ID: 1165849677

View in Genome Browser
Species Human (GRCh38)
Location 19:38842505-38842527
Sequence CTGTGCTTGTAGCTGTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165849675_1165849677 22 Left 1165849675 19:38842460-38842482 CCATGTTGCGTCTCTTTCTCTCT 0: 1
1: 0
2: 5
3: 81
4: 1031
Right 1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG 0: 1
1: 0
2: 2
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165849677 Original CRISPR CTGTGCTTGTAGCTGTTCCT TGG Intronic
901537788 1:9894096-9894118 CTGTTCTTTTAGCTCTTCCGTGG - Intronic
904312901 1:29640742-29640764 CTGTGTCTCTAGCTGTCCCTGGG - Intergenic
905170436 1:36106715-36106737 CTGCACTTGGGGCTGTTCCTTGG - Intronic
906145877 1:43560441-43560463 CTGTGTGTGTAGGTGTGCCTCGG + Intronic
906836591 1:49089625-49089647 CTGTGCTTCCATCTGGTCCTAGG - Intronic
911046002 1:93628844-93628866 CTGTGCTGGTCACTGTTCCAGGG - Intronic
916058804 1:161085309-161085331 CTGTGCTGGGAGCTGTGTCTGGG - Intronic
917591664 1:176482553-176482575 CTGAGCCTGAAGCTGTCCCTGGG - Intronic
917848912 1:179043352-179043374 CTGTGGGTGTAGCTGTGGCTGGG + Intronic
918222113 1:182444594-182444616 CTGTGCTTCTCTCTGGTCCTGGG + Intergenic
920089295 1:203441000-203441022 CTGTGCTGGCAGCTCCTCCTGGG + Intergenic
922143841 1:222918219-222918241 CTGCGCTTCCAGGTGTTCCTGGG - Intronic
922945216 1:229508254-229508276 CTGTCCTAGTCGCTGCTCCTTGG - Exonic
923085010 1:230696565-230696587 CTGTGGCTGGAGGTGTTCCTTGG + Intergenic
923238032 1:232053504-232053526 CTGTTATTGTACTTGTTCCTTGG - Intergenic
923271136 1:232356052-232356074 CTATGCTTGTTACTGTTCCAGGG + Intergenic
923970604 1:239199275-239199297 CTGTACTTGTAACTGTAACTAGG - Intergenic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1066633382 10:37478520-37478542 CTGTGCCTGTCACTATTCCTAGG - Intergenic
1068303174 10:55172413-55172435 CTGTTCTCTTAGCTGTTTCTAGG - Intronic
1070326377 10:75392085-75392107 CTGTGCTGGTCCCTGTGCCTGGG - Intergenic
1071477629 10:86038316-86038338 CCTGGCTTGTAGCTGTTCATGGG - Intronic
1072049269 10:91687350-91687372 ATGTGCTTGAACCTGCTCCTTGG - Intergenic
1073217063 10:101842307-101842329 CTGTGCATGTGCATGTTCCTGGG - Intronic
1076855586 10:133114133-133114155 CTGGGCTTGGTGCTGTTCCCAGG - Intronic
1078374129 11:10778683-10778705 CTGTTGCTGTTGCTGTTCCTGGG - Exonic
1082079103 11:47998064-47998086 CTGTGCTAGGAGCTGTTTTTGGG - Intronic
1085068674 11:73521770-73521792 CTGGGCTTGAAGCTGTTAGTTGG + Intronic
1085297847 11:75441064-75441086 CTGTGCTTGGAGCTGTCCCTGGG - Intronic
1085844578 11:80050748-80050770 CTCTGCTTGTACCTCTTCCCTGG + Intergenic
1087871244 11:103295359-103295381 CTGTGCCTGTTGCTGCTTCTAGG - Intronic
1088806228 11:113355068-113355090 CTGTGAATCTAGCTGGTCCTGGG + Intronic
1090101086 11:123797533-123797555 CTGTGCCTGTTGCTGCTTCTGGG + Intergenic
1090789498 11:130078768-130078790 CTGTGCGTGAATCTGTTCCTGGG + Intronic
