ID: 1165831232

View in Genome Browser
Species Human (GRCh38)
Location 19:38731349-38731371
Sequence TCAGCCTGTACTCACCCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165831232_1165831234 -5 Left 1165831232 19:38731349-38731371 CCGGCAGGGTGAGTACAGGCTGA 0: 1
1: 0
2: 0
3: 28
4: 179
Right 1165831234 19:38731367-38731389 GCTGATCCCTTCAATCCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 140
1165831232_1165831239 19 Left 1165831232 19:38731349-38731371 CCGGCAGGGTGAGTACAGGCTGA 0: 1
1: 0
2: 0
3: 28
4: 179
Right 1165831239 19:38731391-38731413 CTGTTTCCTCATCCATCAAACGG 0: 2
1: 23
2: 201
3: 1323
4: 5239
1165831232_1165831233 -6 Left 1165831232 19:38731349-38731371 CCGGCAGGGTGAGTACAGGCTGA 0: 1
1: 0
2: 0
3: 28
4: 179
Right 1165831233 19:38731366-38731388 GGCTGATCCCTTCAATCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165831232 Original CRISPR TCAGCCTGTACTCACCCTGC CGG (reversed) Exonic
900143635 1:1148901-1148923 TCAGCCTGCACTCGGACTGCGGG + Intergenic
900143646 1:1148946-1148968 TCAGCCTGCACTCGGACTGCGGG + Intergenic
900143657 1:1148991-1149013 TCAGCCTGCACTCGGACTGCGGG + Intergenic
900143667 1:1149036-1149058 TCAGCCTGCACTCGGACTGCGGG + Intergenic
900431029 1:2603329-2603351 TCAGCCGACTCTCACCCTGCTGG - Intronic
901469253 1:9444248-9444270 CCTGCCTGTGCTCATCCTGCAGG - Intergenic
901871659 1:12142168-12142190 TCAGCCTGAAGCCACCCGGCAGG + Intronic
906006174 1:42473222-42473244 TCAGCCTGTCTTCACTGTGCTGG - Intronic
906153637 1:43601807-43601829 TCAGCGGGTCCTCTCCCTGCAGG + Intronic
906249939 1:44303191-44303213 TCACCCAGTACTCACCATGGAGG + Intronic
907111659 1:51931898-51931920 TCAACCTGTAGTCTCCCTGGAGG - Intronic
910870304 1:91827249-91827271 CCAGCCTGTACACGCCCCGCTGG - Intronic
910968947 1:92834906-92834928 TCATCTTGTACATACCCTGCGGG - Exonic
911945231 1:104098873-104098895 TCAGCCTGTTTTCTCTCTGCAGG - Intergenic
912132463 1:106619663-106619685 TGAGCATGTGCACACCCTGCCGG - Intergenic
917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG + Intronic
919958165 1:202439280-202439302 CCTCACTGTACTCACCCTGCTGG - Intronic
920059413 1:203217243-203217265 TCTGGCTGTACTCAGCCTGTAGG - Intronic
920213787 1:204347986-204348008 CCAGCCTCTACTCACCCAGCTGG + Intronic
920434696 1:205940252-205940274 CCAGCCTGTGCCCTCCCTGCAGG - Intronic
920525733 1:206664472-206664494 TCACCCTGGACTCACACCGCAGG - Intronic
920748271 1:208649438-208649460 TCAGTCTGTTCTCATGCTGCTGG - Intergenic
922984688 1:229857261-229857283 TCAGCTTGTATTTACTCTGCTGG + Intergenic
923248776 1:232160280-232160302 TTAGTCTGTTTTCACCCTGCTGG - Intergenic
923446898 1:234080105-234080127 TCAGCCTCTCCTCTCCCTGGAGG - Intronic
1066566739 10:36729198-36729220 TCAGGGTGTATTCATCCTGCTGG + Intergenic
1067089830 10:43261010-43261032 TCAGCCTGTGCGCACCCACCAGG + Intronic
1067190684 10:44065410-44065432 TCAGCCTCTACACACCACGCTGG - Intergenic
1067485695 10:46647859-46647881 TCAGCCTGTTCTCATGCTGTGGG + Intergenic
1067609063 10:47693792-47693814 TCAGCCTGTTCTCATGCTGTGGG - Intergenic
1070915927 10:80154718-80154740 TCAGCCTGGAGGCACCCTGAGGG + Exonic
