ID: 1165846060

View in Genome Browser
Species Human (GRCh38)
Location 19:38818398-38818420
Sequence CTGGGGACACAGGTGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 431}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165846060_1165846075 25 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846075 19:38818446-38818468 AAGCCAGTGGACACCTTCTTGGG 0: 1
1: 0
2: 1
3: 7
4: 151
1165846060_1165846067 0 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846067 19:38818421-38818443 TCTATTCCCTACAGGCAGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 140
1165846060_1165846068 1 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846068 19:38818422-38818444 CTATTCCCTACAGGCAGCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 122
1165846060_1165846074 24 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846074 19:38818445-38818467 GAAGCCAGTGGACACCTTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 164
1165846060_1165846069 2 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846069 19:38818423-38818445 TATTCCCTACAGGCAGCCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1165846060_1165846063 -8 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846063 19:38818413-38818435 GTCCCCAGTCTATTCCCTACAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1165846060_1165846072 12 Left 1165846060 19:38818398-38818420 CCTGTTTCCACCTGTGTCCCCAG 0: 1
1: 0
2: 5
3: 38
4: 431
Right 1165846072 19:38818433-38818455 AGGCAGCCAGGGGAAGCCAGTGG 0: 1
1: 1
2: 5
3: 89
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165846060 Original CRISPR CTGGGGACACAGGTGGAAAC AGG (reversed) Intronic
900422059 1:2560005-2560027 CTGGGGACCAGGGTGGAAATGGG - Intronic
900794912 1:4702075-4702097 CTGGGGACACATGAGAACACTGG - Intronic
900794922 1:4702132-4702154 CTGGGGACACATGAGAACACTGG - Intronic
900796445 1:4711442-4711464 CTGGGGTCCCAGGTGGAGGCCGG + Intronic
900944529 1:5822376-5822398 ATGGGGACACATATGCAAACGGG + Intergenic
901160371 1:7172721-7172743 CTGGGGAGACAGGAGGACACTGG + Intronic
901305044 1:8226767-8226789 CTGGGGACACAGGGGGGCCCAGG + Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903186056 1:21629610-21629632 ATGGGGACAGAGAAGGAAACTGG + Intronic
903577714 1:24349189-24349211 CTGGGGAGACAGGCTGACACTGG + Intronic
903891494 1:26573201-26573223 CTGGGGACACAGTGGGCAAGGGG - Intronic
904725121 1:32540821-32540843 CTGGCCACACAAGTGGCAACTGG + Intronic
904767999 1:32864940-32864962 GTGAGGGCACAGGTGAAAACAGG - Intronic
904966842 1:34380760-34380782 CTGGGGTCACTGGGGGCAACTGG - Intergenic
905695415 1:39969961-39969983 CTGAGGACACAGACAGAAACAGG - Exonic
905733623 1:40312162-40312184 CTGGGCACAAAGGTAGAGACAGG + Intronic
906250543 1:44307674-44307696 GTGGGGACAAAGGAGGAAAGAGG + Intronic
906345145 1:45010283-45010305 CTGTGCCCACAGGTGGGAACAGG - Exonic
906657361 1:47558433-47558455 GTGGAGACACAGGTGTAGACAGG + Intergenic
907272603 1:53299618-53299640 CTGGGCACACAGGTGGGCACAGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907413001 1:54295443-54295465 AAAGGGACACGGGTGGAAACTGG - Intronic
908356417 1:63328210-63328232 CCGGGGACACAGGTGGAGTCCGG - Intergenic
908683916 1:66692886-66692908 CTGATGCCACAGGTGAAAACAGG + Intronic
909758257 1:79255259-79255281 GTGGTGACTCATGTGGAAACTGG + Intergenic
910238239 1:85058218-85058240 CTGGGGACTAAGGAGGACACAGG - Intronic
910333230 1:86099786-86099808 GGTGGGAGACAGGTGGAAACAGG - Intronic
910866846 1:91796626-91796648 CAGAGGACACAGGAGGAAATGGG + Intronic
911527848 1:99006715-99006737 CTGGGGACACAGCAGTGAACAGG - Intergenic
911592053 1:99759504-99759526 CTGGGGATAGAGGTGGAAATAGG + Intronic
912996443 1:114536571-114536593 CTGGTGACGGAGGTGGAAACTGG + Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915419273 1:155766504-155766526 CTGGGGAAACGGGTGGCAACTGG + Exonic
915477466 1:156161323-156161345 CTGGGGGCACAGGGGGAGTCAGG - Intronic
915571319 1:156746811-156746833 CTGGGGCCCCAGGCGCAAACAGG + Intronic
916059518 1:161089050-161089072 CTGGGGGCACTGCTGGAAGCTGG + Intronic
918371574 1:183866803-183866825 CTGGGGACAAGGGTGGGAGCAGG + Intronic
918706393 1:187668294-187668316 CTAGGGACACAAATGGAATCAGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920096987 1:203492664-203492686 CTGGGGAAGAAGGTGGAAATGGG + Intergenic