1091792511 12:3280042-3280064 CTGTGTGTGTGGCTGGTCCTGGG + Intronic
1092279567 12:7089287-7089309 CTGTACCTGTAGCTGGTCATAGG + Exonic
1096035311 12:48463454-48463476 CTGTGATTCTACCTGGTCCTGGG - Intergenic
1096562828 12:52449222-52449244 CTGTGCTTTTAGCTTCACCTTGG - Intronic
1098316870 12:69202030-69202052 CTGTGTTTCCAGGTGTTCCTGGG - Intergenic
1098796567 12:74895816-74895838 ATGTGCTTTTAGCTTTTCCCTGG - Intergenic
1099584983 12:84504469-84504491 CTGTCTTAGTAGCTGTGCCTTGG + Intergenic
1100200801 12:92296017-92296039 CTGTGATTCCAGCTCTTCCTGGG + Intergenic
1101287547 12:103330837-103330859 CTGTGTTTGAAGCTGTTGGTGGG - Intronic
1102562057 12:113769394-113769416 CTGTCCTTGCAGCTGGCCCTGGG - Intergenic
1102699548 12:114826987-114827009 CTGTGCTGGTCACTGTTCCAGGG - Intergenic
1102977196 12:117215189-117215211 CTGTCCTTGTCGCTGTGCCCTGG - Exonic
1104551997 12:129765713-129765735 CTATACTTGTACCTGTTCTTTGG + Intronic
1104680374 12:130746985-130747007 CTCTGCTTGTTGTAGTTCCTAGG - Intergenic
1104832676 12:131764660-131764682 CTTTGCTTCTAGCTCCTCCTGGG - Exonic
1105029767 12:132874458-132874480 CTGTGCTGGGTGCTGGTCCTGGG - Intronic
1106400648 13:29426962-29426984 CTGGGCTGAAAGCTGTTCCTAGG - Intronic
1107189330 13:37560558-37560580 CTGTGCTTCTAGGTGTTCCTGGG - Intergenic
1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG + Intronic
1110600040 13:77362506-77362528 CTGGGCTTGTCATTGTTCCTGGG + Intergenic
1111622003 13:90736355-90736377 CTGTGCATCCAGCTGATCCTGGG - Intergenic
1112138597 13:96612379-96612401 CTCTGCTTGTTGGTGTTCCAAGG + Intronic
1116242592 14:42364594-42364616 CTGTACTTGTAACTGATTCTTGG - Intergenic
1121413269 14:93762338-93762360 CTGGGATTGGAGCTGTTGCTCGG + Intronic
1121479345 14:94249857-94249879 CTATTCTTTTAGCTGTTCCCTGG - Intronic
1122527375 14:102397104-102397126 CTGTGCCTATACCTTTTCCTAGG - Intronic
1122587470 14:102819219-102819241 CTGTGGCTGTCCCTGTTCCTTGG + Intronic
1123185223 14:106510247-106510269 CTGTGCTTGTTGCTGCCGCTGGG + Intergenic
1124649454 15:31464311-31464333 CTCTGATAGCAGCTGTTCCTTGG + Intergenic
1125145587 15:36463862-36463884 CTGTGCATATAGGTGTTCGTGGG + Intergenic
1126375965 15:47996838-47996860 TTGTCCTTGTTGCAGTTCCTGGG - Intergenic
1126731797 15:51691172-51691194 CTGTGCTTGTTTCAGTTGCTTGG - Intronic
1129981780 15:79878806-79878828 CTGTGCTTGTTGCTGCCTCTGGG + Intronic
1132558468 16:582967-582989 CTGTGCCGCAAGCTGTTCCTTGG + Exonic
1134437813 16:14277677-14277699 CTGTCTTTGTAGCTGTTTGTTGG - Intergenic
1135398456 16:22148811-22148833 CTGTGCTTGCAATTGTCCCTAGG - Intronic
1136492881 16:30622084-30622106 CTGCGCTTCCAGGTGTTCCTGGG + Intronic
1137002678 16:35243894-35243916 CTGTACTTGTAGCTACTCATGGG + Intergenic
1137030422 16:35518791-35518813 CTGTGCTTCTGGGTGTTCCTGGG - Intergenic
1141595229 16:85093185-85093207 CGCTGCCTGTAGCTGTGCCTGGG + Exonic
