ID: 1165851234

View in Genome Browser
Species Human (GRCh38)
Location 19:38851411-38851433
Sequence GGGGCTGCCCGCGCAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165851229_1165851234 -3 Left 1165851229 19:38851391-38851413 CCTACGGCATTTAACATTATGGG No data
Right 1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 341
1165851227_1165851234 1 Left 1165851227 19:38851387-38851409 CCGTCCTACGGCATTTAACATTA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 341
1165851226_1165851234 2 Left 1165851226 19:38851386-38851408 CCCGTCCTACGGCATTTAACATT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 341
1165851224_1165851234 10 Left 1165851224 19:38851378-38851400 CCCGGGATCCCGTCCTACGGCAT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 341
1165851225_1165851234 9 Left 1165851225 19:38851379-38851401 CCGGGATCCCGTCCTACGGCATT 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165851234 Original CRISPR GGGGCTGCCCGCGCAGGGTG TGG Intronic
900333520 1:2149156-2149178 ACGGCTTCCCCCGCAGGGTGTGG - Intronic
900342631 1:2195948-2195970 AGTGCTGCCCGGGCAGGGGGAGG + Intronic
900417777 1:2543009-2543031 GGGGCTTCCAGCCCAGCGTGGGG + Intergenic
900488684 1:2935583-2935605 TGGGCTGCACGCCCAGGCTGGGG + Intergenic
900637637 1:3673840-3673862 GGGGCTTCCCAGGCAGGGTGCGG + Intronic
901013059 1:6211794-6211816 GGGGCTGCCCTGGGAGGCTGGGG + Intronic
901109944 1:6785897-6785919 GGGGATGCCCGGTCCGGGTGGGG - Intronic
901434025 1:9235153-9235175 GGGGCTGGCAGCGCAGGCTCCGG - Intronic
902290384 1:15431258-15431280 GGGTCTTCCCAGGCAGGGTGTGG + Intergenic
902467382 1:16626493-16626515 GGGCCTGACCCTGCAGGGTGAGG - Intergenic
902838689 1:19062073-19062095 GGGGCTGCAGATGCAGGGTGTGG - Intergenic
903132760 1:21290295-21290317 GGAGCGGCCCGCGCGGGGAGGGG + Intronic
903349955 1:22711341-22711363 GCGGCTGCCCGAGCCGGGGGCGG - Intronic
903364057 1:22795072-22795094 GGGGGTGCCCAAACAGGGTGGGG - Intronic
903736708 1:25534481-25534503 GGTGCTGCCAGCCCAGGGTGGGG + Intergenic
903738776 1:25546086-25546108 GAGGCTGCCAGCCCAGCGTGGGG - Intronic
903867632 1:26410697-26410719 GGGGCTGCCCGCGGGGGGTTGGG + Intergenic
903953968 1:27012421-27012443 GGGGCTGCACGCTCAGCGTGGGG + Exonic
904082325 1:27879990-27880012 GGGAATGCCAGGGCAGGGTGGGG - Exonic
904210682 1:28885158-28885180 GTGGCTGCCCCAGCAGGGAGGGG + Intergenic
904360124 1:29965735-29965757 GGAGCAGCCCCAGCAGGGTGGGG + Intergenic
906695951 1:47823584-47823606 GGGGCTGTCAGAGCAGGGGGAGG + Intronic
907401718 1:54228700-54228722 CTGGCTGCCCAGGCAGGGTGGGG + Intronic
911890978 1:103371369-103371391 GGGGCTGACCTCTCAGGCTGCGG + Intergenic
913453454 1:119008018-119008040 GGCCCTGACTGCGCAGGGTGCGG + Intergenic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
916960248 1:169882132-169882154 GGGGCTGCCCACGCAGCTTGTGG + Intronic
918016020 1:180632655-180632677 GGGGGCGCTCGCCCAGGGTGGGG - Intronic
919755813 1:201065810-201065832 GGAGCTGCTCGCGCAGGCTGGGG + Intronic
920002060 1:202807435-202807457 GGGGCGGCCAGCGCTGGCTGGGG - Intronic
920292924 1:204936579-204936601 GAGGCTGGCTGCACAGGGTGGGG + Intronic
921166759 1:212513547-212513569 GGTGCTGCCCGCTGGGGGTGAGG - Intergenic
922757152 1:228102838-228102860 GGCGCTGCCGGGGCAGGGTGGGG - Intronic
923375471 1:233357739-233357761 GGGGCTGCCCATGCATGGGGAGG + Intronic
