ID: 1165850805

View in Genome Browser
Species Human (GRCh38)
Location 19:38849506-38849528
Sequence CAGGCGCCTGCGCGTGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165850805_1165850810 9 Left 1165850805 19:38849506-38849528 CCCCGCGCACGCGCAGGCGCCTG 0: 1
1: 0
2: 1
3: 6
4: 256
Right 1165850810 19:38849538-38849560 AAACCCCGCCGTTTGCCCAACGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165850805 Original CRISPR CAGGCGCCTGCGCGTGCGCG GGG (reversed) Intronic
901009489 1:6191530-6191552 CAGGCGCCTGCCACTGCGCCTGG - Intronic
902501445 1:16914147-16914169 CGGGGGCGCGCGCGTGCGCGGGG + Intronic
904030587 1:27531261-27531283 CAGGCGCCTGCGCCTACGCCCGG + Intergenic
904528845 1:31155124-31155146 CGGGCGCGGGCGCGGGCGCGGGG + Intergenic
906064130 1:42968013-42968035 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
907592745 1:55691262-55691284 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
912881654 1:113422593-113422615 CAGGCGCCTGTGCCAGCGCCGGG - Intronic
913680966 1:121186674-121186696 CAGCCGCCTGCGCGGGCTCCGGG - Intronic
914032797 1:143974313-143974335 CAGCCGCCTGCGCGGGCTCCGGG - Intergenic
914156650 1:145093652-145093674 CAGCCGCCTGCGCGGGCTCCGGG + Intronic
914226668 1:145725273-145725295 CAGGCGCCTGCCACTGCGCTCGG - Intronic
914710991 1:150213636-150213658 CAGAGACCTGCGCATGCGCGGGG - Intergenic
916700233 1:167285447-167285469 CAGGCGCCTGCTGCTGCGCCTGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918238851 1:182604308-182604330 CAGGAGGCTCCGCGTGCGCCAGG + Exonic
920468278 1:206205198-206205220 CAGCCGCCTGCGCGGGCTCCGGG - Intronic
1065546744 10:26829081-26829103 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1067113417 10:43416876-43416898 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1067116932 10:43442584-43442606 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1067416425 10:46106486-46106508 CCGGCGCCTGCGGGAGGGCGAGG - Intergenic
1067416428 10:46106492-46106514 CGGGCGCCGGCGCCTGCGGGAGG - Intergenic
1067436556 10:46282964-46282986 CCGGCGCCTGCGGGAGGGCGAGG - Intergenic
1067436559 10:46282970-46282992 CGGGCGCCGGCGCCTGCGGGAGG - Intergenic
1067485735 10:46648221-46648243 CAGGCGCCTGCCACCGCGCGCGG - Intergenic
1067609021 10:47693430-47693452 CAGGCGCCTGCCACCGCGCGCGG + Intergenic
1068737943 10:60435942-60435964 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1069023114 10:63511565-63511587 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1069468223 10:68661170-68661192 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1071420116 10:85486818-85486840 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1071624610 10:87155075-87155097 CAGGCGCCTGCCACCGCGCGCGG + Intronic
1072591486 10:96832245-96832267 GACGCGGCTGGGCGTGCGCGGGG + Intronic
1073259420 10:102177593-102177615 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1074503341 10:114044972-114044994 CGGGCGGCGGCGCGGGCGCGGGG - Exonic
1075238383 10:120753591-120753613 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
1075287012 10:121195568-121195590 CAGGCACCTGGGAGTGCGTGAGG + Intergenic
1075370027 10:121927958-121927980 CGGGCGGCTGAGCGTTCGCGGGG - Exonic
1075964473 10:126599326-126599348 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1076650176 10:131982012-131982034 TTGGGGCCTGCGCGTGCGCAGGG + Intergenic
