ID: 1165849234

View in Genome Browser
Species Human (GRCh38)
Location 19:38839725-38839747
Sequence CTGTCCCATGGGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165849226_1165849234 -3 Left 1165849226 19:38839705-38839727 CCACCGCTAGCCCCAGTCAACTG 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 318
1165849227_1165849234 -6 Left 1165849227 19:38839708-38839730 CCGCTAGCCCCAGTCAACTGTCC 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 318
1165849225_1165849234 20 Left 1165849225 19:38839682-38839704 CCTGGTCTCAGGTAGACACTCAG 0: 1
1: 0
2: 7
3: 19
4: 183
Right 1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 318
1165849224_1165849234 23 Left 1165849224 19:38839679-38839701 CCGCCTGGTCTCAGGTAGACACT No data
Right 1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG 0: 1
1: 0
2: 2
3: 36
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165849234 Original CRISPR CTGTCCCATGGGAAGGCAGA AGG Intronic
900130672 1:1085836-1085858 CTGCCCCACGGGAGGGCACAGGG - Intronic
900615604 1:3564426-3564448 AAGACCCATGGGAAGGGAGAGGG + Intronic
900695140 1:4005035-4005057 CTGTCCCCTGGAAAGGAAGGAGG - Intergenic
900737593 1:4308908-4308930 GGGTCCTATGGGAAGGGAGAGGG - Intergenic
901807116 1:11745566-11745588 CTGCCCCATGGGAGGGGTGAAGG + Intronic
903060241 1:20664115-20664137 CTGCCCCATGGGGTGGCACAGGG - Exonic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
905579982 1:39076916-39076938 CAGTCACCTGGGAAGCCAGAAGG - Intergenic
905791538 1:40792193-40792215 CTGTCCCCTGGGAGGGGAGGGGG + Intronic
906766862 1:48441607-48441629 TTGTCCTATGGGAAGGCTTAGGG - Intronic
906812675 1:48845071-48845093 CAGTCCCAAGGAGAGGCAGAAGG + Intronic
906955832 1:50372903-50372925 ATGGCCCATGGGTAGGAAGAAGG - Intergenic
907319298 1:53592765-53592787 CTGTGCCAAGGGGAGGCAGGAGG - Intronic
907668213 1:56451594-56451616 CTGTCTCATGGCAGGGAAGAGGG - Intergenic
907805352 1:57813555-57813577 CTAACCCATGGGAACACAGAAGG + Intronic
911576979 1:99589588-99589610 CTGTCCTATGGTAAAGCAGCAGG + Intergenic
912362615 1:109107479-109107501 CTGGCCTCTGGGAAGCCAGAAGG - Intronic
912792465 1:112665637-112665659 CTGTCACGTGAGAATGCAGAAGG - Intronic
913382921 1:118230083-118230105 CTGTCCTGTGGGAAGGCTTAAGG - Intergenic
913518151 1:119622623-119622645 CTGACCCAGGGGAAGGAAGTGGG - Exonic
913664296 1:121033310-121033332 CTGCCCCAAGAGATGGCAGAAGG - Intergenic
914015686 1:143816589-143816611 CTGCCCCAAGAGATGGCAGAAGG - Intergenic
914162097 1:145144419-145144441 CTGCCCCAAGAGATGGCAGAAGG + Intergenic
914654306 1:149725130-149725152 CTGCCCCAAGAGATGGCAGAAGG - Intergenic
915210038 1:154301796-154301818 CTGTCCCAAATGAAGGCAAAGGG + Intergenic
915734786 1:158077894-158077916 GTGTCCCAGGAGAGGGCAGAGGG + Intronic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
916001773 1:160623497-160623519 CCTTACCATGGGAAGGCAGCCGG + Intronic
916143244 1:161717932-161717954 TTGTCCAGTGGGAAGGGAGAAGG - Intergenic
917510299 1:175663986-175664008 GGGTCCCAGGGGAAGGCAGTGGG + Intronic
917630772 1:176889247-176889269 CTATCCCAAGGGGAGGGAGAGGG + Intronic