920130694 1:203729692-203729714 CTGGGGACACAGGTGCTTCCTGG + Intronic
920733003 1:208505522-208505544 CAGGGAACACAGGTAGAACCAGG + Intergenic
921262243 1:213394624-213394646 CTGGGAAGTCAGGTGGAAATGGG + Intergenic
922237276 1:223731549-223731571 CAGGAGACAGACGTGGAAACTGG - Intronic
922502015 1:226104339-226104361 CTTGGGACACAGGTGAACTCGGG - Intergenic
922869950 1:228894283-228894305 CTGTGGACACACGTGAAAACTGG - Intergenic
923105938 1:230853912-230853934 CTGGGGCCAGAGTGGGAAACAGG - Intronic
923220283 1:231886531-231886553 CTGTAGACACACGTGCAAACTGG - Intronic
923544557 1:234914700-234914722 CTGGAGATACAGCTGTAAACAGG + Intergenic
1063972810 10:11393273-11393295 GTTGGGACACATATGGAAACTGG + Intergenic
1065195081 10:23256640-23256662 CTGGGGACACATGTTAAAAGTGG + Intergenic
1065915193 10:30349225-30349247 CCGGGCACACAGGTTCAAACGGG + Exonic
1066131758 10:32401182-32401204 CTGGGGACTGAGGAGGCAACTGG + Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1066921162 10:41498850-41498872 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066921405 10:41503600-41503622 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066921527 10:41505975-41505997 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066921630 10:41508012-41508034 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066921753 10:41510386-41510408 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066921870 10:41512761-41512783 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066921996 10:41515136-41515158 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066922117 10:41517511-41517533 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066922220 10:41519546-41519568 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066922346 10:41521922-41521944 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066922467 10:41524297-41524319 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066922570 10:41526333-41526355 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066922693 10:41528708-41528730 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066923052 10:41535833-41535855 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066923172 10:41538207-41538229 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1066923411 10:41542957-41542979 TTGAGGACTCAGTTGGAAACGGG + Intergenic
1067062311 10:43083734-43083756 AGGGGGACAGAGGGGGAAACAGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067473793 10:46553542-46553564 CTGAGGAGACAGGTGGAATGAGG + Intronic
1067668423 10:48298714-48298736 CTGGGGCAACAGGTATAAACTGG + Intergenic
1067712245 10:48658600-48658622 GTGGGTACACAGCTGGGAACAGG + Intergenic
1068602147 10:58967648-58967670 CTGGGGACAGAGGAGGTTACAGG - Intergenic
1069534336 10:69241837-69241859 CTGGGGACAAGAGTGGAAGCAGG + Intronic
1069860474 10:71468117-71468139 CTGGGGACAGAGGAGGACAGGGG - Intronic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1069958750 10:72067540-72067562 CTGAGGACACAGGTGTATGCTGG - Intronic
1070071695 10:73096532-73096554 CTAGGGACAGAGGTGGGAAGGGG + Intronic
1070174987 10:73962615-73962637 TTGGGGACAAAGATGGACACAGG - Intergenic
1070566550 10:77607655-77607677 CTGGGGATGCAGGTGGCTACTGG + Intronic
1070889126 10:79929076-79929098 CAGGTCACACAGGTGCAAACTGG - Intergenic
1071740067 10:88348065-88348087 CAAGGGTCACAGGTGGGAACTGG - Intronic
1071837626 10:89434976-89434998 CTGGAGAGACAGGAGTAAACAGG - Intronic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1073224285 10:101903846-101903868 CTGAGCAAACAGGTGTAAACAGG - Intronic
1073272130 10:102274219-102274241 CTGAGGTCACGTGTGGAAACTGG - Intronic
1073452428 10:103617748-103617770 TCTGGGACACAGATGGAAACAGG - Intronic
1073599620 10:104834083-104834105 CTGGGGAGACAGGTGAAGAGGGG - Intronic
1074104997 10:110382740-110382762 CAGGGGACAGAGGTGGCATCAGG + Intergenic
1075200202 10:120395940-120395962 ATGTGGACACAGGTGCACACAGG + Intergenic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075822020 10:125322743-125322765 TGGGGGGCAAAGGTGGAAACAGG + Intergenic
1075926951 10:126258953-126258975 CTGGGGACACGGTAGGGAACAGG - Intronic