1144272501 17:13631591-13631613 CTGTGCTTGCAGTTGTTCAAAGG + Intergenic
1144393614 17:14820645-14820667 CTGTGCATCTCGCTGGTCCTGGG + Intergenic
1144537480 17:16104992-16105014 CTGTCCTCTTTGCTGTTCCTGGG - Intronic
1144855326 17:18264304-18264326 CTGTGCTTGTGGCAGTCCCTGGG + Exonic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1147141416 17:38462775-38462797 CTGTGTGTGTAGCTGTGCATGGG + Intronic
1147409815 17:40241880-40241902 ATGTGTTTGCAGCTGCTCCTTGG + Intronic
1147913646 17:43873411-43873433 CTGTGCTTCCAGGTGTTCCTGGG - Intergenic
1149446105 17:56714509-56714531 CTGTACTTGTAGGTGCTCCAAGG - Intergenic
1149491901 17:57091195-57091217 CTGTGCCTTTAGCTGTCTCTGGG + Intronic
1150910875 17:69386204-69386226 CAGTGCTTATAGCAGTTCCTAGG - Intergenic
1151514842 17:74586625-74586647 CTGAGCTTCCAGGTGTTCCTGGG - Intronic
1152170435 17:78742896-78742918 CTGTGCATTTAGCTGTGGCTAGG - Intronic
1153890225 18:9507135-9507157 CTATGCTTGTTGGTGTTTCTGGG + Intronic
1155391637 18:25343987-25344009 CAGTGCTTGTAGCTGTGGCAGGG + Intronic
1157092362 18:44651323-44651345 CTGTGTTTGTAGATCATCCTTGG + Intergenic
1159033479 18:63254975-63254997 CTGTACTTGGATCTGGTCCTTGG + Intronic
1160287213 18:77554873-77554895 CTGTGATTGTATCAGTGCCTTGG - Intergenic
1160394273 18:78560117-78560139 TTGTGCCTGTAGGTGTTCCCCGG + Intergenic
1160792075 19:927572-927594 CTTTGCTTGGAGCTCTTCCGTGG + Intronic
1164013947 19:21235330-21235352 CTGCGCTTCCAGGTGTTCCTGGG - Intronic
1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG + Intronic
1166939992 19:46356649-46356671 CCATGCTTGTAACTGTTTCTGGG + Intronic
925346294 2:3174475-3174497 CTGTGCGTGTCGTTGTGCCTGGG - Intergenic
925442720 2:3902252-3902274 CTGTGCTTTGAGCTGTTGTTTGG + Intergenic
926146823 2:10401401-10401423 CTGTTCTTTTGGGTGTTCCTAGG + Intronic
926765369 2:16319045-16319067 CTGTGCTTGGAGCAGCTCCATGG - Intergenic
927516936 2:23677316-23677338 GTGAGGTTGTAACTGTTCCTAGG + Intronic
928437663 2:31266172-31266194 CTGGGCCTGCAGCTGGTCCTGGG - Exonic
929034681 2:37679465-37679487 CTGTGGTTTCAGCTGTTTCTTGG - Intronic
930021189 2:47003206-47003228 CTGTGCGTGAGGCTGTGCCTGGG + Intronic
930710662 2:54548357-54548379 CTGTGCTTGTACCGCATCCTGGG + Intronic
931465930 2:62486818-62486840 CTGGGATTGGAGCTGTCCCTGGG - Intergenic
932883662 2:75527894-75527916 CTGTGTTTTTGGCTGTTTCTTGG - Intronic
932890802 2:75595921-75595943 CTGTGCATGTAGGTGATGCTGGG + Intergenic
933551386 2:83781343-83781365 CTGAGCCTGTATCTGTCCCTGGG - Intergenic
933691077 2:85180062-85180084 CAGTCCTTGCAGCTGTTCCCAGG - Intronic
937770148 2:125711072-125711094 ATGTGCTCTTAGCTCTTCCTTGG - Intergenic
940001180 2:148967481-148967503 CTGTGCTTGCTGGTGTGCCTTGG + Intronic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
941157164 2:161993345-161993367 CTGTGCTGCTAGCTATTCCATGG + Exonic
941635699 2:167932843-167932865 CTATGCTGGTAGCTCGTCCTAGG + Intergenic