923744403 1:236686815-236686837 CGGGCCGCCCGCGCGTGGTGGGG + Intronic
924527226 1:244863565-244863587 CGGGAGGCCCGCGCGGGGTGGGG - Intronic
924554667 1:245108193-245108215 GGGGCAGCAAGCTCAGGGTGAGG - Intronic
1065173446 10:23054291-23054313 GTGGCTGCCCGTACAGGGTTGGG + Intergenic
1065919017 10:30374648-30374670 GGGGCTGCCCACTCCGGGAGAGG + Intergenic
1066080852 10:31928992-31929014 GGGGCAGCCAGCGTACGGTGTGG + Intergenic
1067047539 10:42992965-42992987 GGGGGTGCTGGCGCAGGCTGAGG - Intergenic
1067937187 10:50623028-50623050 AGGGCTGCCCCCGCGGGGCGGGG - Intronic
1069372692 10:67764367-67764389 GGGGCTGAGGGCTCAGGGTGCGG - Intergenic
1069572470 10:69502701-69502723 GGGGCTCTCCTGGCAGGGTGAGG + Intronic
1070835481 10:79444922-79444944 AGGGCTGCCCTGGCAGGGAGAGG + Intronic
1071487764 10:86114124-86114146 GGGGCTCTCTGCACAGGGTGGGG + Intronic
1071570218 10:86692613-86692635 GGGGCTGCCCGGGGAGGGACGGG - Intronic
1072491177 10:95907565-95907587 GCGGTCGCCCGCGCAGGGCGTGG - Intronic
1074361236 10:112825389-112825411 TGGGCTGCCAGTGCAGGATGGGG - Intergenic
1075785691 10:125048607-125048629 GAGGCTCCCTGCCCAGGGTGTGG + Intronic
1075788330 10:125065546-125065568 GGAGCTGACTGCGCAGGATGTGG - Intronic
1076520589 10:131078490-131078512 GAGGCTGCAGGAGCAGGGTGAGG - Intergenic
1076737487 10:132465305-132465327 GGGGATGGCAGGGCAGGGTGGGG - Intergenic
1076781240 10:132725805-132725827 GGGGCTGCCAGGGCAGGGGCAGG - Intronic
1076795461 10:132795846-132795868 GGGGGTGCCCACTCAGGGAGAGG + Intergenic
1077006000 11:356312-356334 GGGGCGGGACGCGCTGGGTGCGG - Intergenic
1077065070 11:637388-637410 GGGGCTGGCTGGGCAGGGCGCGG + Exonic
1077269257 11:1667397-1667419 AGGGCTGCAGGAGCAGGGTGGGG - Intergenic
1077271288 11:1683308-1683330 AGGGCTGCAGGAGCAGGGTGGGG + Intergenic
1077298976 11:1838544-1838566 GGAGCTGGCCCCGCAGGGAGAGG + Intergenic
1077413112 11:2412667-2412689 GGTCCTGCCCTCGCAGGGTGGGG - Intronic
1077541692 11:3149529-3149551 GGTGCCGCCCGCGCAGGCCGTGG + Intronic
1080037290 11:27722627-27722649 GGGGCAGCCCCCGCAGGATGAGG - Intergenic
1083307734 11:61769804-61769826 GGGCCTCCCCGCTCAGGCTGGGG + Intronic
1083619582 11:64042326-64042348 GGGACTGCACGGGAAGGGTGGGG - Intronic
1083659543 11:64245795-64245817 GGGGCTTCCTGGGGAGGGTGTGG - Intronic
1083823168 11:65183673-65183695 AGGGCTGGCCCCACAGGGTGTGG - Intronic
1084192462 11:67505209-67505231 GGCCCTGCCCGGGCTGGGTGAGG - Exonic
1084660353 11:70543014-70543036 GGGGCGGCATGCGCTGGGTGAGG + Intronic
1089527631 11:119107621-119107643 GGGGCTGGGCGCGCGGGGTCGGG - Exonic
1090397928 11:126431595-126431617 GGGGCTGCCCCCGCAGGAACGGG - Intronic
1091134612 11:133177614-133177636 GGGGCAGTCCGGGCAGGGTCGGG - Intronic
1091367872 11:135037365-135037387 GGGGCAACCCCTGCAGGGTGGGG - Intergenic
1091748927 12:3010680-3010702 GAGGCCGCCAGCGCTGGGTGAGG + Intronic
1096216574 12:49801088-49801110 GGGGCTGCCTGCTCAGGGGCTGG + Intronic
1096466421 12:51849309-51849331 GGGGCGGCCCGCGGACGGGGCGG - Intergenic
1096673624 12:53214789-53214811 GGGGCTGCAGGCCCTGGGTGGGG - Intronic
1096996387 12:55840801-55840823 AGGGCTGCCCGGGCTGTGTGGGG + Exonic
1097187924 12:57205454-57205476 CGGGCTGGCCGGGCACGGTGTGG - Exonic
1097777879 12:63668858-63668880 GGAGCTGCGCGCTCGGGGTGGGG - Intronic
1099133362 12:78864005-78864027 GGGACTTCCCGCGAAGGGTGCGG - Intronic
