611747 1:17602006-17602028 GGGCTGAGGGCCAGGCTGCTGGG - Intronic
902776603 1:18678910-18678932 GGGCTCTGGGACTGGCTGCCTGG + Intronic
902857850 1:19222162-19222184 GGACTGAAGGCCAGGCAGCCAGG + Intronic
903576665 1:24343593-24343615 GGACTGAGCGCCTGGCAGCCAGG + Intronic
904313154 1:29642244-29642266 GAGCAGATGGCCTGGCTGGGTGG + Intergenic
904753223 1:32754021-32754043 GGGCTGCGGGCCCGGCGGCCGGG + Intronic
905460969 1:38122867-38122889 AGGCAGATGGCTGGGCTGCCTGG + Intergenic
906069305 1:43006060-43006082 GGGCTCTAGGCCAGGCTGCCAGG + Intergenic
906190816 1:43898580-43898602 GGACTGAGGGCCTGGGTGGCGGG + Intronic
906243818 1:44259266-44259288 TGGCTGGCTGCCTGGCTGCCTGG + Intronic
906528880 1:46512048-46512070 GGAGTGATGGTCAGGCTGCCTGG - Exonic
906551839 1:46671850-46671872 GGGCAGATGGGCTGACTGGCTGG + Exonic
910792697 1:91067572-91067594 GGGTTGTTGGCCTGGCTGGCGGG - Intergenic
913223012 1:116674202-116674224 GGGCAGCTGGGCTGTCTGCCTGG + Intergenic
914048103 1:144106619-144106641 GGGCGGCTGGGCTGGCTGGCTGG + Intergenic
914131080 1:144858829-144858851 GGGCGGCTGGGCTGGCTGGCTGG - Intergenic
915479435 1:156174992-156175014 GGCCTGTTGGGCTGGCTCCCTGG + Intronic
919775745 1:201192952-201192974 GTGCTGGTGGCCTGGCCTCCTGG - Intronic
920013694 1:202888708-202888730 GGGCAGAGGGCCGGGCTGGCTGG + Intronic
921175978 1:212594881-212594903 TGGCTGATTGCCTGGCCACCTGG + Intronic
922238991 1:223743206-223743228 GGGCAGCTGGCCAGGCAGCCTGG - Intronic
923012104 1:230096036-230096058 GGGCTGTGGGCCTGGCTGCTGGG + Intronic
923357796 1:233177639-233177661 GGGCTGTTGAGCTGCCTGCCAGG - Intronic
923391355 1:233516166-233516188 AGACTGATGGCCTGGCTCCCAGG - Intergenic
1064731960 10:18340535-18340557 GGGCTGGAGTCCTGGCTGCCTGG + Intronic
1067838596 10:49657494-49657516 GGGCTAGTAGCCTGGCTGCCTGG - Intronic
1069601780 10:69712527-69712549 GGGCTGGGGGCCTGGCTCCCGGG - Intergenic
1069621463 10:69840109-69840131 TTGCTGATGGGCTGGCTGTCGGG + Intronic
1069793607 10:71039103-71039125 GTGCTGAGTGCCTGGGTGCCTGG - Intergenic
1070657375 10:78280724-78280746 AGGCTGTGGGCCGGGCTGCCTGG + Intergenic
1070809886 10:79292391-79292413 GGGCTGTCTGCCTGGCTGGCTGG - Intronic
1070930372 10:80256715-80256737 GGGCAGATGGCCTGGGTGAGGGG + Intergenic
1071729632 10:88234568-88234590 TGGCTGAGGGCCTGGTAGCCAGG + Intergenic
1072955637 10:99885613-99885635 GGCCTGGGGGCCTGGCTGCAGGG + Intronic
1074538529 10:114345980-114346002 GGGCAGGTGCCATGGCTGCCTGG - Intronic
1074813225 10:117125886-117125908 GGGCTGATGACCTGACTTTCTGG + Intronic
1074843001 10:117374319-117374341 GGGGAGGGGGCCTGGCTGCCGGG - Intronic
1075066696 10:119293700-119293722 TGGATGATGGCCTGGATGCCTGG + Intronic
1076358178 10:129867885-129867907 GGACTGATGGCCTTGATGCACGG + Exonic
1076388822 10:130080621-130080643 GGCCTCTTGGGCTGGCTGCCAGG - Intergenic
1076462132 10:130654886-130654908 GGGCTGGTGGCCTTGTGGCCTGG - Intergenic
1076628955 10:131841408-131841430 GGGCTGCGGGACTGCCTGCCAGG - Intergenic
1076869626 10:133186988-133187010 GGGCTGCTGGCCTTGCTTCCCGG - Intronic
1077370211 11:2178195-2178217 CAGCTGAATGCCTGGCTGCCAGG - Intergenic
1077383973 11:2260386-2260408 GGGCTGAGGGGGTGGCTGCCAGG + Intergenic
1077446137 11:2591848-2591870 GAGCTGTTGGCCTGGCCCCCAGG + Intronic
1078461586 11:11519142-11519164 GGGCTTATGGCCTGGCGAGCAGG - Intronic
1079562480 11:21839592-21839614 GGGCTGAGGGCCCAGCTGGCTGG + Intergenic
1080647088 11:34195156-34195178 GGCCTGTTGCCCTGGCTGCTGGG - Intronic
1080703958 11:34670441-34670463 GGGAGGATTTCCTGGCTGCCAGG - Intergenic
1080827626 11:35861338-35861360 GGCCTGGGGGCCTGGCTGCGGGG - Intergenic
1081604368 11:44518230-44518252 GGGCTAGAGGTCTGGCTGCCAGG - Intergenic
1082085433 11:48045799-48045821 GGGGTGAGGGCCTGGCCACCTGG + Intronic
1083190495 11:61048550-61048572 GTGCTCATCGCCTTGCTGCCTGG + Intergenic
1083593593 11:63908791-63908813 GGGCTCAGGGGCTGTCTGCCAGG + Intronic
1083619149 11:64040436-64040458 GGGCTGGTGGGCTGTCTCCCTGG + Intronic
1083901636 11:65646275-65646297 GGGCAGAAGGGCTTGCTGCCAGG - Exonic
1084182234 11:67452561-67452583 GGGTTGATGGCGTGGCTGGCCGG - Exonic
1084455824 11:69267723-69267745 TGGCTGCTGGCTGGGCTGCCTGG - Intergenic
1084582082 11:70030273-70030295 GGGCTGCTGATGTGGCTGCCGGG + Intergenic
1084647490 11:70466884-70466906 GGGCCTAGGGCCTGGCTGCCAGG + Intergenic
1085390915 11:76181750-76181772 GGGCGGGTGGCCTGGCGGGCAGG + Intergenic
1085529802 11:77184519-77184541 GTGCTGGTGCCCTGGCTGGCAGG + Intronic