1075970777 10:126650347-126650369 CTGGGAACAGAGGTGAAAAATGG - Intronic
1076163377 10:128263149-128263171 CTGGGGTCGCAGGTGGGAGCTGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076790872 10:132776055-132776077 CCGCGGACACGAGTGGAAACTGG - Intronic
1077029983 11:461063-461085 ATGGGGACAGAGGTGGAAGGAGG + Intronic
1077092049 11:783025-783047 CTGGGGACAGAGGTGTCCACGGG - Intronic
1079397308 11:20075939-20075961 CTGAGAACACAGGTGTAGACAGG - Intronic
1080862735 11:36163914-36163936 CTAGGGACAAAGATGAAAACGGG - Intronic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1083398122 11:62405233-62405255 CTGGAGAGACAGGTGGGAACAGG + Intronic
1084536786 11:69762071-69762093 TTGGGGACACAGGGAGAAGCTGG + Intergenic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085465829 11:76722584-76722606 CTGGGGACACAGGCAGGATCTGG - Intergenic
1085695824 11:78703651-78703673 CTAGAGACACAGGTGGCAAAGGG - Intronic
1086402157 11:86469748-86469770 CTGGGGACTCAGCTGGGAAATGG + Intronic
1087171154 11:95051094-95051116 CCAGGGACACTGGTGGAGACTGG + Intergenic
1087954716 11:104271383-104271405 TAGGAGACACAGGTGGTAACTGG - Intergenic
1088753868 11:112868928-112868950 CTGAGGCCACAGGAGGAAAGAGG - Intergenic
1089111742 11:116062723-116062745 CAGGGGAGAGAGGAGGAAACGGG + Intergenic
1089136028 11:116250044-116250066 CTGGGGACCCATGAGGACACAGG - Intergenic
1089852957 11:121516178-121516200 TAGGGGACAAAGGTGGGAACAGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090583294 11:128183085-128183107 CAGGGCACACAGCTTGAAACCGG + Intergenic
1090879495 11:130821120-130821142 CTGCAGAAACAGGAGGAAACAGG + Intergenic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091291261 11:134441155-134441177 CTGAGGTCACAGTTGGAAAAGGG + Intergenic
1091782779 12:3224498-3224520 CTGGGGGCAGAGGCGGAATCAGG + Intronic
1092116755 12:6014378-6014400 CAGGGGACAAAGGTGGAAGCTGG + Intronic
1093025349 12:14240605-14240627 GTGGGGACACTGTAGGAAACAGG - Intergenic
1093438338 12:19163758-19163780 CTGAGGACTCAGGTGAAATCTGG - Intronic
1093566369 12:20609781-20609803 AGGAGGACACAGGTGGAAAGGGG + Intronic
1095560351 12:43557358-43557380 TTGGGGACTCAGGGGGAAAGAGG - Intergenic
1095702537 12:45205169-45205191 TAGGGGACAGAGGTGGAAGCAGG + Intergenic
1095750408 12:45704347-45704369 CTGGGACAACAGGTGTAAACGGG + Intergenic
1096526668 12:52214105-52214127 CTGGGGACACCAGTGGGCACCGG + Intergenic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102366012 12:112335365-112335387 TTGGGGACTCAGGGGGAAAAGGG + Intronic
1103386035 12:120533507-120533529 CAGGAGACAGAGGCGGAAACAGG - Intronic
1104701179 12:130905294-130905316 CTGGGCACACAGCTGGTAAGAGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1104803048 12:131567841-131567863 CTGGGGACTCAGCTGGACCCTGG - Intergenic
1105045607 12:133000974-133000996 CTGGGGACACAGGATGGAAGAGG - Intronic
1105705147 13:22963708-22963730 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105858060 13:24388724-24388746 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105964912 13:25374777-25374799 CTGGGGACACTGATGGAAACAGG + Intronic
1106157210 13:27170853-27170875 CTGGACACACGGCTGGAAACGGG + Intronic
1106177316 13:27342454-27342476 CTGTGGACACAGCTGGTCACAGG + Intergenic
1106393020 13:29354067-29354089 CAGGGGACTCAGGTGGAGCCTGG - Intronic
1106433885 13:29707365-29707387 CTGGGGCCACAGGTGAATCCAGG - Intergenic
1108548447 13:51519703-51519725 GTGAGGACACAGGGGGAAAGTGG + Intergenic
1109168982 13:59073015-59073037 CAGGGGAGAAAGGTGGAAAAGGG - Intergenic
1109179959 13:59202012-59202034 CTGGTGAGTCAGCTGGAAACTGG + Intergenic
1109578899 13:64299832-64299854 CTGTGGTCATAGGTGCAAACTGG - Intergenic
1110078268 13:71277702-71277724 CTCCGGAAATAGGTGGAAACAGG - Intergenic
1111830518 13:93323512-93323534 CTTGGAAGACAGGTGAAAACTGG - Intronic
1111907247 13:94269667-94269689 TTGGGGACAAAAGTGGACACAGG - Intronic
1112327792 13:98454849-98454871 CTGAGGACAGAGGAGGAAAGAGG + Intronic
1112340917 13:98552383-98552405 CTGGGGACACAAGTGGCTACGGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112645962 13:101331896-101331918 CCCCAGACACAGGTGGAAACAGG - Intronic
1112668983 13:101613336-101613358 CTGGGAACACAGGAGGACCCTGG - Intronic