1071624650 10:87155437-87155459 TCAGCCTGTTCTCATGCTGTGGG - Intronic
1071855883 10:89623861-89623883 TCAGCCTCTTCCCACCCTGAGGG - Intronic
1073754200 10:106563581-106563603 TCGGCCTGCACTCACCTTCCTGG - Intergenic
1074423122 10:113326879-113326901 TCAGCCTGAAGTGACCCAGCTGG - Intergenic
1074535494 10:114325787-114325809 TCAGCCTTTTCTCAGGCTGCTGG - Intronic
1075297511 10:121291359-121291381 TCACCCTGGAATCACCCGGCTGG - Intergenic
1077138561 11:1013500-1013522 GCGGCTCGTACTCACCCTGCAGG - Exonic
1077866245 11:6223909-6223931 TGAGGCTCTGCTCACCCTGCTGG - Exonic
1078063326 11:8062003-8062025 TCAGCCCGTTCTCACTCGGCAGG + Intronic
1079924033 11:26470198-26470220 TCAGCCTGTTCTCAAACTCCTGG - Intronic
1080111878 11:28576944-28576966 TCAGTCTGTACTTCCTCTGCAGG + Intergenic
1081860731 11:46332281-46332303 TCAGCCTCTCCTGACCCAGCAGG + Intergenic
1083978868 11:66148354-66148376 TGAGGCTGTACTCACACTCCAGG + Intronic
1084562354 11:69911930-69911952 TCTGCCTGGCCTCCCCCTGCAGG - Intergenic
1086230431 11:84562959-84562981 TCAGGCTGTTCTCAAACTGCTGG + Intronic
1086549705 11:88041894-88041916 TCAGCCTCCCCTCATCCTGCTGG + Intergenic
1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG + Intergenic
1088623572 11:111711592-111711614 ACAGCCTGGACTCAGCCTGCTGG - Intronic
1089761341 11:120726352-120726374 TCTGCCTCTATTCTCCCTGCAGG - Intronic
1090888931 11:130905701-130905723 TCAGCATGATCTCATCCTGCTGG + Intronic
1091300466 11:134504014-134504036 TCACCCTGGACTCAACCTTCAGG - Intergenic
1101997978 12:109538698-109538720 CCAGCATCTCCTCACCCTGCTGG - Intergenic
1102305418 12:111801010-111801032 TGAGTCTGTTCTCACACTGCTGG + Intronic
1103925174 12:124419809-124419831 GGAGCCTGCACTCACACTGCCGG + Intronic
1104531115 12:129572033-129572055 TCCGCAGGTACTCACCCTGCAGG + Intronic
1105203781 13:18202305-18202327 TCTGCCTGTGCTGACCCTGCAGG + Intergenic
1107130892 13:36894489-36894511 TTAGTCTGTTCTCACACTGCTGG - Intronic
1107335316 13:39348471-39348493 TCAGCCTGAACTCACAGGGCTGG - Intronic
1110063599 13:71071889-71071911 GCAGCCTGTACACAACTTGCAGG - Intergenic
1110796404 13:79643584-79643606 TCAGGCTGCATTCAACCTGCTGG + Intergenic
1112107428 13:96256529-96256551 TCAGCCTCTTCTCAGCCAGCTGG + Intronic
1112393212 13:99003820-99003842 TCATACTGTACTTATCCTGCAGG - Intronic
1113483042 13:110635581-110635603 GCAGCCGCCACTCACCCTGCTGG - Exonic
1113952270 13:114078771-114078793 TGGGCCTGTGCTCACCCTGAGGG - Intronic
1113987779 13:114332234-114332256 TCAGAGGCTACTCACCCTGCAGG - Intergenic
1120637245 14:86967292-86967314 TTAGTCTGTATTCACACTGCTGG - Intergenic
1125767590 15:42145751-42145773 CCAGCCTCGACTCACCTTGCAGG + Exonic
1126172881 15:45708799-45708821 TCAGGCCTTTCTCACCCTGCAGG + Intergenic
1126533007 15:49731655-49731677 TCTGCCTGAACTCAGCCAGCAGG + Intergenic
1132387416 15:101410281-101410303 TCAGCCTGCACTCACCTTGGAGG + Intronic
1132661908 16:1065475-1065497 CCAACCTGCACTCACCCTGTGGG - Intergenic
1133098864 16:3467017-3467039 ACAGGCTGTCCGCACCCTGCAGG - Intronic
1133382243 16:5341126-5341148 TCATCCTGCACCAACCCTGCTGG - Intergenic
1136372971 16:29847740-29847762 TCCTCCTGTTCTCACCCTCCAGG + Exonic