1100581465 12:95943540-95943562 GTGGCCGGGCGCGCAGGGTGGGG + Intronic
1102245633 12:111353930-111353952 GGGGCTGCCTGCTCAGTGGGAGG - Intergenic
1103436818 12:120933116-120933138 GGGGTTGACCGGGCAGGGTCAGG + Intergenic
1103568021 12:121826827-121826849 GGGGGTGACAGCCCAGGGTGTGG + Intronic
1104305291 12:127604935-127604957 TGGGCAGCCCTCGCAGGATGTGG + Intergenic
1104675488 12:130709561-130709583 GGGGCTCCCCTCTCAGGGAGAGG + Intronic
1104874734 12:132026137-132026159 GTGGCCGCCCACGCAGGGTCTGG + Intronic
1109538158 13:63741716-63741738 GGGACCGCCATCGCAGGGTGGGG - Intergenic
1109538288 13:63742112-63742134 GGGACCGCCATCGCAGGGTGGGG - Intergenic
1109545550 13:63837660-63837682 GGGACCGCCATCGCAGGGTGGGG + Intergenic
1111951314 13:94711543-94711565 GGGGCTGCCCGCGGCGGCGGCGG + Exonic
1112305254 13:98267698-98267720 GCGGCTGCGCCTGCAGGGTGAGG - Intronic
1112331891 13:98483152-98483174 GGGGCAGCCTGGGCAGGGTCTGG + Intronic
1113464495 13:110504026-110504048 GGGGCTGCCCGGGCAAGGCCAGG + Intronic
1114031460 14:18584003-18584025 GGGGCTGCTGTCGCAGGCTGTGG - Intergenic
1114257827 14:21017812-21017834 GGGGCTGGCGACTCAGGGTGTGG + Intronic
1117912693 14:60649655-60649677 GGGGCTGCGCGGGTAGGGAGTGG + Intronic
1119303707 14:73590773-73590795 GGGGCTGCCCGCGGGGCTTGCGG - Intergenic
1119383094 14:74240834-74240856 GGGGCTGGCCGCGCAGGGCAGGG + Intronic
1119416631 14:74474738-74474760 GGAGCTGCCCACTCAGGATGAGG + Intergenic
1121104971 14:91273712-91273734 GGGGCGTCCCGCGCAGGAGGCGG - Intronic
1122463605 14:101916183-101916205 GGGGCTGTCGGGGTAGGGTGTGG + Intronic
1122773394 14:104106904-104106926 GGGGCTGGGCCCCCAGGGTGGGG - Intronic
1122790107 14:104180682-104180704 GGGGCACCCTGGGCAGGGTGGGG + Intronic
1122939770 14:104976083-104976105 GGGGCAGCAGGTGCAGGGTGGGG + Intronic
1124010838 15:25837476-25837498 GAGGCTCCCGGCGCAGGGAGTGG + Intronic
1124350835 15:28954531-28954553 GGGGGTGCCTGTGCATGGTGGGG - Intronic
1125536123 15:40441783-40441805 GGGATCGCCCGCTCAGGGTGGGG + Intronic
1129675861 15:77632268-77632290 GGGGCTGCCCGCTCGGGGCTCGG + Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130295726 15:82646440-82646462 GGGGCTGCAGGCGCGGGGCGGGG + Intronic
1131781912 15:95869062-95869084 GGGCCTGCCCTCTCCGGGTGTGG + Intergenic
1132225972 15:100141667-100141689 GGGGCTGCCGGGTGAGGGTGGGG + Intronic
1132578593 16:675099-675121 GGGGCCTCCAGCCCAGGGTGTGG + Intronic
1132663811 16:1072844-1072866 GGGGGTGCCCGCGCGGGAGGGGG - Intergenic
1132689531 16:1176382-1176404 AGGGCTGTCCCCGCAGAGTGGGG + Intronic
1132851367 16:2026475-2026497 AGGGCTTCCCGGGGAGGGTGGGG + Intronic
1133008001 16:2895278-2895300 GGCGCTGCCCTGGCTGGGTGGGG - Exonic
1133040578 16:3058257-3058279 GGGGCTGCCCGCCCAGGTGAGGG + Exonic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1136573357 16:31109428-31109450 GGGGCAGCCAGCCCAGGGTCCGG + Intronic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1138472061 16:57245507-57245529 GGGCCGGGCCGGGCAGGGTGGGG + Intronic
1139403137 16:66697294-66697316 GGGGCGGGCGGGGCAGGGTGAGG + Intergenic
1139597769 16:67968264-67968286 GTGTCTGCGCGCGCAGGGCGGGG + Intronic
1141640756 16:85339635-85339657 GAGGCGGCGGGCGCAGGGTGGGG + Intergenic
1142136320 16:88453481-88453503 GGGGCTGGGCGCGCGGGCTGGGG + Exonic
1142261393 16:89044107-89044129 GGGGCAGCCGGCAGAGGGTGAGG - Intergenic