1085709674 11:78817751-78817773 AGGCAGACGGCCTGGCTTCCAGG + Intronic
1087424058 11:97967419-97967441 GTGCTGTTGACTTGGCTGCCTGG + Intergenic
1087812607 11:102624197-102624219 GGGCTGCTTTCCTGACTGCCAGG - Intronic
1088680929 11:112240917-112240939 GGGCTGAAGCCCTGTCTGTCTGG + Intronic
1088986135 11:114910127-114910149 GAGCTGGTGGGCTGCCTGCCTGG - Intergenic
1089338321 11:117740930-117740952 GATCTGATGGCCTGGCTGGCTGG - Intronic
1089605284 11:119638068-119638090 GGGCTCATGGCCAGGCTGGGTGG + Intronic
1090050210 11:123371296-123371318 GGTCTCACGGCCTGTCTGCCAGG + Intergenic
1090231963 11:125113745-125113767 GGTCTGGAGGCCTGGCTGCAGGG + Intergenic
1091141548 11:133239495-133239517 GGGCTGAGGCCCTGGCTGCAGGG - Intronic
1092214924 12:6674443-6674465 GTGCTAATTGCCTGGCTTCCAGG - Intronic
1094672808 12:32587414-32587436 GGTCTGTTGCCCAGGCTGCCAGG + Intronic
1095145413 12:38721131-38721153 GGGCCGATGGGATGGATGCCTGG + Intronic
1096456936 12:51795316-51795338 GGGATGATGTCCTGGCAGGCAGG + Intronic
1096531673 12:52246544-52246566 GGGCCGAGGGCCTGGGTGCTGGG + Intronic
1096680451 12:53252204-53252226 GGGAGGGTGGCCTGGCGGCCTGG + Intronic
1096976692 12:55703454-55703476 GCACTGTTGGCCTGGCTGCTTGG - Intronic
1100631872 12:96398705-96398727 TGACTGAAGGTCTGGCTGCCAGG + Intronic
1101469991 12:104986797-104986819 GGGCTTTTGGTTTGGCTGCCTGG + Intronic
1101712680 12:107283080-107283102 GGGGTGATGCCCAGGCTGCATGG + Intergenic
1102029620 12:109732451-109732473 GGGCTGCTGGGCAGGCGGCCGGG - Intronic
1102799953 12:115723436-115723458 TAGCTAATGGCCTGGCTGCCTGG - Intergenic
1102933799 12:116881048-116881070 GCGCTGGCGGCCTGGCTGCTCGG - Exonic
1103039992 12:117686964-117686986 GGGCTGGCGGGCTGGCTGGCTGG + Intronic
1103074663 12:117972478-117972500 AAGCAGATGGCTTGGCTGCCAGG - Intergenic
1103595268 12:122021564-122021586 GGGCAGCTGGGCTGGCTCCCGGG + Exonic
1104276101 12:127329215-127329237 GGGCTGCTGGACCAGCTGCCTGG + Intergenic
1104756490 12:131272798-131272820 TGTCTGATGTCCTGGTTGCCAGG - Intergenic
1104776841 12:131394581-131394603 TGTCTGATGTCCTGGTTGCCAGG + Intergenic
1104953732 12:132453903-132453925 GGGCTGCTGGCATCGGTGCCCGG + Intergenic
1105451249 13:20502275-20502297 GGGCTGTGGGTCTGCCTGCCTGG + Intronic
1105702978 13:22947780-22947802 GGGCACATGGCCAGGCTGGCTGG - Intergenic
1105841223 13:24255060-24255082 GAGCTAATGGCCTGGCTGAATGG - Intronic
1106786545 13:33113424-33113446 GGCATCATGGCCTGGCTGGCAGG - Intronic
1107938202 13:45362663-45362685 GGGCAGAGGTTCTGGCTGCCTGG + Intergenic
1108448636 13:50536554-50536576 GGGTTGCTGGGCTGGCTGGCAGG + Intronic
1108450607 13:50558983-50559005 TGGATGATGGCTTGGCTTCCAGG + Intronic
1112590059 13:100754772-100754794 GGGTAGAAGTCCTGGCTGCCAGG - Intergenic
1113682187 13:112252297-112252319 GGGCTGATGCCCAGCTTGCCAGG - Intergenic
1114221203 14:20699069-20699091 GGACTGACTGCGTGGCTGCCAGG - Intronic
1114267697 14:21082360-21082382 GGGCTGCTGCCCTGAGTGCCCGG + Exonic
1114366762 14:22035272-22035294 GGCCAAATGGCCTGGCTCCCTGG - Intergenic
1114484169 14:23053336-23053358 GGTCTGCAGGCCTGGGTGCCAGG - Intronic
1116703259 14:48265701-48265723 GGGCTCTGGGACTGGCTGCCAGG + Intergenic
1118990304 14:70791598-70791620 GGCCTGCTGGCCTCACTGCCTGG + Intronic
1120781295 14:88488421-88488443 GAACTGATGGCGTGGCTGCCTGG - Intronic
1121246420 14:92464318-92464340 GGGCAGGTGGCCTGGATGCCTGG - Intronic
1121308665 14:92923277-92923299 GGGCGGCTGGACTGGCGGCCGGG - Exonic
1122048376 14:99039224-99039246 GGGGGGCTGGCCTGGCTGCAAGG + Intergenic
1122147360 14:99699635-99699657 GGCCTGAGGCCCTGGCTGCCAGG + Intronic
1122627559 14:103092000-103092022 TGGCTGAGGACCTGGCTCCCAGG - Intergenic
1122876517 14:104668687-104668709 GGGCTGAGGGCCCCGCTGCCTGG - Intergenic
1122890908 14:104731833-104731855 GGGCTCAGGGCCGGGCTGCCTGG + Intronic
1123936067 15:25194668-25194690 AGGATGCTGGCCTGGATGCCAGG - Intergenic
1123961130 15:25402300-25402322 GTGCTGCTGGCCTGGCATCCTGG + Intronic
1124055429 15:26237370-26237392 GGCCTGATGCCCTGCCTCCCTGG + Intergenic
1124492279 15:30165395-30165417 GGGCTTTTGGCCTGTCTCCCTGG - Intergenic
1124751256 15:32372922-32372944 GGGCTTTTGGCCTGTCTCCCTGG + Intergenic
1125577527 15:40765786-40765808 TGGCTGCTTGGCTGGCTGCCAGG - Exonic
1125592633 15:40864356-40864378 GAGCTCATGGCCTGCTTGCCGGG + Intergenic
1125734979 15:41918625-41918647 GGGCTGTTAGCCTGCATGCCTGG - Intronic
1125827646 15:42689898-42689920 GGGCTGCTGTCCTGACTGCCAGG - Exonic