1140170580 16:72599891-72599913 CCGGCCTGGACTCACCCTACAGG - Intergenic
1141502642 16:84454530-84454552 TGAGCCTTTACTGACCGTGCTGG + Intronic
1143294731 17:5862311-5862333 TCAGCCTGTATGTAACCTGCAGG - Intronic
1144654308 17:17025504-17025526 GCACCCTGTACTCTCCCTCCTGG + Intergenic
1144678968 17:17180212-17180234 CCAGCCCGAGCTCACCCTGCTGG + Intronic
1144873240 17:18383056-18383078 GCAGCCTGTACACGCACTGCAGG + Exonic
1151678729 17:75613271-75613293 GCAGCCTGTGCCCGCCCTGCAGG + Intergenic
1152166338 17:78710051-78710073 TCAGCCTGAAGTCTCCCAGCTGG - Intronic
1152511220 17:80790398-80790420 TCAGCCTCCCCTCGCCCTGCAGG + Intronic
1152557974 17:81064029-81064051 CCAGCCTGTCCTCTCTCTGCTGG + Intronic
1153522059 18:5962731-5962753 TGAGTCTGTACAGACCCTGCTGG - Intronic
1160018687 18:75163994-75164016 TCAGCCTCCACTCTCCCAGCTGG - Intergenic
1160159453 18:76460214-76460236 TCTGCCTGCACTCACCGTCCAGG + Intronic
1162728433 19:12703370-12703392 TTAGCCTGTTCTCAACCTGGGGG - Intronic
1163392165 19:17037336-17037358 TCCGCCTGTGCTCACCCTGTAGG - Intergenic
1165806571 19:38584397-38584419 TCAGCCTGTACCCTCCATCCTGG + Intronic
1165831232 19:38731349-38731371 TCAGCCTGTACTCACCCTGCCGG - Exonic
1167320904 19:48796703-48796725 CCACCCGGAACTCACCCTGCAGG + Exonic
1167457266 19:49603277-49603299 TCAGCCCATTCTCACCCTGATGG + Intronic
1167510063 19:49891107-49891129 TCGGCCTGTGCCCAACCTGCAGG - Exonic
925715022 2:6775903-6775925 TGAGCCTGCGCTCATCCTGCAGG - Intergenic
927690475 2:25204542-25204564 GCAGCCTCTGCTCACCCTGCAGG - Intergenic
927853302 2:26513284-26513306 TCATCCTGTCCTCACTCTGGGGG - Intronic
931188224 2:59974422-59974444 TGAGCCTGTAATTACCCTGGAGG - Intergenic
934518018 2:95001037-95001059 TCAGCCTGTACTCACACATATGG + Intergenic
939082251 2:137676146-137676168 GCAGCCAGGCCTCACCCTGCTGG - Intronic
940006071 2:149010495-149010517 GCACCCTGTGCTCACCCTGTGGG + Intronic
940123450 2:150294622-150294644 CCAGCCTCAACTCACCCTTCTGG - Intergenic
942027875 2:171928333-171928355 TGAGACTGTAGTCACCTTGCAGG - Intronic
946907291 2:224429370-224429392 TCAGCCTGAGATGACCCTGCAGG - Intergenic
947748337 2:232520688-232520710 CCAGCCTGGACTTACCTTGCAGG - Exonic
1170501717 20:16981548-16981570 CCAGCCTCTGCTCATCCTGCAGG - Intergenic
1171389136 20:24790020-24790042 TCAGACCGCATTCACCCTGCAGG + Intergenic
1173817339 20:45998188-45998210 TCAGCCTGGACTGACCCTGGAGG + Intergenic
1174489071 20:50879582-50879604 TCAGCAGATACTCACCCTTCCGG - Intronic
1174740284 20:53006555-53006577 CCAGTCTGTAGTCACCATGCAGG + Intronic
1176714187 21:10335781-10335803 TCTGCCTGTGCTGACCCTGCAGG - Intergenic
1177244010 21:18498544-18498566 TCATCCTGTTCTCACCCTTTGGG - Intergenic
1178481270 21:32981282-32981304 TGTGCCTGGACTCACCCAGCTGG + Intergenic
1179164463 21:38924792-38924814 GCAGCCTGTAGTCCCCCTGAAGG - Intergenic
1179975216 21:44861594-44861616 TCAGCCTCAGCTCAGCCTGCCGG + Intronic
1180001578 21:44997683-44997705 TCAGCCTGTGCTCCTCCTCCTGG - Intergenic
1180090817 21:45533117-45533139 ACAGCCTGTGCTCCCCCTCCTGG - Intronic
1180761250 22:18209675-18209697 TCTGCCTGTGCTGACCCTGCAGG - Intergenic
