ID: 1165831093

View in Genome Browser
Species Human (GRCh38)
Location 19:38730820-38730842
Sequence ATGGGCGCACCTGCTGCTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831093_1165831103 19 Left 1165831093 19:38730820-38730842 CCCTGAGCAGCAGGTGCGCCCAT 0: 1
1: 0
2: 0
3: 21
4: 107
Right 1165831103 19:38730862-38730884 GTGGCCACCTCCATCCACTAAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1165831093_1165831101 0 Left 1165831093 19:38730820-38730842 CCCTGAGCAGCAGGTGCGCCCAT 0: 1
1: 0
2: 0
3: 21
4: 107
Right 1165831101 19:38730843-38730865 CCGGAGATCCTAGGAGAAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 190
1165831093_1165831106 28 Left 1165831093 19:38730820-38730842 CCCTGAGCAGCAGGTGCGCCCAT 0: 1
1: 0
2: 0
3: 21
4: 107
Right 1165831106 19:38730871-38730893 TCCATCCACTAAGGAAGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1165831093_1165831099 -3 Left 1165831093 19:38730820-38730842 CCCTGAGCAGCAGGTGCGCCCAT 0: 1
1: 0
2: 0
3: 21
4: 107
Right 1165831099 19:38730840-38730862 CATCCGGAGATCCTAGGAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 95
1165831093_1165831096 -9 Left 1165831093 19:38730820-38730842 CCCTGAGCAGCAGGTGCGCCCAT 0: 1
1: 0
2: 0
3: 21
4: 107
Right 1165831096 19:38730834-38730856 TGCGCCCATCCGGAGATCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831093 Original CRISPR ATGGGCGCACCTGCTGCTCA GGG (reversed) Exonic
900520379 1:3102484-3102506 GGGGGCCCACCTGCAGCTCAGGG - Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
902976207 1:20090398-20090420 AGGGGCACAGCTGCTGCTCAGGG - Intronic
903339478 1:22644693-22644715 ATGGTAGCACCTGCTTCACAAGG + Intronic
904281942 1:29426775-29426797 ATGGGAGCATCTGGAGCTCAGGG + Intergenic
904557232 1:31373181-31373203 ATGGGCGCACCAGCCCCTCCTGG - Intronic
909581913 1:77246394-77246416 AAGGGAGCACCTGCAGATCAGGG + Intergenic
913534676 1:119759775-119759797 ATTGGCACACCTGCTACTCAGGG - Intronic
915501920 1:156325036-156325058 TTGGGTGCATCTGCTGCTCCAGG + Exonic
1063105700 10:2989633-2989655 ATTGGGGCACCTGGAGCTCAAGG + Intergenic
1063280454 10:4624029-4624051 ATGGGAGCACTTTCAGCTCAGGG + Intergenic
1065961678 10:30738891-30738913 ATGGGTGCACCTGCTACCCAGGG + Intergenic
1071598005 10:86942158-86942180 CTTGGCCCACCTGCTTCTCAGGG - Intronic
1073448966 10:103598257-103598279 TGGGGCACACCTGCTGCTCAGGG + Exonic
1073541996 10:104322344-104322366 CTGGGCACCCCTGCTGCTTAAGG - Intronic
1073592642 10:104771445-104771467 ATGGGCACATCTTCTGCCCAGGG - Intronic
1074969444 10:118523738-118523760 ATGCAAGCACCTACTGCTCAAGG + Intergenic
1075976759 10:126702764-126702786 ATGGCTTCACCTGCAGCTCAGGG + Intergenic
1076846805 10:133073205-133073227 ATGGGGGCTCCTGCTGCCCAGGG - Intronic
1077378412 11:2216212-2216234 CTGGGCGCACCGGATGCTCAGGG + Intergenic
1081461058 11:43273345-43273367 ATGGGTGCACCAGCTGGTAAGGG + Intergenic
1083171705 11:60927280-60927302 AGTGGCCCACCTGCTGCACACGG - Exonic
1084214665 11:67640823-67640845 CTGGGCGCAGCTGCAGCTCAGGG + Intergenic
1084982434 11:72837569-72837591 GTGGGGGCACCTGCTGCTGCAGG + Intronic
1086656064 11:89356906-89356928 ATGGGTCCACTTGCTGTTCATGG - Intronic
1089309660 11:117549228-117549250 ATGAGCCCACCTGCTGCTCCTGG - Intronic
1089366567 11:117924445-117924467 ATGGGCGCCCTTGATGCCCAGGG - Intronic
1091675574 12:2486681-2486703 CTGGGAGAACCTGTTGCTCAGGG - Intronic
1098676091 12:73291487-73291509 ATGGGAGAACTTGCTGATCATGG - Intergenic