942115723 2:172727163-172727185 CTCTGCTTGCAGCTGCACCTGGG - Intergenic
942122310 2:172790443-172790465 CTGTACTTGGAGCTTTTGCTTGG + Intronic
942268068 2:174248098-174248120 CTGTTCCTGTATCTGTTCTTTGG - Intronic
944583274 2:201151791-201151813 CTGTGCTTGCTTCTGTTGCTGGG + Intronic
945255311 2:207798280-207798302 CTGTGTTTGTATCTGTGCTTTGG + Intergenic
946013523 2:216585499-216585521 CTTGGCTTGTAGATGGTCCTTGG - Intergenic
946828474 2:223703607-223703629 CTGTGTTTGAGGCTTTTCCTGGG + Intergenic
949052900 2:241906794-241906816 CTGTGCTTGTTGCTGCCTCTAGG + Intergenic
1174253230 20:49234895-49234917 CTGAGCTGGCAGCTGTTTCTAGG - Intronic
1174353764 20:49985238-49985260 CTGTGCCTGGAGCTGCTCTTTGG + Intronic
1175832860 20:61976580-61976602 CAGTGCTTGGACCTGGTCCTGGG + Intronic
1176119399 20:63447210-63447232 CTGTGTTTGTAGCAGTTGATGGG - Intronic
1177739437 21:25136289-25136311 CTTTGCCTGCAGCAGTTCCTGGG + Intergenic
1178357758 21:31922946-31922968 CTGTGTATGAAGGTGTTCCTGGG + Intronic
1179178104 21:39023113-39023135 CTATGTTTGCAGCTGTTCTTTGG - Intergenic
1183867012 22:40712016-40712038 CTGTGCCTGTAGCCATCCCTGGG - Intergenic
951204519 3:19911040-19911062 TGATGCTTGTAGATGTTCCTTGG - Intronic
951371764 3:21858314-21858336 CTGTGCATATAACTGTTCCTTGG - Intronic
952294010 3:32045253-32045275 CTTTGCTTGTAGCTTCTACTGGG + Intronic
952963055 3:38604696-38604718 CTGTGGTTCTAGCTTTTCCAGGG - Intronic
955801053 3:62687050-62687072 CCATGCTTGTGGCTGTTCCCAGG - Intronic
955840110 3:63103601-63103623 ATGTGCTAGGAGCTGTTCTTGGG + Intergenic
957294544 3:78320587-78320609 CTGTTTTTGGAGCTTTTCCTAGG - Intergenic
959962303 3:112312349-112312371 CTGTGCCTGTTGCTGCCCCTGGG - Intergenic
960505923 3:118493960-118493982 CTATGTTTGTAGGTGTTCCAAGG + Intergenic
961354393 3:126326637-126326659 CTGTGCTTTAGGCTGTGCCTAGG + Intergenic
961394947 3:126580038-126580060 CTGGGCTTCAAGCTGTTCCGTGG - Intronic
962027978 3:131568704-131568726 CAGTGTGTGGAGCTGTTCCTGGG + Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962479446 3:135785864-135785886 CTGTGCTGGTGGCTCTTCCAAGG + Intergenic
964770894 3:160224184-160224206 CTTTGCTTTTATCTGATCCTCGG + Intergenic
965419097 3:168434914-168434936 GTGTGCTTGTTGCTGTTGTTTGG - Intergenic
966282829 3:178254677-178254699 CTGTGTTTGTAGCAGTAGCTGGG - Intergenic
966865579 3:184257490-184257512 CTGAGCTACGAGCTGTTCCTCGG + Exonic
970551319 4:17184662-17184684 CTGTGGTTCCAGGTGTTCCTTGG - Intergenic
971807903 4:31384330-31384352 CTGAGCCTGTATCTTTTCCTGGG - Intergenic
972215486 4:36893196-36893218 CTGAGTTTGTACCTTTTCCTTGG + Intergenic
972844931 4:42975965-42975987 CTGTACGTGAAGCTGTTCCTTGG - Intronic
973004594 4:44991791-44991813 TTGTGTTAGTAGCTGTTCCTTGG - Intergenic
981331018 4:143510520-143510542 ATGTCCCTGTAGCTGTTTCTAGG + Intergenic
981651279 4:147061740-147061762 CTTTGCTTGTAGATCTTTCTAGG - Intergenic