1077322127 11:1947232-1947254 CGGGCGCTGGCGCGTGCGGGGGG + Intergenic
1077359185 11:2133140-2133162 CAGGCCCCTGCGCAGGCGCTGGG + Exonic
1079128490 11:17734783-17734805 CCGTCGCCTGCTCGTTCGCGCGG - Intergenic
1086245226 11:84743865-84743887 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1087461976 11:98456964-98456986 CAGGCGTCTGCGCCTTCGGGAGG - Intergenic
1087633354 11:100676382-100676404 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1087759334 11:102089077-102089099 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1090788365 11:130069625-130069647 CAGGCGCGGGGGCGTGCGCGCGG - Intergenic
1202805145 11_KI270721v1_random:2545-2567 CGGGCGCTGGCGCGTGCGGGGGG + Intergenic
1093225857 12:16482486-16482508 CAGGCGCCTGCCACTGCGCCTGG - Intronic
1093452878 12:19335556-19335578 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1093464842 12:19439370-19439392 CAGGCGCCGGGGCGGGGGCGGGG + Intronic
1095267464 12:40176965-40176987 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1096515375 12:52152524-52152546 CGGGCGCCTGAGGGTGGGCGCGG + Intergenic
1096532750 12:52252269-52252291 CAGGCGCCTGCTGGAGGGCGAGG - Intronic
1096537905 12:52287109-52287131 CAGGCGCCTGCTGGAGGGCGAGG - Exonic
1096540866 12:52306251-52306273 CAGGCGCCTGCTGGAGGGCGAGG + Exonic
1096542506 12:52315900-52315922 CAGGCGCCTGCTGGAGGGCGAGG - Exonic
1096549372 12:52362258-52362280 CAGGCGCCTGCTGGAGGGCGAGG - Exonic
1096552183 12:52380370-52380392 CAGGCGCCTGCTGGAGGGCGAGG - Exonic
1096647587 12:53047176-53047198 CGGGCGCGGGCGCGGGCGCGGGG + Intronic
1097848641 12:64390515-64390537 CAGGCGGCTGTTCCTGCGCGCGG + Exonic
1098269742 12:68758275-68758297 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1100621844 12:96284316-96284338 CAGGCGCCTGCCCCTGCGCCTGG - Intronic
1104160577 12:126176167-126176189 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1104256741 12:127146160-127146182 CAGCCGTGTGCGCCTGCGCGCGG + Intergenic
1105008852 12:132740891-132740913 CAGGAGCCTGGGCGTGCACCAGG + Intronic
1106185355 13:27404961-27404983 CAGGCGCCTCCGCGTCTGCTGGG + Intergenic
1111217874 13:85167877-85167899 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1115986252 14:39105818-39105840 CAGGCGCCTGCCACTGCGCCTGG - Intronic
1117423769 14:55574654-55574676 CAGGCGCCTGCCACTGCACGCGG - Intronic
1118635035 14:67740763-67740785 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1118725804 14:68628392-68628414 CAGGAGAGTGCGCATGCGCGCGG - Intronic
1123431146 15:20217638-20217660 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1123490381 15:20775596-20775618 CAGGCGCGGGCGCGTGAACGTGG - Intergenic
1123546882 15:21344683-21344705 CAGGCGCGGGCGCGTGAACGTGG - Intergenic
1124575396 15:30903680-30903702 CAGGCGCCTGCCTCTGCGGGTGG + Intergenic
1125916913 15:43495672-43495694 CAGGCGCCTGCCCGCGCACCCGG - Intronic
1126580321 15:50236888-50236910 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
1126592707 15:50355451-50355473 CCGGCGCCTGCGCGGCAGCGGGG + Intergenic
1126766924 15:52019121-52019143 CCGGCGCGTGCGGGTGCGCTGGG + Intronic
1127415132 15:58749922-58749944 CAGGGGCGCGCGCATGCGCGCGG + Exonic
1127814552 15:62596120-62596142 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1128373005 15:67054318-67054340 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
1128906768 15:71474360-71474382 CAGGCGCCTGCCCCTGTGCCTGG + Intronic