1126106353 15:45149341-45149363 TGCCTGCTGCCCTGGCTGCCTGG - Intronic
1127071054 15:55289219-55289241 GACCGGAGGGCCTGGCTGCCAGG + Intronic
1127512188 15:59653914-59653936 TGGCTGATGGATTGGATGCCAGG - Intronic
1127606239 15:60591551-60591573 GGGCGGAAGGCCGGGCCGCCCGG + Intronic
1128056386 15:64702921-64702943 GGGCGGATGGCCCCGCTGCGGGG + Intronic
1128124928 15:65185288-65185310 AGCGTGAAGGCCTGGCTGCCGGG - Exonic
1128382078 15:67120567-67120589 GGGCAGATGGGCTAGCTGCGAGG + Intronic
1128531346 15:68450398-68450420 TGGCCGCTGGCCTGGGTGCCTGG - Intergenic
1128778969 15:70345440-70345462 TGGCTCGTGGCCTGGCTGCATGG - Intergenic
1128954583 15:71926800-71926822 GGTCTGAGGGCCAGGCTGTCTGG - Intronic
1129235537 15:74221776-74221798 GGGCTGCTGCTCTGGCTGGCAGG - Intergenic
1130013938 15:80173309-80173331 AGAATGATGCCCTGGCTGCCTGG - Intronic
1131437027 15:92431296-92431318 GGGCTGAGGCCAGGGCTGCCTGG - Intronic
1132148813 15:99445431-99445453 GGGCTCATGGCTTTCCTGCCCGG - Intergenic
1132219783 15:100096765-100096787 GGCCTGACGCCCTGACTGCCTGG + Intronic
1132646451 16:1001355-1001377 GAGCTGAGGGCCTGGCTGCGGGG + Intergenic
1132846209 16:2002008-2002030 GGTCTGCTGCCCTGGGTGCCCGG - Intronic
1133235922 16:4387408-4387430 GGGCTGGTGCCCAGGCAGCCTGG - Intronic
1133268214 16:4597372-4597394 GGGCTGCTTGCCGGGCGGCCAGG + Intronic
1133317728 16:4894656-4894678 GGCCTGAGGGCCTGGGAGCCCGG + Intronic
1133916395 16:10113112-10113134 GGCCTGAGAGCCTGGCTGGCTGG - Intronic
1133978570 16:10617485-10617507 TGGGTGCTGGCCTGGCTGCAGGG + Intergenic
1134090714 16:11390349-11390371 CGGCTGCAGGCCTGGGTGCCCGG - Exonic
1134913040 16:18045720-18045742 GGGCAGCTGGTCTGGCTGCAGGG + Intergenic
1135223680 16:20637156-20637178 TGTGTGATGCCCTGGCTGCCAGG + Intronic
1136414891 16:30096777-30096799 GGTCCGACGCCCTGGCTGCCAGG - Intronic
1136544155 16:30946656-30946678 GGGCAGATGGTCTGGATACCTGG + Intronic
1137459734 16:48649605-48649627 GGGCTGAGGGCATGTCTGCCTGG + Intergenic
1137842255 16:51651327-51651349 GAGCTGCTGGCAAGGCTGCCAGG - Intergenic
1138251524 16:55505526-55505548 GAGCTGAAGGCACGGCTGCCAGG - Exonic
1138554257 16:57762779-57762801 GGGGTGAGGGCCAGGCTCCCAGG - Intronic
1138676513 16:58655359-58655381 AGGCTGGAGGCCTGGCTTCCAGG + Intergenic
1139583859 16:67888584-67888606 GGGCTGATAGCCAAGCTGGCTGG + Intronic
1139961677 16:70721596-70721618 AGGCTGAGCCCCTGGCTGCCAGG + Intronic
1140478011 16:75248635-75248657 GGGCTCAAGTCCTGGGTGCCCGG + Intronic
1141804579 16:86334317-86334339 GGGCTGAGGGGCTGGCTCCAGGG + Intergenic
1141882532 16:86869415-86869437 GGGCAGCTGGCCTGGCCTCCTGG - Intergenic
1142119496 16:88378995-88379017 GCGCTGATGGCCTGGGTGTGTGG - Intergenic
1142486778 17:252667-252689 GGGCTGATGGGGTGGGTGCGGGG - Intronic
1143324274 17:6088258-6088280 TGGCAGATGACCTGGGTGCCGGG + Intronic
1143381527 17:6499212-6499234 GGGCAGGCGGCCTGGCAGCCTGG - Intronic
1143490041 17:7281076-7281098 GGTCTGGTGGCCGGGCTGCTTGG - Intergenic
1143538688 17:7557240-7557262 GGGCTGTTGGCCCTGCGGCCAGG + Exonic
1144496693 17:15750087-15750109 GGGCTGAGGGGCGGGCAGCCTGG + Intergenic
1144904939 17:18634778-18634800 GGGCTGAGGGGCGGGCAGCCTGG - Intergenic
1145200310 17:20938754-20938776 GGGGTGAAGCCCTGGCAGCCTGG - Intergenic
1145756024 17:27390576-27390598 GTGAGGATGGCCTGGATGCCAGG - Intergenic
1146735382 17:35234103-35234125 TGGCCAATGGTCTGGCTGCCTGG - Intergenic
1147484154 17:40796349-40796371 TGGCTGAAGGCCTGGCTCCCAGG + Intronic
1147701969 17:42401964-42401986 GGGCTAATGCCCTGACTGCAGGG + Intergenic
1147962547 17:44176989-44177011 GAGCTGATGCCCGGGCGGCCGGG + Exonic
1148183091 17:45620652-45620674 GGCCTGAGGGCCTGGCTGCCCGG + Intergenic
1148265760 17:46225039-46225061 GGCCTGAGGGCCTGGCTGCCCGG - Intronic
1149362685 17:55911285-55911307 GGGCTCTGGGCCTGGCTGTCAGG + Intergenic
1150628492 17:66859056-66859078 CAGCTGAGCGCCTGGCTGCCTGG - Intronic
1151152601 17:72100764-72100786 GGGCTGATTACCTGGCCGACTGG - Intergenic
1151360202 17:73584184-73584206 GGGCAGTTGGCCTGGCCGCCGGG + Intronic
1151398237 17:73839093-73839115 GGGCTGGAGGGCTGGCTCCCAGG - Intergenic
1151889171 17:76942059-76942081 GCGCTGATGGCCCTGCTGCAGGG + Intronic
1151967126 17:77437291-77437313 GGACTCATGGCCTGGTTCCCAGG + Intronic
1152097136 17:78278821-78278843 GGGCTGGTGGCCAGGCTGGGTGG - Intergenic
1152444064 17:80330444-80330466 AGGGTGTGGGCCTGGCTGCCAGG + Intronic