1104668029 12:130661232-130661254 CTGGGTGCCCCTGCTGCTTAGGG + Intronic
1105247546 13:18666649-18666671 ATGGGCCCTGCAGCTGCTCAGGG + Intergenic
1108123573 13:47215978-47216000 ATGGGGGCAGCTGCAGCCCAAGG + Intergenic
1113384849 13:109839262-109839284 ATGGGCTCCCCTGCTCTTCAAGG + Intergenic
1113601144 13:111568996-111569018 CTGGGCCCACCTGCATCTCATGG - Intergenic
1114253842 14:20985009-20985031 ATGCGGGCAACTGCTGTTCAAGG - Intergenic
1117496552 14:56311265-56311287 AAGGGTACTCCTGCTGCTCAAGG - Intergenic
1118916200 14:70108635-70108657 ATTAGAGCAGCTGCTGCTCATGG + Intronic
1119478925 14:74947837-74947859 ATGGGCTGAGCTGCTGCTCCTGG - Intronic
1125685364 15:41560239-41560261 AGGTGCGGACCTGATGCTCAGGG + Intronic
1129205983 15:74037223-74037245 ATGGCGGCACCTTCTGCTCCAGG + Intronic
1132806129 16:1775974-1775996 AGGGGCCCACCTGCTGCAGAAGG - Exonic
1136339015 16:29629697-29629719 ATGGGCTCACCTGCAGCTTCTGG - Intergenic
1138344586 16:56312100-56312122 ATGGCCCCACCTCCTACTCACGG + Intronic
1141659731 16:85435493-85435515 ATGGGCGCACCTGCTGCGGGGGG - Intergenic
1142270639 16:89087551-89087573 ATAAGAGCACCTGCTGCTAATGG - Intergenic
1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG + Intronic
1144776548 17:17787787-17787809 CTGGCCCCACCTGCTGTTCATGG - Intronic
1151496603 17:74461844-74461866 AAGGACGCACCTGCAGCTCAGGG + Intergenic
1151693769 17:75703591-75703613 ATGTGTGGACCTGCTGCTCCTGG + Intronic
1151948082 17:77330228-77330250 CTTGGAGCACCTGCTGCTCCGGG + Intronic
1152258845 17:79255724-79255746 CCGGGGGCACCTGCAGCTCAGGG + Intronic
1152961455 18:82770-82792 GTGGGCGGACCTCCTGCTGATGG - Intergenic
1154410802 18:14141164-14141186 GAGGGCCCATCTGCTGCTCATGG - Intergenic
1154441291 18:14392472-14392494 ATGGGCCCTGCAGCTGCTCAGGG - Intergenic
1160677465 19:399074-399096 AAGGAGGCACCTGCCGCTCAGGG - Intergenic
1161044281 19:2126801-2126823 ATGCCGGCCCCTGCTGCTCAGGG - Intronic
1165110770 19:33500790-33500812 ATGGGAGCACCTGCGGCGCAGGG + Intronic
1165257755 19:34589861-34589883 ATGGCAGCACCTGCGGCTCCAGG - Intergenic
1165448835 19:35870972-35870994 GTGGGCGCAGCTGCCGCTCCGGG - Exonic
1165831093 19:38730820-38730842 ATGGGCGCACCTGCTGCTCAGGG - Exonic
1168418016 19:56181761-56181783 ATGGGCACACCTATTGCCCAGGG - Intronic
925476600 2:4223716-4223738 ACTGGGGCACCTGCTGCTCACGG - Intergenic
925885555 2:8391429-8391451 AATGGAGCACCTGCTGCTCAGGG + Intergenic
928377507 2:30787687-30787709 CTCTGCGCACTTGCTGCTCAGGG - Intronic
929244387 2:39686082-39686104 ATGGGGGCAGCTGCTGGCCAGGG + Intronic
930016431 2:46973978-46974000 CTGGGAGCACCAGCTGCTCCTGG - Intronic
930618097 2:53614920-53614942 GTGGTTGCTCCTGCTGCTCAAGG + Intronic
932415296 2:71569980-71570002 CTGGAGGCACCTGGTGCTCAGGG + Intronic
935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG + Intergenic
937096068 2:119235935-119235957 GTAGGAGGACCTGCTGCTCAGGG - Intronic
937126235 2:119476641-119476663 ATAGGCGGAGCTGGTGCTCACGG - Intronic
939158802 2:138560534-138560556 ATGGGCTCTCCAGCTGGTCATGG + Intronic
941173248 2:162165149-162165171 ACCGGGACACCTGCTGCTCAGGG + Intergenic
944241293 2:197487635-197487657 ATGGACTCAACTGCTACTCAAGG + Intronic
947140944 2:227018796-227018818 ATGGGCTCATCTGCTGCACGTGG - Intronic
948825399 2:240571354-240571376 TTGGGGGCACCTTCTACTCATGG + Intronic
1170582833 20:17711811-17711833 CTGGGTGCACCAGCTGGTCAAGG + Intronic
1173171109 20:40724643-40724665 ATGCCTGCCCCTGCTGCTCAAGG + Intergenic
1174158520 20:48533649-48533671 ATGAGCACTCCTGCTCCTCAGGG + Intergenic