1113773932 13:112931620-112931642 CTGGGGACGCTCGTGGACACTGG - Intronic
1113936288 13:113996740-113996762 CTGAGGACACAGGTGGGCTCAGG + Intronic
1114412497 14:22514254-22514276 CTGGGATCAGAGGAGGAAACTGG - Intergenic
1115291149 14:31774438-31774460 CTGGGAACACAAGTGCAAATAGG - Intronic
1115456369 14:33608622-33608644 CCGTGAACATAGGTGGAAACTGG - Intronic
1115478693 14:33840884-33840906 GTGGGTAGACAGGAGGAAACGGG - Intergenic
1117208367 14:53469517-53469539 CAGTGCACACAGGTGGTAACCGG - Intergenic
1117747094 14:58880978-58881000 GTCAGGACACAGGAGGAAACAGG + Intergenic
1118455036 14:65937722-65937744 CTGGCGGAACAGGAGGAAACAGG - Intergenic
1118982724 14:70729729-70729751 CTGAGCCCACAGGTGGAAAGGGG - Exonic
1119735760 14:76980732-76980754 CTGTGGCCACCTGTGGAAACTGG + Intergenic
1121045406 14:90784226-90784248 ATGATGACACAGGTGGACACAGG - Intronic
1121093968 14:91202865-91202887 CGGGGGCCACAGGAGGAGACTGG - Intronic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1121265510 14:92599780-92599802 CTAAGAACAGAGGTGGAAACAGG - Intronic
1121444809 14:93972176-93972198 CTGGGGACACACGAGGAGTCAGG + Intronic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1122940610 14:104979372-104979394 CATGGGGCACAGCTGGAAACAGG + Intergenic
1124046675 15:26156818-26156840 CTGGAGCCACAAGTGGAAACTGG - Intergenic
1124372186 15:29110223-29110245 CTGGGGACAGTGGAGGAAGCTGG + Intronic
1124938875 15:34199521-34199543 CTCGGGACACATGTGGAATCAGG - Intronic
1126675384 15:51155987-51156009 TTGGGCACACAGGCAGAAACAGG + Intergenic
1127508378 15:59616482-59616504 TTGGTGACACAGGTACAAACTGG + Intronic
1127773672 15:62249783-62249805 GTGGGGGCACAGATGGAAAGGGG + Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128677881 15:69625053-69625075 CTCTGGACACAGGTGGACAGTGG + Intergenic
1128984441 15:72208858-72208880 CTGGTGACGGAGGTGGAAAATGG - Exonic
1129822631 15:78615335-78615357 TTGGGGACACAGGCAGAGACAGG + Intronic
1129854543 15:78813856-78813878 CTGGGGACACAGCTGTGAACAGG + Intronic
1130580479 15:85133421-85133443 CAAGGGACACAGCTGGAAACTGG + Intronic
1130878337 15:88033092-88033114 CTGTGGACAGGGCTGGAAACTGG - Intronic
1131868674 15:96738833-96738855 CAGGGGAGATAGGTGGAAAGGGG + Intergenic
1132005593 15:98223672-98223694 CTGGGGGTAGATGTGGAAACAGG - Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132533721 16:466995-467017 ATGGGGACACATGGGGCAACGGG + Intronic
1132660443 16:1058585-1058607 CTGGGGACCCTGGTGGGCACTGG - Intergenic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132762393 16:1516332-1516354 GTGGGGACACGGGTGGGAAATGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133035712 16:3032999-3033021 CAGGGGTCAAAGGTGGAAGCTGG + Intronic
1133258699 16:4534644-4534666 CTGGGGAAGCAGGAGGAAATGGG - Intronic
1133670472 16:8014048-8014070 CTGGGAAAACAGGTGTCAACTGG - Intergenic
1133887515 16:9844347-9844369 TTGGGGACACAGGATGAAAAAGG + Intronic
1134077202 16:11300172-11300194 CTGTGGAGTCAGGTGGAACCTGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1136081402 16:27854630-27854652 CAGGTGACACAGGTGGGCACAGG - Intronic
1136333333 16:29595630-29595652 CTGGGCAGTCAGGTGTAAACAGG + Intergenic
1139373338 16:66481540-66481562 CTGGGGTCTCAGGCGCAAACTGG + Exonic
1139938993 16:70591313-70591335 CTGGGGACAAAGGAGGGCACTGG - Intronic
1140091799 16:71845567-71845589 TTGGGGACCCAGGTGGAGATAGG - Intergenic
1141047132 16:80725458-80725480 CTGGGGACACAGCAGTGAACAGG - Intronic
1141162755 16:81640098-81640120 CTGGGGACCCAGGAGGCTACAGG - Intronic
1141601795 16:85131172-85131194 CAGAAGACACATGTGGAAACAGG + Intergenic
1141869534 16:86775364-86775386 CTTGCAACACAGGTGGGAACAGG + Intergenic
1143519947 17:7439420-7439442 CTGGGCCCACGGGTGGTAACTGG + Exonic
1144064370 17:11611447-11611469 CTGGGAACACAGGTTCAAAGGGG - Intronic
1144105784 17:11983973-11983995 TTAGGGACACAGTTGGGAACTGG - Intronic
1145266248 17:21380873-21380895 CTGAGGACACACCAGGAAACAGG - Intronic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1147052967 17:37810855-37810877 CTGGGGACTCAAGGGGAAAAGGG - Intergenic
1147749120 17:42717272-42717294 TTGGGCACACATGTGGAAAATGG - Intronic
1147894226 17:43740050-43740072 CTGGGGGCAGATGTCGAAACTGG + Intergenic
1148695374 17:49555402-49555424 CTGGGCACACAGGTGGAACCAGG - Intergenic