919673110 1:200355752-200355774 GTGACCCCTGGGAAGCCAGAGGG - Intergenic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920209156 1:204315500-204315522 ATCTCCCAGGGGAAGGCAGGTGG + Intronic
921352325 1:214248925-214248947 CTGAACCATGGGAAGGAAGGAGG - Intergenic
921728002 1:218545304-218545326 CTGTGTCATAGTAAGGCAGAGGG + Intergenic
922072166 1:222205148-222205170 CCGTACCATAGGAAGGCAGTGGG + Intergenic
922471574 1:225880326-225880348 CTGTCCCATGGAGAGCCAGAGGG - Intronic
922473210 1:225889102-225889124 CTGTCCCTTGAGAAGGCTGCAGG + Exonic
922797355 1:228347017-228347039 CTCCCCCAAGGGAAGGCAGAGGG - Intronic
922974008 1:229768752-229768774 CTGGGCCAAGGGAAGGCAGGTGG + Intergenic
1064162221 10:12956450-12956472 AGGTCCCATGGGTAGGAAGAAGG - Intronic
1064618507 10:17190238-17190260 ATGTTCCATGGGAAAGCAAAAGG + Intronic
1064722210 10:18240829-18240851 CAATGCCATGGGCAGGCAGAGGG - Intronic
1065162394 10:22936638-22936660 CTTTCTCATGGGAAAGCAGATGG + Intronic
1065263932 10:23955608-23955630 CTGCCCAATGGGAAGGCTGCGGG + Intronic
1065708727 10:28495201-28495223 CTGCCCCCTGGGAAGACAGAGGG + Intergenic
1066457664 10:35585876-35585898 CTGCCCCATGGGAACACAGGTGG + Intergenic
1068110070 10:52670012-52670034 CTGTCCTATGGCAAAGGAGAAGG - Intergenic
1069137820 10:64785910-64785932 GCGTCACATGGAAAGGCAGAGGG + Intergenic
1069616833 10:69811557-69811579 CTGTGACATGGGAGGTCAGAGGG + Intronic
1070510848 10:77159386-77159408 CTTTCCCATAAGAAGGCTGAGGG - Intronic
1070736278 10:78865840-78865862 CTGGCCTGGGGGAAGGCAGAAGG - Intergenic
1070962002 10:80505747-80505769 CAGTCCCAGGGGAAGCCACACGG - Intronic
1070991050 10:80732506-80732528 CTGACCCACGGGAAGACAGTGGG - Intergenic
1071531114 10:86390917-86390939 CTGTCCCCTGTGAAGGCAGCAGG + Intergenic
1074034870 10:109728403-109728425 CTGTCTCATAGGATGTCAGATGG - Intergenic
1074495912 10:113979929-113979951 ATGGCCCATGGGGAGGTAGAAGG + Intergenic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1075301019 10:121324386-121324408 TTGTCCCATCTGAAGGCAGGGGG + Intergenic
1076118970 10:127921050-127921072 CTGGCCCCTGGGAAGACAGAGGG - Intronic
1076334248 10:129694361-129694383 CCCTCCCAGGGGAAGGCAGGAGG - Intronic
1076743769 10:132502310-132502332 CTGCCCACTGGGAAGGCAGTGGG + Intergenic
1077167424 11:1150179-1150201 CTGACCCCTGGGAGGACAGAGGG - Intergenic
1077811911 11:5646732-5646754 CTGTTCCCTGAGAAGGGAGAGGG + Intergenic
1078061536 11:8048972-8048994 CTGTACCATGGGAATTCATAGGG - Intronic
1078107879 11:8370086-8370108 CTGGCCCTTGGGAGGGCAGGTGG - Intergenic
1078641198 11:13098368-13098390 ATTTCCCATGGGATGGCAAAGGG - Intergenic
1078918005 11:15798845-15798867 ATGTCACATGGGAAGAGAGAGGG + Intergenic
1079304738 11:19312057-19312079 CGGACCCAAGGGAAGGCAAACGG + Intergenic
1080757955 11:35220212-35220234 CTGTCCCAAGGGAGAGCACAGGG + Intronic
1080923099 11:36728545-36728567 CTTTCACATGTGAAGGCAAAAGG + Intergenic
1081146183 11:39564251-39564273 TTGTCCCGTGGGAAGGCTTAAGG - Intergenic
1083479197 11:62932984-62933006 CTGGCCCAGGGGATGGCAGTGGG + Intergenic
1083642730 11:64154063-64154085 CTGTCCACAGGGAAGGCAGGAGG - Intronic
1084030645 11:66478757-66478779 CTTCCCCATGGGAATGCAAAAGG - Intergenic
1084122686 11:67078432-67078454 TTGTCTGCTGGGAAGGCAGAGGG + Intergenic