1152552806 17:81038260-81038282 GTGCTGAGGGGCTGGCTCCCTGG + Intronic
1152765308 17:82134133-82134155 GGGCTCCTCGCCTGGCTTCCGGG + Intronic
1152911175 17:83005730-83005752 GGGGTGCTGGCCTGGATGCCCGG - Intronic
1153878945 18:9403967-9403989 GCGCTAATGGCATGTCTGCCTGG - Intergenic
1153986701 18:10357278-10357300 GGGATCATAGCCTGGCTTCCTGG - Intergenic
1154110565 18:11565030-11565052 GGGGTGATGATCTGGCTGCTTGG - Intergenic
1157814678 18:50722109-50722131 GGACACTTGGCCTGGCTGCCAGG - Intronic
1157814873 18:50723180-50723202 GACCTGATGGCCTGGGTCCCGGG - Intronic
1158664454 18:59420141-59420163 GGGCTGTGGGCCTGGCTGTTTGG + Intergenic
1159682726 18:71374420-71374442 AGGCTGGAGGCCTGCCTGCCTGG + Intergenic
1159961393 18:74558294-74558316 GCGCTGCTGGAGTGGCTGCCAGG + Intronic
1160541502 18:79626336-79626358 GGGCTGGTGGGACGGCTGCCGGG + Intergenic
1160856024 19:1218352-1218374 AGGATGATGGCCTGGATCCCTGG - Intronic
1160949532 19:1658767-1658789 GGGCTGCAGGGATGGCTGCCTGG + Intergenic
1161027688 19:2044213-2044235 GGCCTGGTGGGCTGGCAGCCAGG - Intronic
1161354903 19:3813583-3813605 GGGCTCAGAGCCTGGCTGCAGGG - Intronic
1161435789 19:4262068-4262090 GGGCCGAAGGGCTGGCTGCAGGG - Exonic
1161995270 19:7707780-7707802 GGTCTGGGGGCCTGGCTTCCTGG - Intergenic
1162964567 19:14149819-14149841 GCGCTGCTGGCCTGGCAGCCAGG - Exonic
1163371042 19:16901414-16901436 GTGCTGTTGGCCTGCCGGCCAGG - Intronic
1163848336 19:19649963-19649985 GGGCTGGGGGCTTGGCTGACCGG + Intronic
1164387271 19:27783674-27783696 GGCCTGAGGGACTGGCTGTCAGG + Intergenic
1164750919 19:30654183-30654205 GGGCTGGTGCCCAGGCTGCGTGG + Intronic
1164807440 19:31127848-31127870 GAGCTGAGGGCCAGGCTGCCAGG - Intergenic
1165445813 19:35856342-35856364 GGGCCGAGGGCCTGGATTCCTGG + Intronic
1165831030 19:38730382-38730404 GGGCTGATGGCCTGGCTGCCTGG + Exonic
1165938344 19:39403040-39403062 GGGCTGAGGGCCTGGTCTCCTGG + Intergenic
1166044760 19:40223401-40223423 GGGCTGCTGGCCGCGCTGGCAGG - Exonic
1166296679 19:41893353-41893375 GGGCTGAGGGCCTGGACTCCTGG + Intronic
1166296775 19:41893585-41893607 GGGCTGGGGGCCTGGACGCCTGG + Intronic
1166384040 19:42370469-42370491 GGGCTGGAGGCCTGGATTCCTGG + Intronic
1166695930 19:44851406-44851428 GGGCTGGGGGCCTGGATTCCTGG - Intronic
1167219225 19:48186720-48186742 GGGGTGAAGGCCAGGCTGCCAGG + Intronic
1167276799 19:48544349-48544371 GGGCTGGGGGCCTGGATTCCCGG - Intergenic
1167298320 19:48664486-48664508 GGGCTGGGGGCCTGGATTCCTGG - Intronic
1167465048 19:49646218-49646240 GGGCTGGGGGCCTGGCTCACGGG + Intronic
1167561049 19:50226488-50226510 GGGCTGGTGGCCTGGACCCCTGG + Intronic
1167741055 19:51325290-51325312 GGGCTGGGGGCCTGGATTCCTGG + Intronic
1167746370 19:51353707-51353729 GGGCTGATAGCCTGGATTCCTGG - Intronic
1167746471 19:51354003-51354025 GGGCTGATAGCCTGGATTCCTGG - Intronic
1167793054 19:51692545-51692567 GGGCTGAGGGCCTGGACTCCTGG + Intergenic
1168056632 19:53868243-53868265 GGGCTGAGGGCCTGGACTCCTGG + Intronic
1168057131 19:53869956-53869978 GGGCTGGGGGCCTGGGGGCCTGG + Intronic
1168149216 19:54435941-54435963 GAGCTGAGGGCCTGGCCGCCTGG + Intronic
1168238098 19:55076094-55076116 GGGCTGAGGGCCTGGACTCCTGG + Intronic
1168242415 19:55094241-55094263 GGGCTGGGGGCCTGGATTCCTGG - Intronic
1168250264 19:55137711-55137733 GGGCTGAGGGCCTGGACGCCTGG - Intronic
1168253592 19:55155059-55155081 GGGCTGAGGGCCTCGATTCCAGG + Intronic
1168253800 19:55155636-55155658 GGGCTGAGGGCCTCGATTCCAGG + Intronic
1168295868 19:55377170-55377192 GGGCTGGGGGCCTGGATCCCTGG + Intronic
1168306290 19:55437987-55438009 GGGCTGCAGGCCTGGACGCCTGG - Intronic
1168306302 19:55438024-55438046 GGGCTGGGGGCCTGGACGCCTGG - Intronic
1168306317 19:55438061-55438083 GGGCTGGGGGCCTGGACGCCTGG - Intronic
1168306342 19:55438131-55438153 GGGCTGGGGGCCTGGACGCCTGG - Intronic
1202704705 1_KI270713v1_random:14129-14151 AGGCTGATAGCCTGGCGCCCTGG + Intergenic
924997501 2:375834-375856 GGGTCCTTGGCCTGGCTGCCCGG - Intergenic
925118390 2:1398959-1398981 GAGGTGAGGGCCTGGCTGCAGGG - Intronic
925578888 2:5389720-5389742 AGGCTGAATGCCGGGCTGCCAGG - Intergenic
926806047 2:16712257-16712279 TGGCTGATGGCCTTCCTTCCAGG + Intergenic
927485773 2:23487571-23487593 GGGCTGCTGGCCTTGATGGCAGG - Intronic
927633285 2:24793040-24793062 GGTCCGAAGGCCTGGCTGCGGGG - Intronic
927882807 2:26700503-26700525 GGGCTGGTGGCCTCTCTGGCTGG + Intronic
928367468 2:30713819-30713841 TGGTTGATGGCCTGGCTGTGTGG + Intergenic