1142299204 16:89247049-89247071 AGGGCGGCCCGCGCCGGTTGGGG - Intergenic
1142400583 16:89856224-89856246 TGGGCTGCCCGCGGTGAGTGAGG + Exonic
1203062310 16_KI270728v1_random:986858-986880 GGGGAGGCCGGCGCGGGGTGAGG + Intergenic
1142547557 17:715120-715142 TGCGCTGCCCGCGGAGGCTGTGG - Intronic
1143023720 17:3929333-3929355 GGGGCGGCACGAGCAGGATGAGG + Exonic
1143382789 17:6506995-6507017 GGCACTGCCAGCCCAGGGTGGGG + Intronic
1143917248 17:10302969-10302991 GGGGCTGGCCAAGTAGGGTGAGG + Intronic
1144021346 17:11241644-11241666 GGGGCAGCCCGCGGCGGCTGTGG + Exonic
1144501149 17:15787236-15787258 GGGGCTGGCCTCCCAGAGTGGGG + Intergenic
1144784511 17:17824221-17824243 GGGGCTGCCCTAGAAGGGGGAGG - Intronic
1144848278 17:18231269-18231291 GGGGCTGGCCTGGCAGGGGGAGG - Intronic
1145058180 17:19716621-19716643 CGGGCTGCCCAGGCAGGGGGTGG - Intronic
1145093903 17:20008824-20008846 GGGGCGGGCCCCGCAGGATGAGG + Intergenic
1146380545 17:32324017-32324039 GTGGCTGCCAGCCCAGGGGGTGG + Exonic
1149610829 17:57956570-57956592 GGGCCTCCCCGAGGAGGGTGTGG - Intergenic
1149637251 17:58180878-58180900 GGGGCTGCCTGGGAAGTGTGTGG - Intergenic
1150408029 17:64919324-64919346 GGGGCGGCCGGGGCCGGGTGGGG + Intronic
1151744713 17:76005698-76005720 GGGCCTGCCAGAGCTGGGTGTGG + Exonic
1152374870 17:79913809-79913831 GGGGCTGTCCAAGCAGGGGGAGG + Intergenic
1152378242 17:79929577-79929599 GGGGCTGGCGGCTGAGGGTGAGG + Intergenic
1152397786 17:80045173-80045195 GGGGCTGCCCGTGCAAACTGGGG + Intronic
1152624984 17:81384013-81384035 GGGGCAGCTCGCCCAGCGTGGGG - Intergenic
1152625210 17:81385009-81385031 GGGTCTTCCCGCGGAGGCTGGGG + Intergenic
1152858402 17:82679868-82679890 GCTGCTGCCCGAGCAGGCTGCGG + Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1156411128 18:36829023-36829045 GGGGCCGGCCGCGCAGGCGGGGG + Intronic
1156502137 18:37566768-37566790 GGGGCTGCTCTGGCAGGTTGGGG - Intergenic
1157384086 18:47247575-47247597 GGGGCAGCCCCCGCAGGTAGTGG - Intronic
1157610123 18:48950674-48950696 GGCGCGGGCCGCGCGGGGTGGGG - Exonic
1160248846 18:77183702-77183724 GGGCCTGTCCGGGGAGGGTGAGG - Intergenic
1160384299 18:78485655-78485677 GAGGCTGCAGGCGCAGAGTGTGG - Intergenic
1160384351 18:78485907-78485929 GAGGCTGCAGGCGCAGAGTGTGG - Intergenic
1160384413 18:78486202-78486224 GAGGCTGCAGGCGCAGAGTGTGG - Intergenic
1160453524 18:78980392-78980414 GGGGCTGCCCGTCCGGGCTGGGG + Intronic
1160662235 19:306468-306490 GGCGCTGACGGCGCTGGGTGGGG + Exonic
1160702977 19:517444-517466 GGGGCTGGCCAGGCTGGGTGGGG + Intronic
1160731456 19:643357-643379 TGGGCGGCGCGGGCAGGGTGGGG + Intronic
1160766878 19:812710-812732 GGGGCTGCCCCCGCTGGGCGCGG - Exonic
1161161103 19:2762272-2762294 AGGGCTGCCCGCGGAGGCTGAGG - Intronic
1161244299 19:3240777-3240799 CGGGCTGACCACACAGGGTGTGG + Intronic
1161714615 19:5868232-5868254 GGGGCTGACCAGGCAGGGAGTGG + Intronic
1162339855 19:10086014-10086036 GGGGGAGCGCGCGCTGGGTGGGG + Intergenic
1162576977 19:11505151-11505173 GGGGCTGCCCCCCCAGGGCCTGG + Intronic
1162798115 19:13096850-13096872 GGGGCTGCCCGGGCGGGCAGGGG + Intronic
1163783644 19:19263187-19263209 GGCGCTCCCTGTGCAGGGTGGGG + Intergenic
1163807141 19:19406082-19406104 GGCGCGGGCCGCGCAGGGTCGGG + Intronic
1165356900 19:35310061-35310083 GGGCCTGCCCCCGCAGCGTGAGG - Exonic
1165393806 19:35553081-35553103 GGGGCTGCGGGCGCAGTGGGAGG - Exonic