1084978702 11:72816991-72817013 CTGTCCTGTGGGAAGGCCAAGGG - Intronic
1085512317 11:77094599-77094621 CCCTCCCAAGGGATGGCAGAAGG - Intronic
1086920941 11:92585945-92585967 CAGTCTCATGTGAAGGGAGAAGG + Intronic
1087225361 11:95592687-95592709 CTGTCCCGTGGGGAGGCCGTGGG + Intergenic
1087329400 11:96760972-96760994 CTGTCTCATCCCAAGGCAGAAGG - Intergenic
1088095644 11:106097852-106097874 CTTTCTTATGGGAAGGCAGTGGG - Exonic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089294412 11:117459241-117459263 CTCTCCCATGGGAAGGGAGTTGG - Intronic
1090028247 11:123185636-123185658 CTCCCCCAGGGGAAGGCAGATGG + Intronic
1090867878 11:130718340-130718362 CTGTCCCATGGGAACCCAGCTGG + Intergenic
1091910524 12:4227015-4227037 CTGTCCCATGTAAGTGCAGAGGG + Intergenic
1092299322 12:7230480-7230502 CAGTCCCAGGGAAAGGCAGATGG - Intergenic
1097838401 12:64296898-64296920 TCATCCCATGAGAAGGCAGAGGG - Intronic
1098705650 12:73685402-73685424 CTCTGCCATTGGAAAGCAGAGGG + Intergenic
1101454541 12:104816486-104816508 ATGTCCCCTGGAGAGGCAGAGGG - Intronic
1103833533 12:123799966-123799988 GTGTTTCAAGGGAAGGCAGAAGG + Intronic
1104969199 12:132523571-132523593 CTGGCCGATGGGAAGGGAGGTGG - Intronic
1106073853 13:26440582-26440604 TTTTCCTCTGGGAAGGCAGAAGG + Intergenic
1106074452 13:26445754-26445776 CTGTCCCAAGGGAAGACGTACGG - Intergenic
1106091315 13:26597612-26597634 CTGTTCTGGGGGAAGGCAGAGGG - Intronic
1109424766 13:62154798-62154820 TTGTCCTGTGGGAAGGCTGAAGG - Intergenic
1110331426 13:74277775-74277797 CTGTCCCATGGGATGTCACAAGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112157718 13:96835586-96835608 GTGTCACAGGGGCAGGCAGAAGG - Exonic
1113455029 13:110442419-110442441 CTGGCCAGTGGGATGGCAGAGGG - Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115161622 14:30402903-30402925 CTTTCCCATGAAAAGGAAGATGG - Intergenic
1115411920 14:33084801-33084823 CTATCCCATATGAGGGCAGACGG - Intronic
1118912066 14:70069738-70069760 CTGTTCCATGAGAAGGCTTAGGG + Intronic
1119657025 14:76424518-76424540 CTGTCCTTTGGGAATGCACAGGG + Intronic
1121317241 14:92969589-92969611 CTGTCCCTCAGGCAGGCAGAAGG - Intronic
1121468173 14:94129301-94129323 GAGTGCCAGGGGAAGGCAGAGGG + Intronic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1122808961 14:104278392-104278414 CTGGCCCAAGGGGAGGCAGGAGG - Intergenic
1122956199 14:105072677-105072699 CTGTCCCTGGGGCAGGCAGGGGG + Intergenic
1124988455 15:34646435-34646457 CTCTCACATGGGAAGGGAAAAGG - Intergenic
1126842773 15:52733543-52733565 CTGTTGGGTGGGAAGGCAGAGGG + Intergenic
1127914498 15:63444306-63444328 CTGTCCCGTGGGCAGGCACTAGG + Intergenic
1127966005 15:63923401-63923423 CAGTCCAAAGGGTAGGCAGAAGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128355462 15:66923453-66923475 CACTCCCATGGCCAGGCAGAAGG + Intergenic
1128637939 15:69315095-69315117 CTGTCCCCTGGGAAGCCCAAGGG - Intronic
1129076081 15:72997229-72997251 ATGTCCCAAGGGAGGGGAGATGG + Intergenic
1129645085 15:77421566-77421588 CTGTTGCATGTCAAGGCAGAGGG - Intronic
1130994615 15:88896967-88896989 CTGCCCCACTGCAAGGCAGAGGG - Intergenic