929584150 2:43102855-43102877 GTGCTGGTGGCCTGGCTGTTGGG - Intergenic
929758831 2:44789609-44789631 GTGCTGGTTGCCTGGCTGCCTGG + Intergenic
932367617 2:71163007-71163029 GGGCTGTGGGAGTGGCTGCCAGG + Intergenic
932435854 2:71702270-71702292 GGGCTGGGGCCCTGCCTGCCCGG + Intergenic
933958776 2:87395975-87395997 GGGCTCCTGGGCTGGCTGGCTGG - Intergenic
934120294 2:88831842-88831864 GGGCTAGTGTCCTGGCTGCATGG + Intergenic
934242904 2:90287973-90287995 GGGCTCCTGGGCTGGCTGGCTGG - Intergenic
934242933 2:90288103-90288125 GGGCTCCTGGGCTGGCTGGCTGG - Intergenic
934243658 2:90291361-90291383 GGGCTGACTGCGTGGCTGGCTGG - Intergenic
934662081 2:96148442-96148464 GGGCTGATGGATGTGCTGCCAGG - Intergenic
935217003 2:100982443-100982465 GGGAGGAAGTCCTGGCTGCCCGG - Intronic
935331321 2:101979789-101979811 GGACTGAGGGCCTGCCTGGCAGG + Intergenic
936066551 2:109336923-109336945 AGGATGATGGTCTGGCTGTCAGG - Intronic
937104011 2:119293747-119293769 TGGCTGATGGCCTGGCTGTGGGG + Intergenic
937119164 2:119430254-119430276 GTGCTGCTGGCCTGGGGGCCAGG - Intronic
937121069 2:119440261-119440283 GGGCTGATGGCTGGTCTCCCGGG - Intronic
937284100 2:120739053-120739075 TGGCTCATTGCCTGGCTGCGGGG + Intronic
937708593 2:124950694-124950716 AGGCCGAAGGCCTGACTGCCAGG - Intergenic
938092343 2:128441800-128441822 GGGCTGAGGGCCTGGCTGGAGGG - Intergenic
938255721 2:129858498-129858520 CGGCTGCTGGGCTGGCAGCCCGG - Intergenic
938258444 2:129878198-129878220 GAGCTGCTGGCCAGGATGCCAGG - Intergenic
939909501 2:147962884-147962906 GGGCTGGGGGCATGCCTGCCAGG - Intronic
942603036 2:177660909-177660931 GGGCGGGTGGCCAGGCTGCTGGG - Intronic
943369624 2:187001612-187001634 GGCCTGAGAGCCTGGCTGGCTGG + Intergenic
943416332 2:187610585-187610607 GGGCTAATGCCCTGACTGCAGGG - Intergenic
944484906 2:200195234-200195256 GGGCTGATGGTCTGGATGGTGGG + Intergenic
944485377 2:200199866-200199888 GGGCTGGGGGCGTGGCTCCCAGG - Intergenic
946311713 2:218885638-218885660 GGGCTGAGAGCATGGCTGCAGGG - Intronic
946686442 2:222276462-222276484 GCCCTGATTCCCTGGCTGCCTGG + Intronic
947316683 2:228866467-228866489 GGACTGGCAGCCTGGCTGCCAGG - Intronic
948524110 2:238559894-238559916 GGGCTAAGGCGCTGGCTGCCAGG - Intergenic
948628216 2:239283804-239283826 GGGATGATGGGCAGGCTGTCGGG + Intronic
948659674 2:239499238-239499260 GAGCTGCTGGCCTGGCCGGCAGG + Intergenic
948844540 2:240676840-240676862 GGGCTCCTGGCCAGGCTGCCTGG - Intronic
948849320 2:240698039-240698061 GGGCTCCTGGCCAGGCTGCCTGG + Intronic
948857538 2:240736998-240737020 TGGCTGAGGGCCTGGCAGGCTGG + Intronic
948901035 2:240957022-240957044 GGGCTGCTGTCCTGGGTGGCAGG + Intronic
1169073780 20:2749628-2749650 GGGCTGATGGCCTTGATGCAGGG - Exonic
1169263721 20:4155251-4155273 GGGGTGATGGCCCGGCAGCTGGG - Intronic
1169339215 20:4783327-4783349 GGCCTGGTGGCCTGGTGGCCAGG - Exonic
1170546296 20:17437964-17437986 GAACTGCTGGCCTGGCAGCCAGG - Intronic
1171122979 20:22581947-22581969 GGGCCCATGGCCAAGCTGCCAGG + Exonic
1171235887 20:23524310-23524332 GGGCAGGTGGCCTGGCAGCCTGG - Intergenic
1172532466 20:35642357-35642379 GGGCTGAAGGTCTGGGTGGCAGG + Intronic
1173078031 20:39839520-39839542 GGTGTGCTGGCCCGGCTGCCTGG + Intergenic
1173161029 20:40652840-40652862 GTCATGCTGGCCTGGCTGCCAGG - Intergenic
1173251369 20:41365876-41365898 GGGCTGAGGAGGTGGCTGCCTGG + Intronic
1173654748 20:44691862-44691884 AGGCTGAGGGCCTGACTGGCAGG + Intergenic
1173838261 20:46139557-46139579 GTGCTGAGGGTCTGGCTGTCTGG - Intergenic
1174192399 20:48749610-48749632 GGGCAGGTGGCCGGGCTCCCGGG - Intronic
1175658642 20:60793363-60793385 TGGCTGAGGGTCTGGCTGGCTGG + Intergenic
1175754778 20:61522618-61522640 GGGCTGCTTGCCTGGCTGGGGGG - Intronic
1175771769 20:61628590-61628612 GGGCTGGAGGCCCTGCTGCCTGG - Intronic
1175835673 20:61992793-61992815 GGGCTGATGTCCTTGCCGTCTGG - Intronic
1176081523 20:63275783-63275805 TGGCTGGTGGCCTGGGTGGCCGG + Intronic
1176308338 21:5136073-5136095 CTTCTGATGGCCTGGCCGCCTGG + Intronic
1176365544 21:6030486-6030508 AGGCTGCTGGCCTGGGTTCCAGG + Intergenic
1177181814 21:17752481-17752503 GGCCTGATGGCGTGGGTGCAGGG - Intergenic
1179757974 21:43508059-43508081 AGGCTGCTGGCCTGGGTTCCAGG - Intergenic
1179848722 21:44125959-44125981 CTTCTGATGGCCTGGCCGCCTGG - Intronic
1179885649 21:44313251-44313273 GGGCGGCTGGCCTGGATGCTGGG - Intronic
1180083268 21:45496453-45496475 AGGCTTATGGCCTGCCTGTCAGG - Intronic
1180554462 22:16563709-16563731 TGGCTGGTAGCCTGGCTGGCTGG - Intergenic