1202955213 15_KI270727v1_random:71899-71921 CAGGCGCGGGCGCGTGAACGTGG - Intergenic
1132490720 16:229171-229193 TCTGCGCCTGCGCCTGCGCGGGG - Intronic
1133078423 16:3297605-3297627 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1133136773 16:3717642-3717664 CAGCTGCCTGCTCGGGCGCGTGG + Intergenic
1133214697 16:4284626-4284648 CAGGTGCCTGCCCTTGCGCCTGG - Intergenic
1133551011 16:6854735-6854757 CAGGCGCCTGCCATTGCGCCCGG + Intronic
1136018006 16:27418210-27418232 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1137061607 16:35795608-35795630 CTGGCGCATGCGCATTCGCGAGG + Intergenic
1140033873 16:71358667-71358689 CTGGAGCCTGCGCCTGCGCCCGG - Intergenic
1140080627 16:71743801-71743823 CAGGCGCCTGCTACTGCGCCTGG - Intronic
1141476878 16:84279993-84280015 CAGGCGCGTGGGCCTGAGCGGGG + Intergenic
1141972374 16:87492522-87492544 AAGGCGCCTCCCCGTGAGCGGGG - Intergenic
1142670715 17:1486248-1486270 CAGGCCCCGGCGCGTGTGGGTGG - Intronic
1142793336 17:2287072-2287094 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1143174616 17:4948984-4949006 CCCGCGCCTGCGCCTGCGCCGGG + Exonic
1143228438 17:5328806-5328828 CAGGCGCCTGCCACTGCGCCTGG - Intronic
1143546901 17:7602423-7602445 CAGGCGCCTGCCATTGCGCCTGG - Intronic
1143971784 17:10801191-10801213 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
1144008092 17:11119325-11119347 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1145033828 17:19526043-19526065 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1146166544 17:30594090-30594112 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
1146537214 17:33663031-33663053 CAGGCGCATGCGAGTGCGTGTGG - Intronic
1146818057 17:35960651-35960673 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1150068448 17:62131683-62131705 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1150904935 17:69327146-69327168 CAGGAGCGCGCGGGTGCGCGCGG - Intronic
1151594093 17:75066320-75066342 CAGGCGCCTGCCTGCGCGCCTGG + Intergenic
1151662519 17:75526157-75526179 CTGGCGCCTGCACGTGGGCCCGG - Intronic
1152175158 17:78782342-78782364 CAGGCGCAGGCGCGGGCGGGCGG - Intergenic
1152793390 17:82293650-82293672 CAGGGGCCTGCGCGAAGGCGGGG - Intergenic
1154212013 18:12387522-12387544 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
1157496776 18:48162006-48162028 CCGGCGCCTGCCCGGGCGGGCGG + Intronic
1159285437 18:66343630-66343652 CAGGCGCCTGCCTTTGCGCCCGG + Intergenic
1160163634 18:76492909-76492931 CAGAAGCCTGCGGATGCGCGGGG + Intronic
1161487654 19:4544293-4544315 CAGCCGCCTGGGCGAGCGCAGGG - Exonic
1161961862 19:7527725-7527747 CAGGCACCAGCGCGGGCGGGGGG - Intronic
1162095655 19:8308341-8308363 CCCGCGCGTGCGCGTGCGCAGGG - Exonic
1162100361 19:8335223-8335245 GCGGCGCCTGCGCGAGCTCGAGG - Exonic
1162610732 19:11748889-11748911 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1162763981 19:12906763-12906785 CAGGCGCCTGCCACTGCGCCTGG - Intronic
1163037998 19:14582748-14582770 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1163573584 19:18097834-18097856 GAGGCCCCTGCGCGGGCGGGCGG + Intronic
1165049397 19:33132093-33132115 CGGGCGCGGGCGCGGGCGCGCGG + Exonic
1165850805 19:38849506-38849528 CAGGCGCCTGCGCGTGCGCGGGG - Intronic
1166000688 19:39875784-39875806 CGTGCGCCTGCGCGTGCCGGCGG - Exonic
1166003486 19:39892039-39892061 CGTGCGCCTGCGCGTGCCGGCGG - Exonic