1131840060 15:96427667-96427689 ATGGGCCATGTGAAGGCAGAGGG + Intergenic
1132068956 15:98758591-98758613 CTGTCCCAGGTGAAACCAGAGGG - Intronic
1132102939 15:99039928-99039950 CTTACCGATGTGAAGGCAGATGG + Intergenic
1136228070 16:28872198-28872220 CTGTTCCAGGGGGAGCCAGAGGG + Exonic
1137573191 16:49579797-49579819 CTCTCCCATGGGAGGGCACAGGG + Intronic
1140268554 16:73442155-73442177 CTCTCCCAAGAGAAGGCAAAGGG + Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142119134 16:88377318-88377340 CGGGCCCATGGGTCGGCAGAGGG - Intergenic
1142150563 16:88510793-88510815 CTGGCCCAAGGGTAGGCAGTGGG - Intronic
1142201260 16:88762141-88762163 CTGTGCCCTGGGAAGGGAGCTGG + Intronic
1143027226 17:3948020-3948042 CACTCTCATGGGAAGGCAGCAGG - Intronic
1143218525 17:5242414-5242436 CTGCCACATGGGAATGCAGGTGG + Intergenic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144148425 17:12420477-12420499 CTGTTCCATCTGAAAGCAGATGG + Intergenic
1144218026 17:13074120-13074142 CTGTCACATGGCAAGAGAGAGGG + Intergenic
1145978163 17:28996290-28996312 CTCTCCCATCGGCAGGCAGGAGG + Intronic
1146907938 17:36629865-36629887 TTGTCCAAGGGCAAGGCAGATGG - Intergenic
1147614256 17:41819193-41819215 CTGTCCCTGGGGAAGGGATAGGG - Exonic
1148678095 17:49456751-49456773 CCCTCCCATGGGAAGGGAGAAGG - Intronic
1149074209 17:52577698-52577720 TTGTCCTATGGGAAGGCTTAAGG - Intergenic
1150410728 17:64938886-64938908 CTCCCCCAGGGGCAGGCAGAAGG - Intergenic
1150771767 17:68048170-68048192 CTTTCCCATGGGGAGTTAGAGGG - Intergenic
1151447318 17:74175798-74175820 CTGCCCCATGGGAAGCCAGAAGG + Intergenic
1151593281 17:75061121-75061143 CTGTCCCGTGGGAAGACGGAGGG + Intronic
1151603978 17:75124715-75124737 ATTTCCCATGGGAGGGCCGAGGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152079042 17:78175173-78175195 CGCTCCCATGGAAAGACAGAGGG + Intronic
1152572503 17:81126971-81126993 CTGTCCCGAGGGAAGCCAGCAGG + Intronic
1152635059 17:81427458-81427480 GTGTCCCACGGGGAGGCAGGTGG - Intronic
1153615450 18:6929581-6929603 CTCTCCGAGTGGAAGGCAGAGGG - Intergenic
1155522742 18:26685547-26685569 CTGTCCCCAGGGAAGGCCAAGGG + Intergenic
1157302124 18:46486588-46486610 ACCTCCCATGGGAAAGCAGAAGG - Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1159613126 18:70548248-70548270 ATGTGCCATGGGCAGGGAGAAGG + Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160605981 18:80049700-80049722 CTGTTCCTTGGTAATGCAGATGG + Intronic
1161512286 19:4678528-4678550 CTGGCCCCTGGGAAGGCAGTGGG + Intronic
1161581159 19:5081818-5081840 CTTTCTCATGCGAGGGCAGAAGG + Intronic
1161643218 19:5436821-5436843 CTGGCCAATGGGGACGCAGAGGG - Intergenic
1162324955 19:9993486-9993508 CAGCCCCCTGGGAAGGCAGATGG + Intronic
1163034413 19:14562860-14562882 CTGTCCCTGGGGAGGACAGAGGG + Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1163315002 19:16535657-16535679 GTGCCCCATGAGAATGCAGATGG + Intronic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1164981803 19:32619789-32619811 CTGTCCCGTGGGAGGGCTCAGGG + Intronic
1165022627 19:32936508-32936530 CTGTCCCGTGGGACTGCAGTAGG + Intronic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