1180787376 22:18554492-18554514 GGGCTGATAGGCGTGCTGCCCGG - Intergenic
1181234363 22:21440813-21440835 GGGCTGATAGGCGTGCTGCCCGG + Intronic
1181244285 22:21494018-21494040 GGGCTGATAGGCGTGCTGCCCGG - Intergenic
1181582099 22:23834173-23834195 GTGCTGATGGGCTGGTTACCAGG - Exonic
1181670606 22:24424031-24424053 GGGCTGGTGGCCGGGCGGCGTGG + Intronic
1181696525 22:24595412-24595434 GGGCTGCTGGCCCGTCTCCCTGG + Intronic
1183096675 22:35556150-35556172 GGGCTGATGGGAGGCCTGCCAGG + Intergenic
1183315710 22:37135840-37135862 CTGCTGAGGGCCAGGCTGCCGGG + Intronic
1183318451 22:37149478-37149500 GGGTGGATAGCCTGGGTGCCCGG - Intronic
1183407217 22:37636256-37636278 GGGCTGGTGCCCTGGTTGCAAGG - Intronic
1183538351 22:38415912-38415934 GGGCTGAGGGGCTGGGGGCCTGG + Intergenic
1184648008 22:45906568-45906590 GGGCTGATGGGCTGGTGGGCTGG + Intergenic
1184668344 22:46000257-46000279 GGGCTGAGGGCCTGGCAGGTAGG - Intergenic
1184890352 22:47375371-47375393 CTGCTGGTGGCCTGGCTGCTGGG - Intergenic
1185030111 22:48438235-48438257 GTGCTGGTGTCCTGCCTGCCAGG - Intergenic
1185101629 22:48843725-48843747 GGGCTGGTGGCCTTGAGGCCAGG + Intronic
1185249769 22:49794601-49794623 GTGCAGACAGCCTGGCTGCCTGG + Intronic
1185400660 22:50613874-50613896 TGGCGGATCGCCTGGCTCCCAGG + Intronic
949470971 3:4396188-4396210 GGGCTGAAGGCCAGGATGTCTGG + Intronic
949870625 3:8584901-8584923 GAGTGGATGGCCTGGCTGCAGGG - Intergenic
950112438 3:10428094-10428116 GGGCTCAGGGCTAGGCTGCCTGG + Intronic
950548324 3:13652175-13652197 GGGCTGGTGGCCAGGGTGGCTGG - Intergenic
950599167 3:14016909-14016931 GTGCTGATTGGCTGCCTGCCAGG + Intronic
952221137 3:31325435-31325457 GGGCTGTAGCCTTGGCTGCCTGG - Intergenic
953055561 3:39384379-39384401 GGGCTGGCGGCGTGGTTGCCCGG + Intronic
953405232 3:42656638-42656660 TGGCTGCTGCCCTGGCTGCTGGG + Intronic
954214602 3:49117263-49117285 GGGCTCAGGGCCTGGCTCCAGGG + Exonic
954444764 3:50540711-50540733 TGGCCGAGGGCCTGGCTGCTGGG + Intergenic
954638345 3:52083760-52083782 GGGCTGATGCCAGGGCTGCCCGG + Intronic
954672769 3:52299436-52299458 GGGCTGGTGGGCTGGCTGGGAGG + Intergenic
955029714 3:55204561-55204583 GAGATGATGGCCTGGATCCCAGG + Intergenic
956179047 3:66500769-66500791 GGGCTGAACGCCTGTCTTCCAGG - Exonic
957042197 3:75344392-75344414 GGGCTTTTTGCATGGCTGCCTGG - Intergenic
957778910 3:84793141-84793163 GGTCTGATTGCCTGGGAGCCAGG + Intergenic
959566111 3:107834616-107834638 GGGAAGTGGGCCTGGCTGCCAGG + Intergenic
959971373 3:112413784-112413806 GGGCTGCTGGCTGGGCTCCCTGG + Intergenic
960533306 3:118789283-118789305 GTGGTGAAGGCATGGCTGCCTGG - Intergenic
960933023 3:122873877-122873899 TGGCTTATTGCCTGTCTGCCTGG + Intronic
961014506 3:123457272-123457294 GGGCTGAGGGCCTGGGTGCCTGG + Intergenic
961449883 3:126997914-126997936 GGGCTCATGGCCAGCCTGGCAGG + Intronic
961476136 3:127147499-127147521 GGGCTGATGGGTTGGCTGCAGGG - Intergenic
962278620 3:134033740-134033762 GGGCACATGGCCAGGCTGCTGGG + Intronic
962599482 3:136980434-136980456 AGGCAGATAGCCTGGCTGACAGG - Intronic
962805443 3:138923765-138923787 GGGGTGACAGCCTGGCTGCGAGG - Intergenic
962840829 3:139230900-139230922 GGGCTGAAGGGCTGGCTGCCTGG + Intronic
964705936 3:159618747-159618769 GGGCTGGAGGACTTGCTGCCAGG - Intronic
966244139 3:177787207-177787229 GGGCAGATGGCCTGACTTTCTGG + Intergenic
966411843 3:179653122-179653144 GGGCTGACGGGCGGGCTGCGCGG - Exonic
966853255 3:184177239-184177261 GGGCTGGCAGGCTGGCTGCCGGG - Intronic
967086247 3:186097665-186097687 GGGCTGATGGCCTGGGATTCTGG - Intronic
967986237 3:195097629-195097651 GGGCTCCAGGCCAGGCTGCCTGG - Intronic
968504817 4:966884-966906 GGGATGGTGGCCTGGCCTCCTGG + Intronic
968506465 4:973403-973425 GGGCTGCAGGCCGGGCTGCCGGG + Exonic
968650372 4:1757953-1757975 GGGCTGATGGGCCGCGTGCCTGG - Intergenic
968702374 4:2063076-2063098 GGGGTGATGGCCTGGCCACTTGG + Intronic
968733734 4:2284552-2284574 GAGGTGAAGGCCTTGCTGCCCGG + Intronic
968789863 4:2652085-2652107 GGGCTGGTGGCCTCTGTGCCTGG + Intronic
968870381 4:3239087-3239109 GGGCTGAGGGCCTGTCACCCTGG - Intronic
968941803 4:3642966-3642988 GGCCTGAAGGACGGGCTGCCAGG - Intergenic
969235390 4:5861987-5862009 AGGCTGCTGTCTTGGCTGCCTGG - Intronic
969414537 4:7050036-7050058 GGGCTGGTGGCCTGGGTGGCAGG + Intronic
969610195 4:8223396-8223418 GGCCTGGTCACCTGGCTGCCAGG + Intronic
969622309 4:8284730-8284752 GGCCAGATGCCCAGGCTGCCTGG + Intronic
969839111 4:9867724-9867746 GGTCTGACTGCCTGACTGCCTGG + Intronic