1165424981 19:35740601-35740623 GGCGTTGCCCGCGCAGGGGCGGG - Intronic
1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG + Intronic
1166354240 19:42217537-42217559 GGGGCCGCCCTTGCAGGGCGAGG - Intronic
1167293678 19:48637508-48637530 GGGGCTGGACGCGCCGGGCGGGG - Intergenic
1168577823 19:57527777-57527799 GGGGCTGCACGCGCAGAGCCTGG + Intronic
925153803 2:1635165-1635187 GGGGCTGCCCGCCCTCTGTGGGG + Intronic
925182670 2:1827169-1827191 GGGGCTGCCAGCCCAGAATGGGG + Intronic
925291673 2:2752179-2752201 GAGGCTGCCTGGACAGGGTGGGG - Intergenic
925911353 2:8575472-8575494 GGTGCTGTCAGCGCAGGCTGAGG - Intergenic
926141073 2:10368792-10368814 GGAGCTGCCGGAGCAGGCTGCGG - Exonic
927594854 2:24387365-24387387 GGGGATGCCATCACAGGGTGTGG + Intergenic
927698058 2:25251199-25251221 GGGGCAGCCGGAGCTGGGTGGGG + Intronic
928606176 2:32947043-32947065 GGAGCGGGCCGCGCAAGGTGAGG - Exonic
931217591 2:60261080-60261102 GGAGCTGCCCAGACAGGGTGTGG - Intergenic
933709575 2:85315560-85315582 GGGGCTGCACGTCCTGGGTGAGG + Intergenic
933709744 2:85316261-85316283 AGGGCTGCCTGGGCAGGCTGTGG + Intergenic
933713318 2:85343502-85343524 AGGGCTGCCTGGGCAGGCTGTGG - Intronic
933713490 2:85344214-85344236 GGGGCTGCACGTCCCGGGTGAGG - Intronic
934522107 2:95025999-95026021 GGGGCAGCAGGCGCAGGGCGGGG + Intronic
934523641 2:95035137-95035159 AAGGCTGCCCGCCCAGGGTCTGG - Intronic
934978719 2:98823210-98823232 GGGGCTCCACGCGGAGAGTGGGG + Exonic
936144122 2:109967790-109967812 GGGGCTGCACCAGCAGGCTGAGG - Intergenic
936180804 2:110265751-110265773 GGGGCTGCACCAGCAGGCTGAGG - Intergenic
936200565 2:110403679-110403701 GGGGCTGCACCAGCAGGCTGAGG + Intronic
938126115 2:128672464-128672486 GGGGCTGCCCGCGGCGCTTGCGG - Intergenic
938192855 2:129299480-129299502 GGAGCTGCTCCCCCAGGGTGGGG - Intergenic
939179602 2:138788739-138788761 GGGCCTGCCCGGGCTGGGAGTGG - Intergenic
945925074 2:215795024-215795046 GGGGCTGGAGGCACAGGGTGAGG + Intergenic
946763735 2:223020982-223021004 GGGGATGCCTAGGCAGGGTGAGG - Intergenic
948656797 2:239481282-239481304 GGGGCTGCCGGGGCAGGGGATGG - Intergenic
948809999 2:240469568-240469590 GGGGCTGCCTGCAGATGGTGTGG - Intergenic
1168808798 20:689253-689275 CGGGCTGCCTGGGCAGGGTTTGG - Intergenic
1171012445 20:21515830-21515852 CGGGTTGCCAGCGCTGGGTGAGG + Intergenic
1173646113 20:44634113-44634135 GGGGCTGGGAGCGCCGGGTGGGG - Intronic
1175873843 20:62220367-62220389 GGTGCTGCCGGCGCCGGGCGGGG - Intergenic
1176032158 20:63017826-63017848 GGGTCAGCCCGCAGAGGGTGAGG - Intergenic
1176171060 20:63696553-63696575 GGGGCTGCCTGGGGAGGGAGGGG + Intronic
1176178707 20:63739975-63739997 GTGGCTGCGCGCGGAGGGTCCGG + Exonic
1176380501 21:6110359-6110381 GGGGCTGCCCCCGCAGCATGTGG - Intergenic
1176658866 21:9614619-9614641 GGGGCAGCCCGCACATGCTGAGG - Intergenic
1178414426 21:32392738-32392760 GGGGCGGCAGGCGCAGGGTCGGG - Intronic
1179451810 21:41473294-41473316 GGGGCGGCGCGGGCCGGGTGGGG - Intronic
1179504330 21:41830915-41830937 GGGGCTGCTGCTGCAGGGTGAGG - Intronic
1179571494 21:42281268-42281290 AGGGCTGCCCTGGCAGGGTGGGG + Intronic
1179742971 21:43427881-43427903 GGGGCTGCCCCCGCAGCATGTGG + Intergenic
1179970822 21:44836096-44836118 GGGGCTGCACGGGTGGGGTGGGG - Intergenic
1179970854 21:44836167-44836189 GGGGCTGCAGGGGTAGGGTGGGG - Intergenic
1180173934 21:46078439-46078461 GGTGCTGCAGGTGCAGGGTGAGG - Intergenic