981845814 4:149167453-149167475 CTGGGATGGTATCTGTTCCTAGG - Intergenic
982936157 4:161478874-161478896 TTTTGTTTGTAGCTGTTGCTAGG - Intronic
983755511 4:171329535-171329557 CTGTGGGAGTCGCTGTTCCTGGG + Intergenic
986000790 5:3629212-3629234 AGGTGCTTGTAGCTCTTCCCAGG - Intergenic
986170816 5:5313167-5313189 CTGAGGTTGTAACTTTTCCTGGG + Intronic
986664134 5:10085264-10085286 CTATGCTGGTGGCTGTGCCTTGG - Intergenic
989655033 5:43737288-43737310 CTGGGCTCCCAGCTGTTCCTAGG + Intergenic
989992761 5:50787359-50787381 CTGTTCTCCAAGCTGTTCCTAGG + Intronic
991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG + Intergenic
993465014 5:88234439-88234461 CTGTACTTGTAGGTTTTACTTGG - Intronic
994053585 5:95390240-95390262 CTCTGCTTGTGACTGTTTCTTGG + Intergenic
994059674 5:95460359-95460381 CTGTGCTTGAAGCCCTTCTTAGG - Intergenic
995401873 5:111751416-111751438 CTATTCTTGAAGCTCTTCCTAGG + Intronic
995660759 5:114480388-114480410 TTGTGAATGTATCTGTTCCTGGG - Intronic
996689090 5:126318631-126318653 CTGTCCTTGTAGTTTTTTCTGGG - Intergenic
998788344 5:145737576-145737598 CTGTGCTTGTTGCTGTTTTCAGG - Intronic
998856334 5:146398574-146398596 CTCTGCTTCTGGCTGATCCTGGG - Intergenic
998856360 5:146398704-146398726 CTCTGCTTCTGGCTGATCCTGGG - Intergenic
999508533 5:152223647-152223669 CTGTCCTTCTGGCTGGTCCTTGG + Intergenic
1001315879 5:170641063-170641085 CTCTGCTTGAATCTTTTCCTTGG - Intronic
1002969151 6:1996230-1996252 CTGTGCTTGAAGCAGTTGTTGGG - Intronic
1005485289 6:26293769-26293791 CTGTGCTTCTGGGTGTTCCTGGG + Intergenic
1006638555 6:35476796-35476818 GTGTGCTTGTAGCTGTGTATTGG + Intronic
1011360895 6:86523484-86523506 CTGTGAATGTACCTGGTCCTGGG + Intergenic
1015108561 6:129566357-129566379 CAGTGCTAGTAACTCTTCCTTGG - Intergenic
1015406601 6:132844203-132844225 CTGTGCAGGTAGCTTTGCCTGGG + Intergenic
1015806950 6:137119360-137119382 CTGTGCCTGTTGCTGCCCCTGGG - Intergenic
1016468680 6:144352038-144352060 CTGTGCCTTTAGCTTCTCCTTGG + Intronic
1019168884 6:170117503-170117525 CTGTGTCTGTGGCTGTTTCTAGG - Intergenic
1022405147 7:30082352-30082374 ATGTGCTAGAAGCTGCTCCTGGG - Exonic
1023223370 7:37943996-37944018 CTGTGCTGGCAGCTGCTCCCCGG + Intronic
1024051268 7:45624847-45624869 CCGTGCTTGGAGCTGATGCTGGG + Intronic
1026116275 7:67498300-67498322 CTGTCCTTGTAGCATTTTCTGGG - Intergenic
1029944979 7:104522851-104522873 CTGTGCATGTCCCTGTTGCTTGG - Intronic
1031123352 7:117745844-117745866 CAGGTCTAGTAGCTGTTCCTTGG + Exonic
1031347469 7:120686697-120686719 CTGTGCTTGTAGCCCTTCCCAGG - Intronic
1031523280 7:122792792-122792814 CTTTGCTGTTAGCTGTTTCTTGG - Intronic
1032433923 7:131884906-131884928 CTGTGCTTGGGGCTGGTCATTGG + Intergenic
1033521421 7:142164851-142164873 CTTTGCTTGTAGATGGTTCTGGG - Intronic
1033574417 7:142666520-142666542 GTGTTCTTTTAGCTGTTCTTGGG - Exonic