971162125 4:24144100-24144122 GGGCTTATGGCCTATTTGCCAGG + Intergenic
972254265 4:37336503-37336525 GGGATAATGGCCTGACTGCCTGG + Intronic
973246713 4:48017283-48017305 GGGCAGAGGGCGTGTCTGCCTGG + Intronic
979993802 4:127407456-127407478 GGTCTGATTGCCTGGGAGCCGGG + Intergenic
980354497 4:131724746-131724768 GGGGTGCTGGCTTGGCTGCGCGG - Intergenic
980683815 4:136199979-136200001 AGTCTGATGGCCTGGGTCCCTGG - Intergenic
982344242 4:154339160-154339182 GGTCTGATGGCCTGAGAGCCAGG + Intronic
983301620 4:165933493-165933515 TAGCTGATGGACAGGCTGCCAGG - Intronic
983360433 4:166718683-166718705 GGGCTGTGGGAGTGGCTGCCAGG - Intergenic
983414683 4:167439132-167439154 GGGCTGTGGGAGTGGCTGCCAGG + Intergenic
985604161 5:849683-849705 GGGCTCAGAGCCTGGCTGCGGGG + Intronic
985644807 5:1079894-1079916 CGTCTGCTGGCCTGGCTGGCTGG - Intronic
986020273 5:3795156-3795178 TGGCTGAGTGGCTGGCTGCCTGG + Intergenic
986338798 5:6773470-6773492 GGGATTCTGGCCTGGCTTCCCGG + Intergenic
987026496 5:13932180-13932202 AAGCTCATGGCCTGGCTGGCAGG + Intronic
990042331 5:51389661-51389683 GGGCCGCAGGGCTGGCTGCCTGG - Exonic
990237440 5:53783323-53783345 TGGGTGATGGCCTGGTTCCCCGG + Intergenic
991109935 5:62888224-62888246 GGGCTTAAAGACTGGCTGCCTGG - Intergenic
992173194 5:74124173-74124195 GAGCTCATGGCATGGCTGTCTGG + Intergenic
995416927 5:111922914-111922936 GTGCTGCTGACTTGGCTGCCTGG + Intronic
995648668 5:114342946-114342968 GGGCTTAAGACCTGGCTGACGGG - Intergenic
997643228 5:135463453-135463475 GGGCAGATAGCCTGGGTGGCTGG + Intergenic
999142879 5:149374337-149374359 GGGCTGCTGGCCTGGCTTCTGGG + Exonic
999765892 5:154740623-154740645 GGGCTTCCGGCCAGGCTGCCTGG - Intronic
1000040467 5:157481147-157481169 GGGCTGATGGTCTGGGTGAGTGG - Intronic
1000232908 5:159331844-159331866 GGCCTGCCGGCTTGGCTGCCTGG - Intergenic
1001250277 5:170141747-170141769 GGTCTGGGGGCCTGGCTGCGGGG - Intergenic
1001573775 5:172748535-172748557 GGGCTGCCCGGCTGGCTGCCGGG - Intergenic
1001639758 5:173236089-173236111 AGCCTGAGGGCCTTGCTGCCAGG - Intergenic
1002327045 5:178416445-178416467 GTGCTGCTGGTCTGGCTGCTGGG + Intronic
1002637260 5:180614577-180614599 GGAGTGATGGCCCGGCTTCCAGG - Intronic
1002788679 6:423432-423454 GGGCTTGTGGCCTGCCTGCCTGG + Intergenic
1004081126 6:12394223-12394245 TGCCTGATGGCCAGTCTGCCGGG - Intergenic
1005840091 6:29738677-29738699 GGGCAGCTGGCCTCCCTGCCAGG - Intergenic
1005983750 6:30857165-30857187 TTGCTGTTGGCCTGGGTGCCTGG - Intergenic
1006392954 6:33769586-33769608 GAGAGGCTGGCCTGGCTGCCCGG + Intergenic
1006471977 6:34234901-34234923 GGGCTGGCGGCCTGGCGGCTGGG - Intergenic
1006578536 6:35063209-35063231 GGGCTCGTGGGCTGGCTGGCTGG - Intronic
1006623601 6:35383950-35383972 GGGCTGCTGGCCTGGCGGGGGGG - Intronic
1006729112 6:36222353-36222375 GAGCTCAAGGACTGGCTGCCTGG - Intronic
1007830733 6:44636520-44636542 GGCTTGACTGCCTGGCTGCCCGG + Intergenic
1007843520 6:44735748-44735770 GGGCTGGTGGGCTCGATGCCAGG + Intergenic
1010851278 6:80781432-80781454 GGCCTGGGGGCCTGTCTGCCTGG + Intergenic
1013667394 6:112362529-112362551 GGTCTGGGGCCCTGGCTGCCGGG - Intergenic
1014555876 6:122842211-122842233 GGGCTGTGGGAGTGGCTGCCAGG - Intergenic
1014736378 6:125099758-125099780 GGGCAGTTGTGCTGGCTGCCGGG + Intergenic
1016932637 6:149425744-149425766 GGGCAGATGGCCTGGCTGTCTGG - Intergenic
1017935357 6:159000157-159000179 GAGCTGGGAGCCTGGCTGCCAGG - Exonic
1018029758 6:159832520-159832542 AGGCTGAGGGCCAGGGTGCCTGG + Intergenic
1018724113 6:166597388-166597410 GCCCCCATGGCCTGGCTGCCAGG - Intronic
1018840696 6:167514332-167514354 GGGCTGGGGGCCTGGGGGCCTGG + Intergenic
1019002873 6:168770193-168770215 GGTCTGATTGCCTGGGAGCCAGG - Intergenic
1019161797 6:170073915-170073937 AGGCTGCTGGCCTGGCAGCATGG - Intergenic
1019178910 6:170175372-170175394 GGGGTGCTGGCCTCGCCGCCTGG - Intergenic
1019339529 7:502367-502389 GGTCTGCTGGCCCTGCTGCCTGG - Intronic
1019505149 7:1386819-1386841 GGACTGAGGGCCCCGCTGCCTGG - Intergenic
1019857144 7:3620673-3620695 AGTCAGAAGGCCTGGCTGCCTGG + Intronic
1023326776 7:39069362-39069384 GGGCTGATGCCCAGGCTGTGAGG + Intronic
1023863402 7:44228031-44228053 GGGCAGATGCTCTGGCTGTCGGG + Intronic
1024723269 7:52162641-52162663 GTGCTGGTGCCCTGGCTGCAGGG - Intergenic
1025205692 7:56992292-56992314 GGGCTGAGGGCCTGTCACCCAGG - Intergenic
1025666248 7:63584646-63584668 GGGCTGAGGGCCTGTCACCCAGG + Intergenic
1025815088 7:64903584-64903606 TGGCTGCTGGGCTGGCAGCCGGG + Intronic