1180774417 22:18414944-18414966 TCTGCCTGTGCTGACCCTGCAGG + Intergenic
1180807570 22:18725761-18725783 TCTGCCTGTGCTGACCCTGCAGG + Intergenic
1180921151 22:19522338-19522360 AGAGCCTGTACCCACCCTGCTGG - Intergenic
1180975154 22:19844111-19844133 TCAGCATGTAGGCACCGTGCTGG - Intronic
1181070531 22:20333952-20333974 TCTGCCTGTGCTGACCCTGCAGG + Intergenic
1181193516 22:21161894-21161916 TCTGCCTGTGCTGACCCTGCAGG + Intergenic
1181215929 22:21330704-21330726 TCTGCCTGTGCTGACCCTGCAGG - Intergenic
1183082845 22:35467888-35467910 ACAGCCTGTCCTCAGCCTGCAGG - Intergenic
1183432235 22:37772785-37772807 TCAGCCCCTGCCCACCCTGCAGG - Intronic
1184329435 22:43817472-43817494 TCACCCTCTGCCCACCCTGCGGG + Intergenic
1184340912 22:43885379-43885401 TCAGCCTCTTCCCACCCAGCTGG + Intronic
1184417718 22:44361946-44361968 TCAGGCTGGAGTCCCCCTGCAGG + Intergenic
1185205459 22:49535645-49535667 TCAGCCTCTGCCCACCCTCCTGG - Intronic
950405291 3:12800456-12800478 CCAGCTTTTACTGACCCTGCTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954614308 3:51961718-51961740 TCAGCCTGAACTCCACCTTCAGG - Intronic
956007296 3:64794322-64794344 TCAGCCTGTGCTCACTGTACTGG + Intergenic
960446378 3:117753937-117753959 ACTACCTGTCCTCACCCTGCAGG + Intergenic
961270595 3:125684813-125684835 TCAGAATGTAAGCACCCTGCAGG - Intergenic
962809277 3:138947330-138947352 TCTGCCGGTACTCGCTCTGCGGG + Exonic
967826388 3:193881014-193881036 ACAGCCTGTTCTCTCCCTGCAGG + Intergenic
968271082 3:197404256-197404278 ACGGCCTGTCCTCACCCTTCGGG - Intergenic
968500653 4:948327-948349 TCAGCCTGTGCTCACCCCGGCGG + Intronic
968930123 4:3574506-3574528 TCAGCCCGTTCTCATCCTTCAGG - Intergenic
969256978 4:6008820-6008842 TCAGCGAGTACACACCCTGAGGG + Intergenic
969671861 4:8594093-8594115 CCACCCTGTCCTCACCCAGCAGG + Intronic
971950608 4:33340513-33340535 TCAGCCAGAACTCAGCCTGGAGG + Intergenic
973841590 4:54866596-54866618 TCAGCCTTTGCACACCCTGATGG - Intergenic
974428090 4:61765673-61765695 ACACCCTGTACACACCCTGTAGG + Intronic
976461845 4:85320853-85320875 TCTGCATTTACTCACCCTCCAGG + Intergenic
977228808 4:94427197-94427219 TCAGGCTGGACTCACACTCCTGG - Intergenic
982032625 4:151315740-151315762 TCAGGCTGTACTCAGACTCCTGG - Intronic
982056843 4:151559167-151559189 TCAGGCTATACTCATCGTGCAGG + Intronic
982698867 4:158636179-158636201 TCAGGCTGTACTCAAACTCCTGG - Intronic
984870293 4:184319085-184319107 GCAGCCTGCACTTAACCTGCCGG - Intergenic
986818415 5:11437957-11437979 ACAGCCTATACTGACCCTGCAGG - Intronic
989515277 5:42336605-42336627 TCAGCTTGTACTCACTGAGCAGG - Intergenic
990308370 5:54515852-54515874 ACAGCCTGTCCTCATCCTTCTGG + Intergenic
992149884 5:73892426-73892448 TCTGCCTGTGTGCACCCTGCCGG + Intronic
992345216 5:75869278-75869300 TCACCTTGGACTCACCCTACAGG - Intergenic
992648254 5:78832342-78832364 ACAGCCTCTCCCCACCCTGCTGG - Intronic
993007546 5:82444602-82444624 TCAGCCTGTTAGCACCCTTCTGG - Intergenic
993187129 5:84635448-84635470 TGAGCCTGCACACACCCAGCTGG + Intergenic
994273508 5:97809100-97809122 TCTGCATTTACTCACCCTTCAGG + Intergenic
994702796 5:103158247-103158269 TCAGCCTGGACCCTGCCTGCAGG - Exonic