1166359625 19:42247750-42247772 CTGGCCCATGGGCAGGCGGGTGG - Exonic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166540093 19:43599361-43599383 CCCTCCCCTGGGAAGGCAGAGGG + Exonic
1166727019 19:45034554-45034576 CTGTCCCCTGGGTGGGCAGAGGG + Intronic
1167100678 19:47402658-47402680 CTGTCCCATGGGAAATGAGCAGG - Intergenic
1167485590 19:49761273-49761295 CTGGCCCAGGGGAAGCCAGGTGG + Intronic
1168259550 19:55185814-55185836 ATGTCACAGGGGAAGGCTGAGGG + Intronic
924969629 2:113728-113750 CAGCCCCATGGGAAGGGAAAGGG - Intergenic
925267852 2:2579779-2579801 CTGTGCCTTGGGAAGGCACTTGG - Intergenic
925857786 2:8146840-8146862 CAGTCCCATGGGAGGGCACATGG - Intergenic
926156197 2:10455228-10455250 CTGTCCTACAAGAAGGCAGAAGG - Intergenic
926724057 2:15983806-15983828 TGGCCCCTTGGGAAGGCAGAGGG - Intergenic
928072220 2:28228303-28228325 CTGTGTCCTGGAAAGGCAGAAGG + Intronic
929734483 2:44532627-44532649 CTTTCCAATGGGAAAGCAAAAGG + Intronic
933032428 2:77346974-77346996 CTGTCCCAGGGCAGGGAAGAGGG - Intronic
933547677 2:83735915-83735937 CTGTTCCTTGGGAAGGCAAGAGG + Intergenic
933616447 2:84486716-84486738 CTTTCCCATGGCAAGAAAGAAGG + Intergenic
933817328 2:86078908-86078930 CTGTCCCCTGGGTAGGGAGTGGG - Intronic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
934753938 2:96812196-96812218 CAGTCCCATGGGTAGGGAGGAGG - Intergenic
934926986 2:98388915-98388937 GGGTCGCATGGGATGGCAGAGGG + Intronic
935120468 2:100179635-100179657 CTGTCCAAGGTGATGGCAGAGGG + Intergenic
936088530 2:109486380-109486402 CTCTCCCAAGGCAAGGCAGGTGG + Intronic
936371635 2:111906897-111906919 TTGTCAAATGGGAAAGCAGATGG + Intronic
936449842 2:112625838-112625860 GTGTTCAAAGGGAAGGCAGAAGG + Intergenic
937345203 2:121121143-121121165 CAGTCCCGTGGGAAGCCAGAGGG - Intergenic
937527564 2:122789197-122789219 CTGTACCATGGTAAGCCACAGGG + Intergenic
938155771 2:128938825-128938847 CCCTCCCAAGAGAAGGCAGAAGG - Intergenic
941579847 2:167281654-167281676 CAGTCACATTGGAAGGCAGCTGG - Intergenic
941928511 2:170918532-170918554 CTGTCCCATGATACAGCAGAGGG + Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
943783168 2:191846917-191846939 CTCTCCCATGGCTAGGCAGGTGG + Exonic
945017342 2:205533222-205533244 TTCTCCCAAAGGAAGGCAGAAGG + Intronic
946412336 2:219521612-219521634 GGGTCCCATGGGCAGGCAGGAGG + Intronic
947576829 2:231281870-231281892 CTGTCACCTGGGCATGCAGATGG + Intronic
948264806 2:236628659-236628681 CTGGCCCATGGGCAGGGACAAGG + Intergenic
948863635 2:240764595-240764617 CTGTCTTAGGGGAAAGCAGAGGG - Intronic
1168889038 20:1281937-1281959 CTGCCCCATGGCAATGCAGGCGG - Intronic
1171962223 20:31503189-31503211 CTGGCTCATGGGGAGGCAGCAGG - Intergenic
1172406462 20:34693546-34693568 CTGTCCTTGGGGAAGGCAGTGGG - Intergenic
1173002657 20:39115705-39115727 CTGTCCCATGGGACACCAGGAGG - Intergenic
1175256393 20:57650302-57650324 CACTCCCATGGGAAGGGAGGGGG + Exonic
1175986796 20:62768078-62768100 GTGTCTCCTGGGCAGGCAGATGG + Intergenic
1176295370 21:5069406-5069428 GTGTGCCCTGGGAAGGCAGGCGG - Intergenic
1176965555 21:15208313-15208335 ACGTGCCATGGGAAGGAAGAAGG - Intergenic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178144019 21:29717420-29717442 CTGTACCATGCAAAGCCAGAGGG + Intronic