1148751859 17:49949934-49949956 ATGGGGACACAGGAGTAAAGAGG - Intergenic
1149716052 17:58791434-58791456 CTGGGGACACAGTTAAAAATAGG - Intronic
1151386852 17:73760258-73760280 CTGGGGAGGCAGGTGGATGCTGG + Intergenic
1151735507 17:75937632-75937654 CAGTGAACACAGGTGGAAATTGG + Intronic
1151922014 17:77164108-77164130 CTGAGGAAACAGGTTGAAATTGG + Intronic
1152096688 17:78276770-78276792 CTGGGGACCCAGGTGGCAACCGG - Intergenic
1152662242 17:81547907-81547929 CTTGGGCCACAGGAGGAAAGAGG + Intronic
1153273112 18:3342597-3342619 CTCTGGACAAAGGTGGAAGCAGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154070891 18:11149988-11150010 CTGGGTCCACAGGTGCACACTGG + Intergenic
1154138170 18:11799197-11799219 CTGGGGACACATGGGGATATGGG - Intronic
1154946858 18:21170491-21170513 CTGGGGTCCCTGGTGGAAAATGG - Intergenic
1155926563 18:31662051-31662073 CTGGGGAGTCAGATGGCAACAGG + Intronic
1157915673 18:51661402-51661424 GTGGGGAGACATGTTGAAACAGG + Intergenic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1159551308 18:69898415-69898437 CTGCCGACTCAGGTAGAAACAGG + Intronic
1160408269 18:78657914-78657936 CTGGGGACAAAAGTGGAAGGAGG + Intergenic
1160730403 19:639410-639432 TTGGGGACAGAGATGGACACGGG - Intergenic
1160877624 19:1304603-1304625 CTGGCGACACAGGGGTACACAGG - Intergenic
1160957651 19:1700753-1700775 CTGGGGCCAGAGGTGCAGACGGG + Intergenic
1161044344 19:2127083-2127105 CTGGGGTCTCAGGTGGGGACAGG - Intronic
1161470104 19:4452998-4453020 CTGTGGAGACGGGTGGAATCAGG - Intronic
1161796019 19:6387279-6387301 CTGGGGACTCAGGGGTAACCAGG - Intronic
1162872047 19:13593763-13593785 CTGGGGATACAGCTGTGAACAGG + Intronic
1163051927 19:14690591-14690613 CTGGGTCCACATGTGCAAACTGG + Intronic
1163115577 19:15187094-15187116 CTGGGACCACAGGTGGGACCGGG - Exonic
1163132464 19:15283832-15283854 CTGGGGACACAAAAGGGAACAGG + Intronic
1163721582 19:18900450-18900472 CTGGAGACACAGGCAGACACGGG + Intronic
1164834391 19:31348660-31348682 CTGGGCACAGCGGTGGAACCCGG - Intronic
1165112675 19:33511403-33511425 GTGGGGATACAGGTGGACTCAGG - Intronic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1165393938 19:35553811-35553833 CCAGGGACACAGATGGGAACTGG + Exonic
1165476295 19:36032739-36032761 CTGGGGACCAAAGTGGAGACTGG + Exonic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166341244 19:42138565-42138587 CTGGGGACAAATGTGGGGACCGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167109203 19:47448923-47448945 CTGGGGACACAGCAGTAACCAGG + Intronic
1167226051 19:48241213-48241235 CTTGGGACAGAGGCCGAAACAGG + Intronic
1167620999 19:50560657-50560679 CGGGGGACACAGGGAGAAAGTGG - Intronic
1167665005 19:50818715-50818737 CTGGGGACAAGGGTGGACATCGG - Intergenic
1167854275 19:52225647-52225669 CTGGGGCAACAGGTGGGCACAGG - Intronic
925521109 2:4746851-4746873 CTGGCTACACAGGTGGGCACAGG + Intergenic
928405524 2:31011592-31011614 CTGGGGCCACAGGAGGCACCTGG + Intronic
931744780 2:65282300-65282322 CTGTTGACAAAGGAGGAAACAGG - Intergenic
932140494 2:69273211-69273233 CTGTGGACAGATGTGGAAATAGG - Intergenic
932418752 2:71589061-71589083 CTGAGGACAGAGGTGGGGACAGG - Intronic
932720536 2:74135898-74135920 TTGGGAACAAGGGTGGAAACTGG - Intronic
932824247 2:74925388-74925410 GGGGGGACACAGTTGGAAAAAGG - Intergenic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
935718599 2:105960249-105960271 CAGGGGACAAAGGTGGACTCAGG - Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936383750 2:112010905-112010927 GTTGGGACACATGTGGGAACAGG + Intronic
940812989 2:158266495-158266517 TTGGGGAAACAGGTGGTATCTGG + Intronic
942446036 2:176079816-176079838 CTCAGGACAGAGGTGGAAAGTGG + Exonic
942546866 2:177074504-177074526 GTGGGTACACTGCTGGAAACAGG + Intergenic
942604640 2:177677531-177677553 CTGGGGACTCAGGAGGGACCTGG + Intronic
943473809 2:188329700-188329722 ATGGGGACAAAGATGGAAGCAGG + Intronic
944073280 2:195697058-195697080 CTGAGGACAGAGGTGGAAGAGGG + Intronic
945859498 2:215104530-215104552 CACGGGACACTGGAGGAAACAGG + Intronic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948073228 2:235144340-235144362 GTGGGGTCTCAGGAGGAAACGGG + Intergenic
949031308 2:241798747-241798769 CTGGGACCAGAGGTGGGAACAGG - Intronic
1169067155 20:2700562-2700584 GTGGGGACACAGGTGGGATGTGG - Intronic