995526326 5:113053338-113053360 TCACCCTGTTCTCCCCCTGCCGG + Intronic
998392908 5:141798908-141798930 TTAACCTGTACTCATCCTTCAGG + Intergenic
1002105913 5:176879419-176879441 CCAGCCTGGACCCACCCTGTAGG + Exonic
1002293642 5:178215888-178215910 CCACCCTGTCCTCATCCTGCAGG + Intronic
1002809895 6:617631-617653 ACACCCTGTAAACACCCTGCAGG + Intronic
1006449786 6:34099302-34099324 TCAGCCTGCCCTCAGCCTGCAGG + Intronic
1006744510 6:36331888-36331910 AGAGCCTGTCCTCACCCTGACGG + Intronic
1007909871 6:45502867-45502889 CCAGGCTGTGCTGACCCTGCTGG - Intronic
1010951720 6:82044993-82045015 TTAGTCTGTTCTCACACTGCTGG + Intergenic
1012349561 6:98233663-98233685 TCAGCCTGTTTTCATACTGCCGG + Intergenic
1015653801 6:135494689-135494711 TCAGCCTATTGTCTCCCTGCTGG - Intronic
1017027517 6:150194211-150194233 TTAGTCTGTTCTCACGCTGCTGG - Intronic
1017561624 6:155634365-155634387 TCAGCCTGGACTCAGGATGCTGG + Intergenic
1020272560 7:6606078-6606100 TGAACCTGTACACACCCTGCCGG - Intronic
1020760361 7:12261435-12261457 TCACCCTGGACACACCCTGCCGG - Intergenic
1022051221 7:26675212-26675234 TTAGCTTGTTCCCACCCTGCTGG + Intronic
1024321983 7:48079744-48079766 TCAGTGTTCACTCACCCTGCAGG - Intergenic
1026179060 7:68022728-68022750 TCAGCCTGCACTCACCAGGTCGG + Intergenic
1026865812 7:73823348-73823370 TAAGCTTTTACTCACCCTTCAGG + Intronic
1027765516 7:82335974-82335996 ACAGCCTGTACACACTCAGCAGG + Intronic
1029376626 7:100181044-100181066 TCAGCATGTACCAACCCTGGTGG + Intronic
1032304750 7:130722176-130722198 GCAGCCTCTTGTCACCCTGCCGG - Intergenic
1034267336 7:149787558-149787580 CCCGCCTGCACTCACCGTGCAGG - Intergenic
1034700907 7:153094874-153094896 TCAGCCTGTACTCCCTCCTCTGG - Intergenic
1038625878 8:29192934-29192956 GCAGCCTGTGCTCTCCCTGCAGG - Intronic
1041835572 8:62209660-62209682 TCTGCCTGTGCTGACCCTGCAGG + Intergenic
1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG + Intergenic
1043863838 8:85353037-85353059 GCAGCCTGTACTCTCCCCTCTGG - Intronic
1044079085 8:87861758-87861780 TCTGCCTGTTCTCAGCCTGCTGG + Intergenic
1044087795 8:87962213-87962235 TCAGCCTGTTCTCAAACTCCTGG + Intergenic
1044474523 8:92610645-92610667 GCAACTTGGACTCACCCTGCCGG - Intergenic
1044594138 8:93941978-93942000 TCCGCATTTACTCACCCTTCAGG + Intergenic
1049229596 8:141475105-141475127 CCAGCCTGGACTCACCCTTGGGG + Intergenic
1054459957 9:65457299-65457321 TCAGCCCGTTCTCATCCTTCAGG + Intergenic
1058888741 9:109342941-109342963 TTTGCCTATACTCACCCTGCTGG - Intergenic
1059284942 9:113164456-113164478 TCAGCATCTTCTCTCCCTGCGGG + Intronic
1060493844 9:124103666-124103688 TCAGGCTGGTCTCACCCTCCTGG + Intergenic
1061793495 9:133070965-133070987 ACAGCCTCTTCTCACTCTGCAGG + Exonic
1061796103 9:133086764-133086786 ACAGCCTCTTCTCACTCTGCAGG + Intronic
1062502676 9:136858090-136858112 CCACCCTGCACTCACCCTCCAGG - Exonic
1062732941 9:138119677-138119699 TCAGCCTGCACCCACCCACCAGG - Intronic
1185470443 X:378540-378562 GAATCCTGTCCTCACCCTGCAGG + Intronic
1188207714 X:27380610-27380632 TGAGCGTGTACACACCCGGCCGG - Intergenic
1194400408 X:93433478-93433500 CCAGGCTGCACTCCCCCTGCCGG - Intergenic