1178973336 21:37200724-37200746 CTGTCCCTGGGTCAGGCAGAAGG - Intronic
1179861679 21:44192718-44192740 GTGTGCCCTGGGAAGGCAGGCGG + Intergenic
1180842119 22:18964325-18964347 CTTGCCCATGGGAAGGGAGGTGG + Intergenic
1181059376 22:20274556-20274578 CTTGCCCATGGGAAGGGAGGTGG - Intronic
1182436991 22:30337200-30337222 CAGCCCCATGAGAGGGCAGAAGG + Intronic
1182572188 22:31247892-31247914 CTGTCCCCAGGACAGGCAGAGGG + Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183922048 22:41177397-41177419 GTGTCCCAGGGTAAGGCAGCAGG + Exonic
1184302445 22:43569612-43569634 CTGTGCCACGCTAAGGCAGAAGG - Intronic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184671404 22:46013868-46013890 ATGTCCCCCGGGAAGCCAGAGGG - Intergenic
1185052285 22:48560111-48560133 CTTTCCCATGGGACGGCACGTGG - Intronic
1185234390 22:49703618-49703640 CTGCCCCATGGGAGGCCAAAGGG - Intergenic
949364650 3:3267730-3267752 CTGTTCTATGGGAAGGTAGTGGG + Intergenic
950266675 3:11578413-11578435 CTGGACCATGGGAAGGCGGCTGG - Intronic
950421021 3:12899571-12899593 CTGGACCATGGGAAGGCAGCGGG + Intronic
950538798 3:13597702-13597724 CTGTCCCCTGGTAAAGCAGAAGG - Intronic
950920236 3:16686601-16686623 AAGGACCATGGGAAGGCAGAAGG + Intergenic
953663495 3:44907998-44908020 CTATGCTATGGGATGGCAGATGG + Intronic
954631003 3:52047565-52047587 CTGTGCCAGGGGCAGGCAAAGGG - Intergenic
955595031 3:60580080-60580102 TTGTCTCTTGGGAAGGGAGAAGG - Intronic
955883994 3:63578157-63578179 CTATCCCAAGGGAAGACAGGAGG - Intronic
956280928 3:67555944-67555966 ATGTCCCATCAGAAGGCACATGG - Intronic
956815788 3:72907059-72907081 GTGATCCAAGGGAAGGCAGATGG + Intronic
960596434 3:119412053-119412075 CTGTCCCAGGGCGAGGCAGCCGG - Intronic
961633647 3:128319259-128319281 CTGTCCCCTGGTGAGGCAGCAGG - Intronic
961691234 3:128671304-128671326 CTCTGACATGGGCAGGCAGAAGG - Intronic
962263686 3:133930781-133930803 CTGGCCCATGGGAGGGAAGTGGG - Intergenic
968280200 3:197471389-197471411 CGGCCCCATGGGAAGGCGGTGGG + Intergenic
968810545 4:2797784-2797806 CTGTCCCAGAGGAAGGGTGAGGG + Intronic
969489501 4:7491056-7491078 ATGTCCCAAGGGAAGGCAAAGGG - Intronic
969622798 4:8287115-8287137 CTGCCCCATGGGATGGCATCTGG + Intronic
969860468 4:10031853-10031875 CTGTCCCCTGGGAATGCACTGGG + Intronic
970225223 4:13850536-13850558 CTTGCCCATGGGAATGCTGAAGG + Intergenic
971311547 4:25529749-25529771 CTGTCAAATGGGAAGGCTCATGG - Intergenic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
972715976 4:41646528-41646550 CGGTCCCAGGAGGAGGCAGAGGG + Exonic
973590711 4:52437716-52437738 CTGTCTCAAGGCAAGACAGACGG - Intergenic
974107208 4:57483801-57483823 CTGGCCTCTGGGAAGGTAGAAGG + Intergenic
976361013 4:84178116-84178138 CTGTCCAATGTGAGGGAAGAAGG - Intergenic
976683043 4:87778505-87778527 CTGTCCTATTGTCAGGCAGATGG - Intergenic
976694520 4:87904798-87904820 CTGTCCTGTGGGAAAGCATATGG - Intergenic
979449930 4:120858701-120858723 CTCTGCCCTGGGAAAGCAGATGG + Intronic
980137536 4:128873110-128873132 CTGTACTATTGGAAGCCAGATGG - Exonic
981870229 4:149476987-149477009 CTGGCCCCTGGGAAGGCATCTGG + Intergenic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985676012 5:1231763-1231785 TTTTCCCATGGGGAGGCTGATGG + Intronic