1166904691 19:46099668-46099690 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1166936545 19:46336842-46336864 CAGGCGCCTGCCAGTGTGCCTGG - Intronic
1168570030 19:57459054-57459076 CAGGCGCCTGCCACTGCGCCTGG + Intronic
925221227 2:2143145-2143167 CAGGCGCCTGCCACTGCGCCCGG - Intronic
928093423 2:28390449-28390471 CAGGCGCCGCCGGGAGCGCGCGG - Intergenic
928186456 2:29115424-29115446 GAGTCCCCAGCGCGTGCGCGGGG + Exonic
929974315 2:46617038-46617060 CCTGCGCCTGCGCGTGGGCCTGG - Exonic
930608857 2:53519435-53519457 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
933438963 2:82285331-82285353 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
936904106 2:117516950-117516972 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
938547971 2:132352662-132352684 CCTGCGCCTGCGCGGGCGCTGGG - Intergenic
941020935 2:160407557-160407579 CGGGCGCGGGCGCGGGCGCGGGG + Intronic
941098922 2:161275885-161275907 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
944245515 2:197526457-197526479 CAGGCGCCCGCCCCTGCGCCTGG + Intronic
944778537 2:202994310-202994332 CAGGCGCCTGCCCCTGCGCCTGG + Intronic
948473661 2:238203195-238203217 AAGGCGCCGGCGCGACCGCGTGG - Intronic
948923531 2:241079267-241079289 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1169233676 20:3911438-3911460 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1170111813 20:12812597-12812619 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1171504712 20:25623984-25624006 CCGCCGCCTGCGCATGCGCAAGG + Exonic
1172925646 20:38532196-38532218 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1173494273 20:43507668-43507690 CGCGCGCCTGCGCGTTCGGGGGG - Exonic
1174816805 20:53694189-53694211 CAGGCACCTGCCAGTGCGCTTGG + Intergenic
1176547883 21:8209256-8209278 CCGGCGCCCGCGGGCGCGCGAGG - Intergenic
1176548954 21:8213386-8213408 CGGGCGCGCGCGCGTACGCGCGG - Intergenic
1176556847 21:8257598-8257620 CGGGCGCGCGCGCGTACGCGCGG - Intergenic
1178106959 21:29330305-29330327 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1182296958 22:29315558-29315580 CAGGCGCCGGCGGACGCGCGAGG + Exonic
1182296994 22:29315705-29315727 CAGCCGCCGGCGCGAGCGAGCGG + Exonic
1182338867 22:29603595-29603617 CGGGCGCGTACGCGCGCGCGTGG - Exonic
1183537675 22:38412806-38412828 CAGGCGCCCCCGGGTGCTCGCGG + Intergenic
1184766867 22:46576852-46576874 GCGGCGGCCGCGCGTGCGCGTGG + Intronic
1203253838 22_KI270733v1_random:129693-129715 CGGGCGCGCGCGCGTACGCGCGG - Intergenic
1203255389 22_KI270733v1_random:135280-135302 CACGCGCGCGCGCGCGCGCGCGG - Intergenic
1203261894 22_KI270733v1_random:174772-174794 CGGGCGCGCGCGCGTACGCGCGG - Intergenic
949424395 3:3900844-3900866 CAGGCGCCTGCCACTGCGCCCGG - Intronic
950021519 3:9791271-9791293 CCGGCGCCTGCGTGTGCTTGAGG - Exonic
950297788 3:11846897-11846919 GAAGCGCCTGTGCGTGCGTGGGG - Intronic
950486345 3:13276229-13276251 CAGGCGCCTGCCACTGCGCCAGG + Intergenic
953970527 3:47343742-47343764 CCGGCTCCTGCGCGTGTGCATGG - Exonic
954340173 3:49947107-49947129 CAGGCGCCTGCCACTGCGCCCGG - Intronic
954553365 3:51500039-51500061 TAGGCGCGAGCGCGCGCGCGCGG - Intergenic
956798798 3:72738868-72738890 GGGGCCACTGCGCGTGCGCGCGG - Intergenic
957943281 3:87032196-87032218 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
960654635 3:119989500-119989522 CAGGCGCCTGCCTGTACGCCCGG - Intronic
960926062 3:122795582-122795604 CAGGCGCCTGCCCGCGCTCCAGG + Intronic