1034023563 7:147671618-147671640 ATGTGCTATTAGCTGTTCCATGG - Intronic
1034369704 7:150584255-150584277 CTGCGCTTCCAGGTGTTCCTGGG - Intergenic
1035036415 7:155898034-155898056 CTGTGCTTTCAGCTCCTCCTGGG + Intergenic
1036126686 8:6069430-6069452 CTGTGCCTGAAGCAGTTTCTAGG - Intergenic
1039092134 8:33843607-33843629 CTGAGCTTGTCGCTGTTTCTGGG + Intergenic
1039176428 8:34812517-34812539 CTGTGCTTGTCACAGTTCATTGG + Intergenic
1041402999 8:57464347-57464369 CTGAGCTTCTAGGTATTCCTGGG - Intergenic
1041461825 8:58119775-58119797 CTCTGCTTGTGGCAGTTCTTTGG + Intronic
1042419702 8:68571211-68571233 CTTTGCCTGTAGCTACTCCTAGG + Intronic
1042427837 8:68669772-68669794 TTCTGTTTGTAGCTCTTCCTTGG - Intronic
1042626505 8:70763804-70763826 CTGGCCTTGTTGCTGGTCCTTGG + Intronic
1042861909 8:73322935-73322957 GTGTGCATGTATCGGTTCCTAGG + Exonic
1044149735 8:88760593-88760615 TTGTGTTTTTAGCTTTTCCTAGG + Intergenic
1044600630 8:94000361-94000383 CTGTGTTAGTAGTTCTTCCTTGG - Intergenic
1045196755 8:99940351-99940373 CTGTGCTTGATGGTGTCCCTTGG + Intergenic
1045844713 8:106620539-106620561 CTGTGGTTCTAACTGTTCTTAGG + Intronic
1047710918 8:127551514-127551536 CTGTGATTGAATCTTTTCCTTGG + Intergenic
1048161923 8:132029224-132029246 CTGTGCTTGAGGGGGTTCCTAGG - Intronic
1048646793 8:136429348-136429370 CGATGCTTGTAGATGTTCATTGG - Intergenic
1048952527 8:139508214-139508236 CTGGGCTAGTCTCTGTTCCTGGG + Intergenic
1050430367 9:5556027-5556049 CTTTTCATGTAGCTGTTGCTTGG + Intronic
1051853458 9:21535912-21535934 CTGTGTTTGTAGGTGGACCTTGG - Intergenic
1052900191 9:33786967-33786989 CTGTGCTTGTAGGTGGGCATGGG + Intronic
1053127231 9:35592120-35592142 CTTTGTTTCTAGCTGTTCTTGGG - Intergenic
1055117868 9:72624923-72624945 CTGTTTTTGTACCTTTTCCTAGG - Intronic
1055341243 9:75285819-75285841 CTGTGAATGTATCTGGTCCTGGG + Intergenic
1056060288 9:82878322-82878344 GTGTGATTGTAGCTGTTCCCTGG - Intergenic
1057874666 9:98744691-98744713 CTTTTTTTGTTGCTGTTCCTTGG - Intronic
1058924432 9:109648399-109648421 CAGTGCTTGGAGCAGTGCCTAGG - Intronic
1059669079 9:116476446-116476468 CTGGGCTAGTGGCTCTTCCTTGG + Intronic
1059677622 9:116554933-116554955 CTGTGCTTGTTGATTTTCCAGGG + Intronic
1061288192 9:129636052-129636074 CTGGGCTTGAGGCTGCTCCTTGG + Exonic
1062100019 9:134723158-134723180 CTGAGCTTGCACCTGTTCCCTGG - Intronic
1186225062 X:7389702-7389724 CTGTGATTGCAGATGTTCTTTGG - Intergenic
1188252397 X:27913598-27913620 CTGTCCTTGTAGCTGTGGCAGGG - Intergenic
1189855625 X:45222414-45222436 TGGTGCTTGTAGATGTTCTTCGG + Intergenic
1191163112 X:57356364-57356386 CTGTGAAGGTATCTGTTCCTGGG + Intronic
1193504848 X:82329725-82329747 TTATGCTTGTAGATGTTCATTGG + Intergenic
1195015965 X:100781292-100781314 CAGTTCTTGTAGCAGTGCCTTGG + Intergenic
1198232581 X:134706055-134706077 CTGTGCTTGTTGGTATTACTGGG - Intronic
1201341761 Y:12942046-12942068 CTGTACTTGTTGCCTTTCCTTGG + Intergenic