1180455573 22:15511060-15511082 GGGGCTGCTGTCGCAGGCTGTGG - Intergenic
1180741083 22:18053696-18053718 GGGGCTGCGCGCGCCGCTTGCGG - Intergenic
1182421207 22:30249346-30249368 GGGGCTGCCACTCCAGGGTGGGG - Intergenic
1183391381 22:37547181-37547203 CGGCCTGCCTGAGCAGGGTGAGG + Intergenic
1183492995 22:38126692-38126714 GGAGCTGGCTGGGCAGGGTGGGG - Intronic
1183548502 22:38468022-38468044 GCGGCCGCCGGCGCAGGGTGGGG - Intergenic
1184040321 22:41939266-41939288 GGGGCTGCCAGAGCAGGGCTGGG + Intronic
1184996256 22:48209657-48209679 GGGGACCCCCGCCCAGGGTGGGG + Intergenic
1185041101 22:48504838-48504860 GCAGCTGCCAGGGCAGGGTGGGG + Intronic
1185216366 22:49602048-49602070 GGGGCTTCCCAGGCAGGGAGGGG - Intronic
950105889 3:10388150-10388172 GTGGCTGTCAGCACAGGGTGCGG + Intronic
950545726 3:13636950-13636972 GGGGCTGCCTGTCCGGGGTGCGG + Intronic
951217744 3:20040546-20040568 GGCGCTGCCCCCGCAGCCTGCGG + Exonic
952744445 3:36764208-36764230 GGGGCTGGCCGGGCCGGGGGCGG + Intergenic
954664730 3:52245789-52245811 GGGGCTGCCCGCGGAGCGCGGGG - Intronic
955559005 3:60168543-60168565 GGCTCTGCCAGCACAGGGTGGGG + Intronic
958718958 3:97821965-97821987 GGGGCGGGCCGCGCCGGGCGAGG + Intergenic
959619677 3:108386467-108386489 GGGGCTGCCTGGGAAGTGTGTGG - Intronic
961545454 3:127629731-127629753 GGGGCCGCCTGCGGAGTGTGGGG + Intronic
961574460 3:127823236-127823258 GGGGCGGCCCGAGGTGGGTGGGG + Intronic
967776115 3:193387782-193387804 AGGGCTGCCTGGGCAGGGTGGGG - Intergenic
968114969 3:196082216-196082238 GGGGATGCGCGCGCAGCGGGCGG + Intergenic
968121243 3:196127681-196127703 GGGGCTGACCGTGCAGGGCAGGG + Intergenic
968511385 4:997373-997395 GGGGGAGACCGCGCGGGGTGGGG - Intronic
968621240 4:1604335-1604357 GTGGCTGCCTACGCAGGTTGGGG + Intergenic
968621375 4:1604831-1604853 GGGGGAGCCGCCGCAGGGTGGGG - Intergenic
968916228 4:3498109-3498131 CGGGCTGCCAGCCCAGGGCGGGG + Intronic
968958373 4:3730466-3730488 GGGGCTGGGGGCACAGGGTGGGG + Intergenic
969122064 4:4918166-4918188 GGGGCTGACAGCTCAGAGTGGGG - Intergenic
973081934 4:46003560-46003582 GGTGCGGCCCGTGGAGGGTGAGG - Intergenic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
975420495 4:74158287-74158309 AGGGCTGCGGGCGCCGGGTGCGG + Intronic
984853736 4:184175519-184175541 GGGGCTACCACCGCAGAGTGGGG + Intronic
985403906 4:189616984-189617006 GGGGCTGCCCGCGGCGCTTGCGG - Intergenic
985541586 5:489959-489981 GGGGCTGTCCGGGCAGTGTGGGG - Intronic
985841352 5:2308197-2308219 GGGACTGCCAGCTCGGGGTGGGG - Intergenic
986210627 5:5668001-5668023 GAGGCTGGCCGGGCAGGGAGAGG + Intergenic
986626131 5:9725330-9725352 GGGGCTGCGCGCGGAGCTTGTGG + Intergenic
989178726 5:38556243-38556265 GGGGCGGCCCGGGCGGGGTGGGG - Intronic
989368221 5:40679739-40679761 GGGGCTGGGCGCGCGGGGTGGGG - Exonic
990869954 5:60420722-60420744 GCGGGAGCCAGCGCAGGGTGGGG + Intronic
994507075 5:100656785-100656807 GGGGCTGCCCGCGGCGCTTGCGG + Intergenic
994710538 5:103259195-103259217 GGTGGGGCCCGCGCGGGGTGCGG + Intronic
1000512879 5:162205552-162205574 GTGGCTGCCAGGGTAGGGTGGGG + Intergenic
1001195813 5:169672770-169672792 GGGGGTGCCCAGGCAGGGAGGGG - Intronic
1001964294 5:175899730-175899752 GGGACTGCCGGCTCAGGCTGGGG + Intergenic
1001978573 5:176021408-176021430 AGGGCAGACCACGCAGGGTGAGG + Intronic
1002238844 5:177822354-177822376 AGGGCAGACCACGCAGGGTGAGG - Intergenic