986065631 5:4231143-4231165 TTGTCACTGGGGAAGGCAGATGG + Intergenic
986306575 5:6520935-6520957 ATGTCCCATGGGTAGGAAGATGG + Intergenic
986798540 5:11235772-11235794 CAGTCCCAGGGGAAGAGAGATGG + Intronic
987051438 5:14149610-14149632 CTGTGCCATTTGATGGCAGAGGG + Intronic
987774622 5:22348180-22348202 CTGTGCTATGGGCAGCCAGAAGG - Intronic
988895360 5:35666620-35666642 CTCTCCCATTGAAAGACAGAGGG + Intronic
991415879 5:66392506-66392528 TTGTCTCCTGGGTAGGCAGAGGG - Intergenic
991585714 5:68199995-68200017 CTGTACACTGGGAAGTCAGAAGG - Intergenic
993509491 5:88754116-88754138 CTGACCAGTGGGAAGCCAGAGGG - Intronic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
994541730 5:101108267-101108289 CTGCCCCATAGGAAGCCACATGG - Intergenic
995565440 5:113429304-113429326 CTGTGCCATGTGAGGGCACAGGG + Intronic
996477403 5:123937161-123937183 CTGTCCCATCAGAAGGAAAATGG - Intergenic
997531783 5:134586047-134586069 CTTCCCCAAGGGAAGGCAGGAGG + Intergenic
998799643 5:145856391-145856413 CTGCCCTATGGGAAGGCCGCCGG + Intergenic
998988600 5:147790013-147790035 ATGTCCCATGAGGAGGCAGTGGG - Intergenic
999149021 5:149414615-149414637 GTGTCCCCTGGGAAGGCAGGAGG - Intergenic
999199328 5:149804825-149804847 GTGTTCCATGGGAAGGAAGAAGG + Intronic
999869259 5:155732071-155732093 TAGTTCCAGGGGAAGGCAGATGG + Intergenic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1002876806 6:1217863-1217885 CTGTCCCATCGGCAGGCTGTGGG + Intergenic
1003497343 6:6675894-6675916 CTGTCCTCTGGAAAGGCTGAGGG + Intergenic
1004017853 6:11748724-11748746 CTGAGCCATGGGAGAGCAGATGG + Intronic
1006344210 6:33466764-33466786 CTGTACCATGCAAAGGCACAGGG + Intergenic
1006506206 6:34490415-34490437 GTGTCCCAGGGCAAGCCAGAAGG - Intronic
1006520470 6:34568385-34568407 ATGTCCCTGAGGAAGGCAGAGGG + Intergenic
1008126769 6:47677962-47677984 CTGTCCTGTGGCATGGCAGATGG + Intronic
1011454309 6:87530745-87530767 CTGCATCATGGGAAAGCAGAAGG + Intronic
1014202542 6:118621975-118621997 TTGTCCCGTGGGAAGGCTTAGGG - Intronic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1017344618 6:153366847-153366869 CTTTCCAATGGAAATGCAGACGG + Intergenic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1018663690 6:166113835-166113857 CTGGCCCCAGGGCAGGCAGAAGG + Intergenic
1019985246 7:4650756-4650778 CTGCCCCGTGTGCAGGCAGACGG + Intergenic
1022468993 7:30670476-30670498 CTGACCCCTGGGAAAGCAGGTGG + Intronic
1024285339 7:47752227-47752249 CTTTCCCATGGGGAAGCAGAAGG + Intronic
1025199851 7:56955467-56955489 CGGTTCCCTGGGGAGGCAGAAGG + Intergenic
1025672095 7:63621465-63621487 CGGTTCCCTGGGGAGGCAGAAGG - Intergenic
1026965292 7:74435457-74435479 TGGTCCAGTGGGAAGGCAGATGG + Intergenic
1028340598 7:89715381-89715403 ATTTCTGATGGGAAGGCAGATGG - Intergenic
1028504746 7:91558638-91558660 CTGTCCCAGAGGAAGACAGCTGG + Intergenic
1031598196 7:123671742-123671764 CTGTCCAGTGGGAAGACAGGAGG - Intergenic
1031627752 7:124009802-124009824 CTGGCCCATGGGAAGGAAGAGGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1031922417 7:127611900-127611922 CTGTGCCCTGGGAAGACTGAAGG - Intronic
1031992361 7:128206653-128206675 CCAACCCATGGGGAGGCAGATGG + Intergenic