961453801 3:127014558-127014580 CGTGCGTCTGGGCGTGCGCGTGG + Exonic
961664353 3:128486824-128486846 CGCGCGCCCGCGCGTGAGCGGGG + Exonic
964234451 3:154508632-154508654 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
966182277 3:177197810-177197832 GAGGCGCCTTCGAGTGCCCGCGG - Intergenic
966611373 3:181871333-181871355 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
966769436 3:183491250-183491272 CAGGCGCCTGCCACTGCACGCGG + Exonic
966818555 3:183908075-183908097 CAGGGGTGTGCGCGTGCGTGGGG + Intergenic
968187005 3:196639845-196639867 CAGGCGCAGGCGGCTGCGCGGGG - Exonic
968664937 4:1815899-1815921 CAGGCGGCTCCGCGTGAGCCAGG + Intronic
969638481 4:8382847-8382869 CAGGCGCCTGCCACTGCGCCCGG - Intronic
971406023 4:26321237-26321259 CAGGCTCCAGCGCGTGAGGGCGG + Intronic
972486505 4:39545964-39545986 CAGGCGCCTGCCACTGCGCCTGG - Intergenic
972525976 4:39911687-39911709 CAGGCGCCCGCCAGTGCGCCCGG - Intronic
973754883 4:54064682-54064704 CGGGCGCGTGCGTGGGCGCGTGG + Exonic
976417682 4:84797721-84797743 CAGGCGCCTGCCACTGCGCCCGG + Intronic
978095328 4:104769228-104769250 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
979720520 4:123894798-123894820 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
979956252 4:126956583-126956605 CCGGCACCTGTGCCTGCGCGTGG + Intergenic
981034459 4:140154505-140154527 TATGCGCGCGCGCGTGCGCGGGG + Intergenic
984669240 4:182463599-182463621 CAGGCGCCTGCCACTGCGCCTGG + Intronic
986016167 5:3759294-3759316 CAGGCGCCCGCGACTGCGCCCGG + Intergenic
991370119 5:65909757-65909779 CAGGCGCCTGCCACTGCGCCAGG + Intergenic
992690389 5:79236026-79236048 GAGGCGCCGGCGCGCGCGGGCGG + Intronic
992797898 5:80269773-80269795 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
993324601 5:86517285-86517307 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
997988310 5:138522861-138522883 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1001093337 5:168757574-168757596 CAGGCGCCTGCCATTGCGCCCGG + Intronic
1001556811 5:172642152-172642174 CCCGCGCCCGCGCGTGCCCGTGG + Intronic
1002428468 5:179189488-179189510 CAGGCGCCCGCCAGTGCGCCTGG + Intronic
1002663096 5:180804053-180804075 CAGGGGCCTGCGGGTGCGCGCGG - Intronic
1002926769 6:1609688-1609710 CGGGCGCCGGCGCGGGCGCAGGG + Intergenic
1004055503 6:12133833-12133855 CAGGCGCCTGCCACTGCGCCAGG - Intronic
1005723712 6:28628291-28628313 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
1006694710 6:35921075-35921097 CAGGCGCCTGCGCACTCGAGTGG + Exonic
1011044373 6:83065818-83065840 CAGGCGCCTGCGCCGCAGCGGGG - Exonic
1013010838 6:106118361-106118383 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1013666567 6:112355594-112355616 CAGGCGCCTGCCACCGCGCGCGG + Intergenic
1014238523 6:118989102-118989124 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1014798213 6:125749299-125749321 CGGGCGCCAACGCGGGCGCGCGG - Intronic
1015226247 6:130860673-130860695 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1016340918 6:143060815-143060837 CGGGCGCGGGCGCGGGCGCGGGG - Intronic
1017490565 6:154941192-154941214 CAGGCGCCTGCCACTGCGCCTGG - Intronic
1017696589 6:157021725-157021747 GAGGAGCCTGCGGGCGCGCGGGG - Intronic
1018757642 6:166863289-166863311 CAGGCGCCTGCGGGAGAGCAAGG + Intronic
1018871341 6:167785517-167785539 CAGGCGCCTGCCGCTGCGCCCGG - Intronic
1020283606 7:6663979-6664001 CAGGCGCTTGCGGCTTCGCGGGG + Intergenic