1002309365 5:178305529-178305551 GGGGCTGCCCGTGCTGAGTGTGG + Intronic
1002714763 5:181220031-181220053 GAGGCGGCCGGCGCCGGGTGAGG - Intergenic
1003569955 6:7249145-7249167 GTGGCCTCCCGCGCAGGCTGCGG - Exonic
1005812386 6:29527673-29527695 TGGGCTGCCCACACAGGGTCTGG + Intergenic
1006224167 6:32522246-32522268 GGGGCTCCCTGGGCGGGGTGCGG + Intronic
1006230756 6:32584449-32584471 GGGGCTCCCTGAGCGGGGTGCGG + Intronic
1006448330 6:34092139-34092161 GGGGCTGGCTAGGCAGGGTGGGG - Intronic
1006563049 6:34930396-34930418 GGTGCTGCCAGCCCAGGCTGTGG + Intronic
1006642722 6:35497117-35497139 GGGGCGGGGCGCGCAGGGGGCGG + Intergenic
1006671392 6:35731816-35731838 GGGGCTGCCCGGGAAGGGGCGGG - Intergenic
1006725604 6:36197066-36197088 GGGGCTTTCCGAGCAGGGCGGGG + Intronic
1006837174 6:37005979-37006001 GGGGCTGCCCCTGCAGGAGGAGG - Intronic
1010244856 6:73653688-73653710 GGTCCCGCCGGCGCAGGGTGCGG + Intronic
1011492476 6:87906622-87906644 GGGGCTGCAGGCACAGGGAGAGG + Intergenic
1013011666 6:106126046-106126068 GGGGCTGCCAGCGCAGCCAGTGG - Intergenic
1013170593 6:107634239-107634261 GGGGGTTCCCGGGCATGGTGGGG - Exonic
1013220696 6:108074783-108074805 GGGGCGCCGCGCGCAGGGGGCGG - Intronic
1013272509 6:108557900-108557922 GGGGCCGCCCGCGCTGGCGGAGG - Intergenic
1014569955 6:122996543-122996565 CGGGCTGCCCGCGGACGATGTGG + Exonic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1017324706 6:153131426-153131448 GGGGCCGCCCGGGGAGGGGGCGG - Intergenic
1017899033 6:158704637-158704659 AGGGGTGACCCCGCAGGGTGGGG + Intronic
1017906434 6:158760159-158760181 GGGGGTGGCCCCTCAGGGTGTGG - Intronic
1018707139 6:166471186-166471208 GGGGCTGCCCGGGGATGCTGTGG + Intronic
1018740209 6:166722656-166722678 GGGGCTGCCCGAGCTTGTTGTGG + Intronic
1019026085 6:168964161-168964183 AGGGCTGCCCGCAGAGGCTGAGG - Intergenic
1019338637 7:496912-496934 GGGCCAGCCCGGGCAGGGTATGG + Intergenic
1019562549 7:1665832-1665854 GGGGCTGGCCGGGCAGGCGGGGG - Intergenic
1020084459 7:5303042-5303064 GGGGCTGCTGGCACAGGGGGAGG - Exonic
1021095320 7:16528601-16528623 GAGCCTGCCCCCTCAGGGTGGGG - Intronic
1022701247 7:32762242-32762264 GGAGCTGCGCGCTCGGGGTGGGG - Intergenic
1022745433 7:33166867-33166889 GGTGCAGCCCACGGAGGGTGAGG - Intronic
1023570390 7:41565640-41565662 GGGGCTGCCCCTGGAGGGAGTGG + Intergenic
1024094019 7:45970131-45970153 GTGGCTGCCCAGGCAGGGGGTGG + Intergenic
1026360545 7:69598409-69598431 TGGGCTGGCCGCGGAGGGGGAGG + Intergenic
1026850398 7:73719794-73719816 GGGGCTGCTCGTGCGGGGTGGGG - Intergenic
1026929475 7:74215866-74215888 GGGGCTGTCCGAGCACAGTGGGG + Intronic
1027051117 7:75021762-75021784 GGGGCTGGCCAGGCAGGGTTGGG - Intronic
1027188259 7:75984293-75984315 GGGGCTGCCTGGGCCTGGTGGGG + Intronic
1027263935 7:76483573-76483595 GGGGCTGTCAGCGCGGTGTGAGG + Intronic
1027315305 7:76981684-76981706 GGGGCTGTCAGCGCGGTGTGAGG + Intergenic
1028373305 7:90119060-90119082 GGAGCTGCGCGCTCGGGGTGGGG + Intergenic
1028856832 7:95602628-95602650 GGGGCTGCCTGAGAAGGGCGTGG - Intergenic
1029698299 7:102229117-102229139 GGGGCTGCCCGCCCCAGCTGTGG - Intronic
1032468589 7:132162197-132162219 GGAGCAGCCCCCTCAGGGTGTGG - Intronic
1033053125 7:138024875-138024897 GGGGCTGCCCAGGCCGAGTGAGG - Intronic
1034275890 7:149823723-149823745 GGGGCTGCTGGAGCAGGCTGGGG + Intergenic
1034343499 7:150372209-150372231 GGGGCTCCCCGGGCCGGGGGCGG - Exonic