1032515818 7:132505342-132505364 CTTGCCCATGGGCAGCCAGACGG + Intronic
1032785053 7:135194083-135194105 CTGTCCCCTGAAAAGGCAAATGG - Intronic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034164403 7:149014428-149014450 CCGTCTCCTGGGAAGGCAGATGG + Intronic
1034961119 7:155365208-155365230 CCATCCCTTGGGAAGGCAGGAGG + Intronic
1035176584 7:157056305-157056327 GTGTCCCCTGGGAGGGCAGATGG - Intergenic
1037319513 8:17630079-17630101 CACTCCCATGGGAGGGTAGAGGG + Intronic
1038000942 8:23390609-23390631 CTGTTTCCTGGGAAGGCTGAAGG + Intronic
1038731061 8:30128121-30128143 CTGTCCTCTGGGCAGACAGATGG + Intronic
1040433820 8:47370219-47370241 CTGTCTCCTTAGAAGGCAGAAGG + Intronic
1040527853 8:48240160-48240182 TTCTCCCATGGGAAGGCTTAAGG - Intergenic
1040860230 8:51991232-51991254 ATGTCACATGGCAAGACAGAGGG - Intergenic
1041790595 8:61692608-61692630 CTGACTCATGAGAAGGCTGATGG - Intronic
1042396430 8:68296373-68296395 CTGCCCCAAGGGAAGGCTCAAGG + Intergenic
1045097273 8:98810919-98810941 GTGTCACATGGGAAGAGAGAGGG - Intronic
1045564533 8:103299347-103299369 CTGTCCCGGGGGAAGGGCGAAGG - Intronic
1048573058 8:135670633-135670655 CTTTCTAATGGGAAGGCAGGAGG + Intergenic
1049070282 8:140350531-140350553 CCGTCCCAGGACAAGGCAGATGG + Intronic
1049321236 8:141997659-141997681 TTGTCCCTTGGGAAGGGACAGGG - Intergenic
1049935016 9:493271-493293 CTGTCCCATGACATGGCAGCTGG - Intronic
1051122328 9:13764768-13764790 CTGTTCCATGGGACGGCCCAGGG - Intergenic
1053024363 9:34718098-34718120 CTGACCCATGGGAATCCAGACGG - Intergenic
1053035763 9:34825892-34825914 CTGACCCATGGGAATCCAGACGG - Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1056664696 9:88572256-88572278 TTGTCCCAAGGGCAGGCACAAGG - Intronic
1056813370 9:89781717-89781739 TTTTCCCATCGGAAGACAGAAGG - Intergenic
1056929451 9:90862077-90862099 CTGTCACCTGGCAAGGCAGCTGG - Intronic
1059508496 9:114821733-114821755 CTGTCCCATTGGAAGGTCTATGG + Intergenic
1060104181 9:120863225-120863247 CTGTCCATTGGGAGGGCAGGTGG + Intronic
1061188313 9:129068010-129068032 CTGCCCCAGGCCAAGGCAGAGGG + Intronic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1062220768 9:135413861-135413883 CTGCCCCATGGGTTGGAAGATGG + Intergenic
1062309907 9:135930052-135930074 TGGTCCCACGGGAAGGCAGGAGG - Intergenic
1187244697 X:17543513-17543535 CTCTTCCCAGGGAAGGCAGACGG + Intronic
1187268043 X:17755408-17755430 CTGGGCCATCTGAAGGCAGAGGG - Intergenic
1187321207 X:18238875-18238897 CTGGGCCATCTGAAGGCAGAGGG + Intergenic
1188122814 X:26330549-26330571 CACTCCCATGGGATAGCAGAGGG + Intergenic
1194195209 X:90883611-90883633 CTGTCCCATGGAAAAGCAGCTGG - Intergenic
1194730075 X:97442636-97442658 ATGTCCACTGGGAAAGCAGATGG - Intronic
1195850874 X:109280396-109280418 TTGTCCCGTGGGAAGGCTTAAGG + Intergenic
1195958271 X:110357957-110357979 ATGTCCAATGGGGAGACAGAGGG - Intronic
1197772495 X:130098108-130098130 CTGAGCCATGGGCAGGCAGGGGG + Intronic
1199693985 X:150330497-150330519 CGGTCCCATGGGAAGGATGTGGG - Intergenic
1200018910 X:153185506-153185528 CTATCCCATGGGAATTCAAAAGG - Intergenic
1201464209 Y:14262400-14262422 CAGTCCCATGGAAACACAGATGG - Intergenic