1020930577 7:14388020-14388042 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1023134694 7:37039399-37039421 CAGGCTCCTGCTCGTGGGCAGGG + Intronic
1023859477 7:44208988-44209010 CAGGCGCCTGTGTGTGAGCTGGG - Intronic
1023881705 7:44324860-44324882 CTTGCGCCTGCTCCTGCGCGTGG - Intronic
1025810925 7:64875024-64875046 CAGGCTCATGCGCATTCGCGAGG - Intronic
1025811329 7:64877526-64877548 CTGGCGCATGCGCATTCGCGAGG - Intronic
1029536991 7:101162939-101162961 GGGGCGCCGGCGCGCGCGCGCGG + Exonic
1032101012 7:128977737-128977759 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1033794489 7:144831541-144831563 CAGGCGCCTGCCACTGCGCCTGG - Intronic
1039528805 8:38240926-38240948 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1039617978 8:38971802-38971824 CAGGCGCCTGCCACTGCGCCCGG - Exonic
1039918358 8:41875976-41875998 CAGGCGCGGGTGTGTGCGCGCGG - Intronic
1040856786 8:51956842-51956864 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
1041068164 8:54101916-54101938 CACGCGCCTGAGCGTGCGCCCGG - Exonic
1042870594 8:73394926-73394948 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1044569402 8:93700573-93700595 AAGGCGCCTGGGCGCGCGCTGGG - Exonic
1045165902 8:99604640-99604662 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1045304515 8:100947109-100947131 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1046214502 8:111126237-111126259 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1049803178 8:144527502-144527524 CCGGCGCCGGAGCGTGCGGGCGG - Exonic
1051594177 9:18807500-18807522 CAGGCGCCTGCCACTGCGCCCGG - Intronic
1051656284 9:19385162-19385184 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
1052127211 9:24791919-24791941 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1052311386 9:27072929-27072951 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1055299144 9:74864928-74864950 CAGGCGCCCACGACTGCGCGTGG - Intronic
1057036047 9:91812381-91812403 CAGGCTCCTGCGCGGGGGCCGGG + Intronic
1057119091 9:92554778-92554800 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1057432349 9:95005330-95005352 CAGGCTCCGGCTCGGGCGCGGGG + Intronic
1057587036 9:96337837-96337859 CAGGCACCTGCCCCTGCGCCTGG - Intronic
1059051060 9:110926061-110926083 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1059107182 9:111521832-111521854 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1062272234 9:135714808-135714830 CCGGCGGCTGCGGGGGCGCGCGG - Intronic
1186572722 X:10733004-10733026 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1186768146 X:12791761-12791783 CAGGCGCGGGCGCGGGGGCGCGG - Intronic
1189433318 X:40968866-40968888 CAGGCGCCTGCCACTGCGCCCGG + Intergenic
1190070643 X:47276425-47276447 CAGGCGCCTGCCACTGCGCCTGG + Intergenic
1191717879 X:64205529-64205551 CAGGAGCCTCCGCCTGCCCGCGG - Intronic
1192216741 X:69164629-69164651 CGTGTGCCTGCGCATGCGCGGGG + Intronic
1192578862 X:72264351-72264373 CAGGCGCCTGCCACTGCGCCCGG + Intronic
1194935402 X:99941554-99941576 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1196631840 X:117950322-117950344 CAGGCACCTGCCACTGCGCGCGG - Intronic
1200129941 X:153836187-153836209 CAGGCGCCTGCCACTGCGCCCGG - Intergenic
1200168307 X:154052602-154052624 CAGGCGCCTGCCACTGCGCCTGG + Intronic
1200217773 X:154375731-154375753 CAGGCGCCTGCCACTGCGCCCGG - Intergenic