1169083878 20:2815290-2815312 CTAGGGCCCCAGGTGGATACAGG - Exonic
1172895963 20:38300165-38300187 GTGGGGACAAACGAGGAAACAGG + Intronic
1173431167 20:42988162-42988184 CTGGGGACACAGTGATAAACAGG - Intronic
1173754180 20:45500295-45500317 CAGGGGGCAAAGGTGGAAAGGGG + Intergenic
1173809878 20:45949227-45949249 CTGGGGACACAGGCACATACTGG + Exonic
1174007168 20:47419949-47419971 CTGGGAACACAGCAGCAAACTGG + Intergenic
1174107987 20:48176623-48176645 CTGGGGACAGAGGTAGACAGTGG - Intergenic
1174295746 20:49543847-49543869 CTGGGGATACAGCAGGGAACAGG - Intronic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175310168 20:58006348-58006370 TTGGGGACACAGCTGCAAACAGG + Intergenic
1175464857 20:59183803-59183825 GTGGGGACACAGGCTGAAAGAGG - Intergenic
1175491377 20:59383125-59383147 ATGGGGACACAGGAGGTACCAGG - Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176128218 20:63485370-63485392 CTGGGGACCCCAGTGGGAACAGG + Intergenic
1176191991 20:63815905-63815927 CAGTGGACACAGGTGGGCACAGG + Intronic
1176263334 20:64194750-64194772 CTGGGGGCAAAGGTGGAAGTTGG + Intronic
1178875285 21:36409444-36409466 CTGAGGCCAGTGGTGGAAACAGG + Exonic
1178920620 21:36735974-36735996 GTGGGGACCCTGGTGGAACCTGG - Intronic
1179026943 21:37686783-37686805 ATCGGGACACGGGTGGAGACAGG + Intronic
1179348253 21:40581723-40581745 CAGGGGACACAGGTGTTAGCTGG + Intronic
1179680913 21:43020777-43020799 CAGGAGGCACAGGTGGGAACAGG + Intronic
1179721134 21:43316535-43316557 CTGGGGACTCAGCTGGACTCAGG - Intergenic
1180196314 21:46196511-46196533 CTGCAGACACAGCTGCAAACAGG + Intronic
1180568178 22:16692867-16692889 CAGGGGACAAAGGTGGAAGCTGG + Intergenic
1180929599 22:19579903-19579925 CTGTGGACACAGACTGAAACAGG - Intergenic
1181025758 22:20126513-20126535 CTGGGGACACAGGTGCTTCCTGG + Intronic
1181437815 22:22920532-22920554 CTGGTGACACATGTGGGACCAGG - Intergenic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1182063281 22:27413002-27413024 ATGGGGATACAGCTGGAAAGTGG + Intergenic
1183050331 22:35255733-35255755 CTGGGGAAACACATGGAAATGGG + Intergenic
1183653439 22:39171836-39171858 CTGGGGCCTCAGGTGGGACCCGG - Intergenic
1183687043 22:39367178-39367200 CTGAGGACACAGTTGGGAACAGG - Intronic
1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG + Intronic
1184255680 22:43285535-43285557 CGGGGGACAGAGGTGGCCACTGG + Intronic
1184689876 22:46112671-46112693 CTGGGGACGCGGGAGGAAAGAGG - Intronic
1184806337 22:46796963-46796985 GTGGGGACACAGCAGGAACCAGG - Intronic
1184901647 22:47450065-47450087 TTGAGGTCACAGGTGGAATCAGG - Intergenic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185385237 22:50528872-50528894 CTGGGGACCCAAGGGGAAAGGGG + Intronic
1185391392 22:50563187-50563209 CTGGGGACACAGCAGGCAAACGG - Intergenic
949596977 3:5558431-5558453 CTGGGGACAGAAGTATAAACGGG - Intergenic
950284144 3:11731779-11731801 CAGGGGAGACACGTGGAAGCTGG - Intergenic
950581346 3:13864312-13864334 CTGGGGAAAGAGGTGGGACCAGG - Intronic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953962486 3:47277601-47277623 CTGGGGTCATTGGTGGAAAATGG - Intronic
955662533 3:61316506-61316528 CTGGAGCCACAGTTGCAAACTGG + Intergenic
956055051 3:65289928-65289950 CTGGGGACACAAGAGGAAATGGG - Intergenic
957086171 3:75679773-75679795 TTGGGGACTCAGGGAGAAACGGG - Intergenic
957188423 3:76973900-76973922 ATGGGGACACAGGTGGGGATGGG + Intronic
958603722 3:96331750-96331772 CTGGAGACACGAGTGGAAAAGGG + Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
960508807 3:118524299-118524321 CTGAGGATACAGGAGGAAAGAGG - Intergenic
960986606 3:123285106-123285128 CCGGGGACACACTTGGAGACGGG - Intronic
961942482 3:130652524-130652546 CTGAGGATACAGGAGCAAACTGG + Intronic
962742309 3:138370613-138370635 CCGGGGCCACAGCTGGAACCTGG + Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963773064 3:149409172-149409194 CTGGAAACACAGGTGTGAACTGG - Intergenic
965597688 3:170424193-170424215 CTGGGGACACTGGGGAAAATAGG + Intronic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966289661 3:178341261-178341283 CTTTGGACACAGGTGGATATGGG + Intergenic
968877929 4:3283955-3283977 TTGGGGACACAGGTGGAATGGGG + Intergenic
969409824 4:7020539-7020561 ATGGGGACACAGCTAGAAATTGG + Intronic