1176183776 20:63766970-63766992 CTGAGCCCACCTGCTGCTCTGGG + Intronic
1176454766 21:6898702-6898724 ATGGGCCCTGCAGCTGCTCAGGG + Intergenic
1176832938 21:13763750-13763772 ATGGGCCCTGCAGCTGCTCAGGG + Intergenic
1176862256 21:14017255-14017277 GAGGGCCCATCTGCTGCTCATGG + Intergenic
1177405942 21:20668222-20668244 ATTGGAGCATCTGCTGCTAAGGG + Intergenic
1178128141 21:29538424-29538446 ATGGGGGCAGTTGCTGCTCAAGG + Intronic
1178381525 21:32113730-32113752 ATGGGCATACTTGCTGCTCATGG + Intergenic
1179902129 21:44399790-44399812 CTGGGAGCCCCTGCTGCTCCAGG - Intronic
1180590729 22:16935076-16935098 GTGAGGGCAGCTGCTGCTCAGGG + Intergenic
1181116840 22:20636693-20636715 AAGGGAGCACCTCCTGCTCATGG + Intergenic
1181584580 22:23846037-23846059 ATGGGCCCGTGTGCTGCTCATGG + Intergenic
1184655190 22:45937550-45937572 AGGTGCACACCTGCTGCCCAGGG - Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185145835 22:49136203-49136225 ATGGGCCCAGCTGTGGCTCATGG + Intergenic
1185147014 22:49143111-49143133 CTGGGCGCTGCTGCTGCTCTGGG - Intergenic
1185310493 22:50151627-50151649 CTGGGCCCAGCAGCTGCTCACGG - Intronic
953725928 3:45398847-45398869 ATGGGGGGACCTACTGTTCAAGG - Intronic
955405476 3:58623071-58623093 ATGGGCCTGCCTGGTGCTCAGGG - Intronic
956634068 3:71345805-71345827 CTGCCCGCACCTGCTGTTCATGG - Intronic
958899325 3:99867227-99867249 ATGGGTGAAACTCCTGCTCAGGG - Intronic
961041651 3:123682556-123682578 ATGAGCGCACAGGCTGCCCAGGG + Intronic
962272111 3:133984888-133984910 ATGGGAAAACCTGCTGCTCAAGG - Intronic
968735961 4:2296726-2296748 GGGGCGGCACCTGCTGCTCAAGG + Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
973096691 4:46210783-46210805 ATGGGTGGTTCTGCTGCTCATGG + Intergenic
976528746 4:86125512-86125534 ATATGCTCCCCTGCTGCTCAAGG + Intronic
985617608 5:933236-933258 AGGGCCTGACCTGCTGCTCAGGG - Intergenic
1002201962 5:177534024-177534046 ATGGGTGCTTCAGCTGCTCATGG - Intronic
1013608911 6:111775814-111775836 AGGGGCCCACAGGCTGCTCAGGG + Intronic
1016461746 6:144285809-144285831 ATGGGCTTACCTGCTGCCCGCGG - Intronic
1018899473 6:168043967-168043989 ATGCCCACACCTGCTGCTCACGG - Intronic
1019409078 7:898807-898829 CTGGCCCCACCTGCTCCTCAGGG - Exonic
1027601336 7:80245012-80245034 ATGGGGGCACCTGCCTCTGACGG + Intergenic
1030107084 7:105996379-105996401 AAGGACGCACCTGCGGCCCAGGG - Intronic
1033052153 7:138015296-138015318 CTGTGAGCACCAGCTGCTCATGG + Intronic
1033785492 7:144725262-144725284 ATAAGAGCACCTGCTTCTCAGGG + Intronic
1034299405 7:150002011-150002033 ATAGGCTCACCAGCTGCACACGG + Intergenic
1034806604 7:154094762-154094784 ATAGGCTCACCAGCTGCACACGG - Intronic
1035287769 7:157817038-157817060 ATGGGCCCTCTCGCTGCTCAAGG + Intronic
1040385069 8:46909542-46909564 ATGGTCCCACCTGCAGCCCAGGG + Intergenic
1041045489 8:53882454-53882476 AGGGGAGCAGCTGCTGCCCACGG + Intronic
1048986758 8:139738893-139738915 ATGGTCGCACCTTCCTCTCAGGG + Intronic
1049469673 8:142769719-142769741 CTGGGGCCACCTCCTGCTCAAGG - Intronic
1056554574 9:87677889-87677911 ATGGGCGCACCTGGTGCACGTGG + Intronic
1057227892 9:93302098-93302120 ACTGGCACATCTGCTGCTCATGG + Intronic
1058071777 9:100608790-100608812 ATTGGCTCACCTGGTTCTCAGGG - Intergenic
1060892624 9:127198431-127198453 ATGGGCGACCCTGCTTCTCCCGG - Intronic
1062736699 9:138141348-138141370 GTGGGCGGACCTCCTGCTGATGG + Intergenic
1186387470 X:9124730-9124752 ATTGGAGCCACTGCTGCTCAAGG + Intronic
1200398923 X:156007423-156007445 GTGGGCGGACCTCCTGCTGATGG + Intronic