1035023057 7:155809954-155809976 GGGGGCGCCCGCGCAGGGGCCGG - Intronic
1035600569 8:894722-894744 GTGGCTGGCAGGGCAGGGTGGGG + Intergenic
1035600665 8:894998-895020 GTGGCTGGCAGGGCAGGGTGGGG + Intergenic
1038563669 8:28601657-28601679 GAGGCTGCCAGGGCAGGGAGAGG - Intronic
1038789732 8:30657947-30657969 GGGGCTGCGGCCGCCGGGTGTGG - Intronic
1042246343 8:66712607-66712629 GGGGCAGCCCGTGCGGGGAGGGG - Intronic
1042695131 8:71547539-71547561 GAGGCTGCCCGGGCGGGCTGGGG + Exonic
1043844955 8:85152930-85152952 GGGGCTGCCGGCGCCTGTTGGGG - Intergenic
1044591622 8:93917859-93917881 GCTGCTGCCCGCGCGGGTTGTGG + Intronic
1048070700 8:131017612-131017634 GTGGCTGCCCATGCAGAGTGTGG - Intronic
1049000249 8:139821349-139821371 GGGGCTGCTCTCCCAGGCTGGGG + Intronic
1049418265 8:142505381-142505403 GGGGCTGCCCGAGCAGGGCTGGG + Intronic
1049470799 8:142774253-142774275 GGGGATGCGCGCACAGGCTGGGG - Intronic
1049686018 8:143939658-143939680 GCGGCGGCCTGGGCAGGGTGGGG - Intronic
1049695725 8:143983515-143983537 GGGGCTGCTCCAGCAGGGAGAGG + Exonic
1049725511 8:144143856-144143878 GGGGCTGCAAGCTCAGGGCGGGG + Intergenic
1053139861 9:35675785-35675807 GAAGCGGCCCGCGCAGGCTGGGG - Exonic
1054722410 9:68617045-68617067 GGGGCTGCCCGCGGCGCTTGCGG + Intergenic
1054762336 9:69014168-69014190 GGGGCTGGCTGCGCTGGCTGCGG + Intergenic
1055140780 9:72874778-72874800 GGGGCTGCCTGTGCATTGTGGGG - Intergenic
1056960487 9:91118159-91118181 AGGGCTGCCCGCTCTGGCTGGGG - Intergenic
1057184999 9:93052584-93052606 GGAGCTGCCAGCGCAGGCAGAGG + Intergenic
1057802620 9:98199330-98199352 GGGTCTGCCAGCCAAGGGTGAGG + Exonic
1057883056 9:98807803-98807825 GGTGCTGCGGGCGCAGCGTGGGG + Exonic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1058866617 9:109167049-109167071 GGGGCTGGCTGCGCAGGCGGCGG + Exonic
1061084838 9:128392861-128392883 GGGGATCCCCGCACAGGGTCAGG - Intergenic
1061237844 9:129352495-129352517 GGGGTTGAGCGCTCAGGGTGTGG + Intergenic
1061842885 9:133369921-133369943 GGGACTCCCAGGGCAGGGTGTGG + Intronic
1061958332 9:133975191-133975213 GGGGGTGCCGGGGCAGGCTGGGG - Intronic
1062034411 9:134376495-134376517 AGGGCTGCCTGAGCAGAGTGTGG - Intronic
1062200608 9:135300796-135300818 GGGGCTGGGCGCCCTGGGTGAGG + Intergenic
1062311891 9:135942774-135942796 GGGGCTGCCCTGGGAGGGCGGGG + Intronic
1062359254 9:136179810-136179832 GGGGCTGCCCACCCAGTGTGGGG - Intergenic
1062381607 9:136289606-136289628 GGGGCTGCCTCCTGAGGGTGGGG + Intronic
1062440503 9:136567371-136567393 GGGTCTGCCCGGGCTGGGTGGGG + Intergenic
1062452364 9:136621010-136621032 GGGGCCCCCCGGGCAGAGTGCGG + Intergenic
1062582992 9:137236581-137236603 GGGGCCGCCTGCGCAGGTGGGGG + Intergenic
1062651819 9:137581682-137581704 GGGGCTGGCCAGCCAGGGTGAGG - Intergenic
1203636612 Un_KI270750v1:118226-118248 GGGGCAGCCCGCACATGCTGAGG - Intergenic
1186244907 X:7608914-7608936 GCGGCTGGCCGGGCAGGGGGCGG + Intergenic
1186449373 X:9659277-9659299 GTGGTTGCCGGGGCAGGGTGGGG - Intronic
1189348490 X:40260186-40260208 GGGGATGACTGCGCAGGGCGAGG - Intergenic
1190929430 X:54935145-54935167 AGTGCTGCCCCTGCAGGGTGTGG - Intronic
1198110215 X:133496359-133496381 GCGTCTGCCCACGCAGAGTGAGG + Intergenic
1198687587 X:139244002-139244024 GGGGCTGCCAGGGCAGGTGGTGG + Intergenic
1200175121 X:154108774-154108796 GGACCTGCCCCTGCAGGGTGAGG + Intergenic