969973543 4:11073435-11073457 CTTGAGCCCCAGGTGGAAACAGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971352206 4:25863958-25863980 TTGGGGACGCAGGTTGAGACTGG + Intronic
972607012 4:40622940-40622962 GTGAGGACAAAGGTGGAAGCAGG + Intronic
972984669 4:44749265-44749287 CTGGTGACACCGAGGGAAACAGG - Intergenic
973965266 4:56155430-56155452 CTGGGGATACATGAGGAACCAGG + Intergenic
974098510 4:57391427-57391449 CTGAGAACACAGGTTCAAACTGG + Intergenic
974129147 4:57731301-57731323 TTAGGGACACAGGTGAAAAGTGG + Intergenic
974133597 4:57787387-57787409 CAGGAGGCAAAGGTGGAAACAGG + Intergenic
980461990 4:133126182-133126204 ATGAGGATACAGATGGAAACAGG + Intergenic
980963639 4:139500308-139500330 GTAGGGACCCAGGTGGAAGCAGG - Intronic
982306638 4:153939112-153939134 CTGGGGACACAGATATAAACAGG + Intergenic
984016337 4:174431490-174431512 CTGGGGCCACAGGTGCACACAGG - Intergenic
985505654 5:278820-278842 CTGGGGACACAGGAGGGTGCTGG + Intronic
990171464 5:53054769-53054791 CTGGGGACTCAGGGGGGAAATGG + Intronic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
991230098 5:64322826-64322848 TTGGGGACCCAGGGGGAAAGGGG + Intronic
992159789 5:73990114-73990136 CTGAGGATACTGGTAGAAACTGG - Intergenic
992520820 5:77549118-77549140 TTGGGGACTCAGGGGGAAAGGGG + Intronic
992984562 5:82214785-82214807 ATGGGGAAACAAGTGCAAACTGG + Intronic
993214920 5:85008145-85008167 ATGGGGTTACAGGTGGAATCTGG - Intergenic
994104481 5:95931160-95931182 CTGGAGCCAGAGTTGGAAACTGG - Intronic
994291882 5:98036184-98036206 TTGGGGACACAGTTGTAAGCTGG - Intergenic
995450548 5:112295095-112295117 CTGGGACCACTGGTGTAAACAGG - Intronic
995578057 5:113562534-113562556 CTGGAGACACAGGCAGGAACAGG - Intronic
995651944 5:114379186-114379208 CTGGGGCCCCAGGTGGACAGTGG - Intronic
996410201 5:123150788-123150810 CTGGGTTCACAGGTCTAAACTGG + Intronic
999380049 5:151114771-151114793 GTGGGGCCACAGTTGGAAATTGG + Intronic
999681256 5:154062549-154062571 CTGGGGACAAAAGTGGAAGCAGG - Intronic
1001773866 5:174314425-174314447 CTGGGGCCACAGTGGGGAACGGG + Intergenic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1003399558 6:5780847-5780869 ATTGGGACAAAGGTGGAAGCAGG + Intergenic
1003422701 6:5972984-5973006 CTGGTGACAGAGGTGGAAAATGG + Intergenic
1005205542 6:23399293-23399315 CTGGGGACTCAGGAGGGAAAGGG - Intergenic
1005349016 6:24916131-24916153 CTGAGGAAAAAGGTGGAAGCAGG - Intronic
1005562334 6:27053658-27053680 TTTGGGACTGAGGTGGAAACAGG - Intergenic
1005591355 6:27331569-27331591 CTGGGGTCATAGGTGGACAGAGG - Intergenic
1006297426 6:33176133-33176155 CTGAGAACATAGGTGGAAGCAGG + Intronic
1006334282 6:33412324-33412346 CTGGGGCCAGAGGTGGGAGCAGG - Exonic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1007387108 6:41527719-41527741 ATGTGTAGACAGGTGGAAACAGG + Intergenic
1008503589 6:52207677-52207699 GTGGGGACACAGGAGGAAATTGG + Intergenic
1009653945 6:66515098-66515120 CTGGTGACACAGGAGGTTACAGG - Intergenic
1010495280 6:76527266-76527288 ATGGGGACAGAGTTGGAAAGAGG + Intergenic
1010616056 6:78013599-78013621 CTAAGGACAGAAGTGGAAACTGG - Intergenic
1012965279 6:105667221-105667243 CTGAGGCCAGTGGTGGAAACAGG + Intergenic
1015595172 6:134859500-134859522 ATGGGGACAGAGGTGGACCCAGG + Intergenic
1018850894 6:167589422-167589444 CTGCGGACCCAGGTGGGAAGGGG + Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019265444 7:114467-114489 CTGGCAACAAAGGTAGAAACAGG + Intergenic
1019442790 7:1055888-1055910 CTGGGGACTCAAGTGGAGTCTGG + Intronic
1019859204 7:3641882-3641904 AAGGGGTCACAGATGGAAACAGG - Intronic
1019911440 7:4102685-4102707 CTGGAAAAACTGGTGGAAACTGG - Intronic
1020124098 7:5523212-5523234 CTGGGGACACAGGCCCAAAGAGG - Intergenic
1021537423 7:21721577-21721599 ATGGGGACACAGCGGGAAAGTGG - Intronic
1022598991 7:31738773-31738795 CAGGTGACACAGGTGGCACCTGG - Intergenic
1023528088 7:41126129-41126151 CTGGGGACAAGGATAGAAACAGG + Intergenic
1024530163 7:50384633-50384655 CTGGAGACAAAGGTGGTACCTGG + Intronic
1024860461 7:53834380-53834402 CTGTGGTCTCAGGTGGAAATGGG + Intergenic
1024970052 7:55060832-55060854 ATGGTTACACAGTTGGAAACAGG - Intronic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1025904381 7:65772101-65772123 GTGGGGCCACAGGTGGACACAGG - Intergenic