1026867533 7:73832732-73832754 GGGCTGGAGGCCTGGGTGCGGGG + Intergenic
1027174035 7:75892100-75892122 GTCCTGATGACCTGTCTGCCTGG + Intergenic
1029697824 7:102225974-102225996 GGGCTGAGGTCCTGCCTGCAAGG - Intronic
1032018170 7:128392753-128392775 GGCCTGAGAGCCTGGCTGGCTGG + Exonic
1033291204 7:140084316-140084338 GGTGTGGTGGCCTGGCTGGCTGG - Intergenic
1034255949 7:149724768-149724790 GGACTGAGGGGCTGCCTGCCAGG - Exonic
1035062090 7:156076827-156076849 GAGCTCATGGCCTGGAAGCCGGG + Intergenic
1036281510 8:7404818-7404840 GGGCTGTGGGAATGGCTGCCAGG - Intergenic
1036339961 8:7906754-7906776 GGGCTGTGGGAATGGCTGCCAGG + Intergenic
1036639520 8:10573651-10573673 GGGCTGTGGGAGTGGCTGCCAGG - Intergenic
1036737606 8:11331794-11331816 GGGCTGCTGGGCTGTGTGCCAGG + Exonic
1037657075 8:20893715-20893737 GGTAGGATGGGCTGGCTGCCAGG + Intergenic
1040278174 8:46024470-46024492 GGGCTGATGCAGAGGCTGCCAGG + Intergenic
1041135391 8:54752642-54752664 GGGATGATGGCATGGCGTCCTGG - Intergenic
1042733263 8:71960734-71960756 TGGCTCATGGCCACGCTGCCCGG - Intronic
1044677928 8:94748378-94748400 GGGCTGATGGAGTGGTTGCTGGG + Intronic
1046632131 8:116631580-116631602 GGGCTGAAGGCCTCTCTCCCTGG - Intergenic
1047208948 8:122825311-122825333 TGGCTTAGTGCCTGGCTGCCTGG + Intronic
1047778453 8:128092460-128092482 GGGCCAATGGCCAGGGTGCCGGG - Intergenic
1048304473 8:133273997-133274019 GGGCTGCTGGCCTAGGTGTCCGG - Intronic
1048525160 8:135195884-135195906 TGGCTCATCCCCTGGCTGCCAGG - Intergenic
1049059310 8:140263841-140263863 AGTCTGCTGGCCTGGCTACCCGG + Intronic
1049259153 8:141629524-141629546 GGCCTGCTGGACTGGCTGGCTGG + Intergenic
1049300619 8:141867596-141867618 GGGCTGCTGGCCAGGGTGTCAGG + Intergenic
1049431375 8:142566853-142566875 GCGCTGCTGCCCTGGCAGCCTGG + Intergenic
1049463998 8:142742840-142742862 GGGCTGCAGGCCAGGCTGCAGGG - Intergenic
1049613491 8:143566697-143566719 GTGATGATGGCCTGGCTGAGAGG + Exonic
1049666478 8:143845838-143845860 GGACTGCTGTCCTGGATGCCAGG + Intergenic
1051661414 9:19430504-19430526 GGTCTGCTGGGCTGGCTGACTGG + Intronic
1053058057 9:35005871-35005893 GGGCTGTGGGACTGGTTGCCAGG - Intergenic
1053078433 9:35154560-35154582 GGGCTGTGGGAGTGGCTGCCGGG + Intergenic
1053366348 9:37525056-37525078 GGGACCTTGGCCTGGCTGCCAGG + Intronic
1056378235 9:86035050-86035072 GGGCATGTGGCCTGCCTGCCAGG + Intronic
1056452202 9:86727213-86727235 TGGCTCTTGGCCTGGATGCCTGG + Intergenic
1057181820 9:93034700-93034722 GGGCTGCTGGCCTGAGGGCCTGG - Intronic
1057292038 9:93812977-93812999 GTGCTGATGGCCTGGAGCCCAGG + Intergenic
1057481281 9:95447350-95447372 GGGCTGCTGGCCTTGCCGTCCGG + Exonic
1058651069 9:107176246-107176268 GGGCTGATGGTCTGTTTGCAAGG - Intergenic
1059485991 9:114627111-114627133 GGGCTGTTGGCCCAGGTGCCTGG + Intronic
1059574647 9:115475742-115475764 GGGCTGTGGGAGTGGCTGCCAGG - Intergenic
1061448550 9:130656070-130656092 AGGCTGAGGCCCTGGCTGCAGGG + Intergenic
1062069189 9:134546300-134546322 GGGGTGCTGGCGTTGCTGCCCGG + Intergenic
1062099480 9:134720742-134720764 GGGCTGGTTGCCTGGCTGGTAGG + Intronic
1062211940 9:135369661-135369683 GGTCTGATGTGCTGGGTGCCTGG - Intergenic
1062573479 9:137195991-137196013 GAGCTGCTGGCCTGTGTGCCGGG - Intronic
1062590871 9:137274052-137274074 GGGGCGATGGCCCGGCTGCCAGG + Intergenic
1062590881 9:137274103-137274125 GGGGCGATAGCCTGGCTGCCAGG + Intergenic
1062668921 9:137694800-137694822 GAGCTGATGGCCTGCCTTCCAGG - Intronic
1189361774 X:40358935-40358957 GGCCTGAGAGCCTGGCTGGCTGG + Intergenic
1190360564 X:49644945-49644967 GGACTGGAGGCCTGGCTTCCAGG + Intergenic
1192173647 X:68872483-68872505 TGGCTCTGGGCCTGGCTGCCTGG + Intergenic
1192235099 X:69290550-69290572 GAGCTGATGGCCTGACAGCAGGG + Intergenic
1192496322 X:71618454-71618476 GGGCTGGTGCTCTGGCTGCTGGG + Exonic
1193044005 X:77033221-77033243 GTGCTGAAGGCCTGACTGGCAGG - Intergenic
1193735800 X:85154644-85154666 GGCCAGATGGCCAGACTGCCTGG - Intergenic
1193778759 X:85677375-85677397 GGTTTGGTGGCCAGGCTGCCTGG + Intergenic
1194413070 X:93579023-93579045 GGACTGGTGGCCTGGCACCCAGG - Intergenic
1195655019 X:107324917-107324939 AGGCTGGGGGCCGGGCTGCCAGG + Intergenic
1195655021 X:107324927-107324949 GGTCTGCCGGCCTGGCAGCCCGG - Intergenic
1195704112 X:107726154-107726176 GGGGAGATGGCCTTGTTGCCAGG - Intronic
1200149856 X:153946061-153946083 AGGCTGATGCCCTGGCAGCTGGG + Intergenic
1200212997 X:154355185-154355207 GGGCAGGAGGCCTGGCGGCCTGG - Intronic