1030289084 7:107854665-107854687 ATGTAGACACAGGTGGAAACTGG - Intergenic
1031874088 7:127118823-127118845 ATGTGAACAGAGGTGGAAACGGG - Intronic
1034269339 7:149796129-149796151 CTGGGGACACAGCAGTGAACAGG + Intergenic
1034356288 7:150453010-150453032 CTGGGGACACAGAACAAAACAGG + Intronic
1034590250 7:152132312-152132334 CTGAGGACACAGGAGCAAGCAGG + Intergenic
1035219521 7:157397571-157397593 ATGGGGACACAGGAGGAAATCGG - Intronic
1035403923 7:158586765-158586787 CGGGGGACGCAGGTAGAAGCGGG + Intronic
1035851963 8:2929370-2929392 CTGGGACACCAGGTGGAAACAGG + Intergenic
1036603309 8:10283595-10283617 TTGGGGACTCAGGGGGAAAGAGG - Intronic
1036690223 8:10940484-10940506 TGGGGGACACAGGTGAAAATCGG - Intronic
1037682458 8:21108787-21108809 TTGGGGCCACAAGTGGAAAATGG + Intergenic
1037962397 8:23107327-23107349 CTGGGGACATAGGAGCAAAGCGG + Intronic
1038172886 8:25154105-25154127 TTGGGGAGAAAGGTGGAAAGGGG - Intergenic
1038517196 8:28197222-28197244 CTGGGGACAGAGGTGAAATAAGG - Intergenic
1039431136 8:37526047-37526069 TTGGGGACTCAGGGGGAAAAAGG + Intergenic
1039784846 8:40825204-40825226 TTGGGGTCATAGGTGGAGACAGG + Intronic
1039858554 8:41437060-41437082 CTGGGCAGACAGGAGGTAACTGG - Intergenic
1041477794 8:58285026-58285048 CTGGTGAAACATGTGAAAACTGG + Intergenic
1042150807 8:65781468-65781490 CAGGGAACACAGGTAGACACAGG + Intronic
1044747885 8:95388859-95388881 CTGGGGACATAGTGGCAAACAGG + Intergenic
1044772286 8:95648959-95648981 CTGGAGATAGAGGTGGATACTGG - Intergenic
1047357959 8:124141155-124141177 CTGGTGTTACAGGTGGAGACAGG - Intergenic
1047448884 8:124944632-124944654 CTTGGGAACCAGGTGGAAACAGG - Intergenic
1047532340 8:125688145-125688167 CTGGGGACAAAGGTGGATACAGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049302692 8:141879972-141879994 CTGGGAGCACAGGTGGAGAGGGG - Intergenic
1049366033 8:142237320-142237342 CTGGGGACACAGGCCTGAACAGG - Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049873471 8:144999968-144999990 CTGAGGACATCGGTGGAGACAGG + Intergenic
1053282954 9:36832923-36832945 CTGGGGACACAGAAGTGAACAGG - Intergenic
1053484603 9:38442365-38442387 CTGGGGACAGAGGAGCAGACAGG + Intergenic
1054872782 9:70064314-70064336 TTGGGGACTCAGGTGGAAAGGGG - Intronic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055509323 9:76979735-76979757 TAGGGGACAGAGGTGGAATCAGG + Intergenic
1055521762 9:77088537-77088559 CTGGGGAAATAGGTGGGAATGGG - Intergenic
1057854992 9:98594942-98594964 CTTGGCAAACAGGAGGAAACAGG + Intronic
1058884638 9:109314094-109314116 CACGGGCTACAGGTGGAAACTGG + Intronic
1058921400 9:109618764-109618786 CTGGGGACCCAGGTGCTATCAGG + Intergenic
1060457134 9:123809066-123809088 GTGGGGAGACAGGAGGCAACAGG + Intronic
1060751061 9:126169860-126169882 CTGGGGACAGAGGAGGAACCTGG + Intergenic
1061205449 9:129160479-129160501 CTGGGGACAGAGGGGTGAACTGG + Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061550039 9:131329082-131329104 CTGGGCACAGAGGTGGGATCTGG - Intergenic
1061702462 9:132426392-132426414 CTTGGGTTGCAGGTGGAAACGGG - Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062350097 9:136134257-136134279 CTGGGGACACGGGTGGGTAGTGG - Intergenic
1062366213 9:136210387-136210409 CTGGGGCCACAGGTAGCAGCAGG + Intronic
1185613083 X:1403552-1403574 CAGGGGACACAGCAGGCAACAGG + Intronic
1186009680 X:5115563-5115585 CTGGGGAAAGATATGGAAACAGG + Intergenic
1186712728 X:12217009-12217031 AAGGGGACACAGGTGGCACCTGG + Intronic
1188672143 X:32893339-32893361 AAGAGGACACAGCTGGAAACTGG - Intronic
1189630363 X:42946278-42946300 AAGGGGACAATGGTGGAAACAGG + Intergenic
1190217121 X:48487340-48487362 CTGGGGTCACACATGGTAACTGG - Intergenic
1190974849 X:55389249-55389271 CTGGGGAGCAAGATGGAAACAGG + Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192820876 X:74643756-74643778 CTGGGGAAAGAGATGGGAACAGG - Intergenic
1193453308 X:81698361-81698383 TTGGTAACACAGGTGAAAACAGG - Intergenic
1193881670 X:86930484-86930506 GTGGGGACAAAAATGGAAACAGG - Intergenic
1196590042 X:117476392-117476414 ATTGGGACACAGGTGGTAACTGG + Intergenic
1197704505 X:129623986-129624008 AGGGGGACAAGGGTGGAAACAGG + Intergenic
1198243076 X:134803253-134803275 CTGGGGCCACATGTGGAAGGAGG + Intronic
1201574359 Y:15446296-15446318 TGGGAGCCACAGGTGGAAACTGG - Intergenic