ID: 1165851452

View in Genome Browser
Species Human (GRCh38)
Location 19:38852218-38852240
Sequence CCGCGCGCGGCCGGGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165851452_1165851460 -2 Left 1165851452 19:38852218-38852240 CCCTGGCCCCCGGCCGCGCGCGG 0: 1
1: 0
2: 1
3: 31
4: 312
Right 1165851460 19:38852239-38852261 GGCGCCGCCCGCCAGTGCCCCGG 0: 1
1: 0
2: 2
3: 33
4: 1801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165851452 Original CRISPR CCGCGCGCGGCCGGGGGCCA GGG (reversed) Intronic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900166678 1:1246770-1246792 CCGCGCGGGGGCGAGGCCCAGGG + Intergenic
900227570 1:1540239-1540261 GCGCGCGCGGGCGGGGAGCAGGG + Intronic
900245506 1:1634367-1634389 CCGCGGGCGGCCTTGGGGCAGGG + Intronic
900256737 1:1701526-1701548 CCGCGGGCGGCCTTGGGGCAGGG + Intronic
900523086 1:3115612-3115634 CCGAGAGGGGGCGGGGGCCACGG + Intronic
901050580 1:6424158-6424180 CTGCGGGCGGCCTGAGGCCATGG + Intronic
901075789 1:6554128-6554150 CAACGCGCGGCCGGGGCCCACGG + Exonic
901083655 1:6597696-6597718 CAGTGCGAGGCAGGGGGCCAAGG + Intronic
901851703 1:12019953-12019975 CCCCGCAGGGCCGGGGGGCACGG - Intronic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
903349741 1:22710688-22710710 CCGCGCGCCGCCGCGAGCCCGGG - Intergenic
903795116 1:25922915-25922937 CCGCGTGCGCCCGGGGGTCTGGG - Intergenic
903813053 1:26045619-26045641 CCGCGGGGGGCCTGGGGCCGGGG - Intronic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
904600720 1:31671296-31671318 CCGCCCTCGGCAGGGGGCCTAGG - Intronic
905137089 1:35808242-35808264 CGGCGCCCGGCCCGGGGACAGGG - Exonic
905449588 1:38047682-38047704 CGGAGCGCGGCCGGGTACCAGGG - Intergenic
906116088 1:43358468-43358490 CCGCGGGCGGCAGCGGGGCAGGG - Intergenic
906263165 1:44407926-44407948 CCCCGCGCGGCTGCGGACCAGGG + Intronic
906377036 1:45304102-45304124 GCGCGCGGGGCCGCGGGGCAGGG - Intronic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
906637008 1:47416479-47416501 CCGCGCCCGGCCCGGGGCGGCGG + Exonic
906805549 1:48776532-48776554 CCGGGAGGGGCCGGGGGCCCGGG - Intronic
907189071 1:52633553-52633575 CTGCCCGCGGCCGGGGGGCGAGG + Exonic
910606593 1:89092075-89092097 CCGCACCCGGCCTGGGTCCATGG + Intergenic
912712655 1:111960864-111960886 CCGAGGGAGGCCTGGGGCCATGG + Intronic
914489988 1:148146098-148146120 GGGCGGGCGGCCGGGAGCCATGG + Intronic
914813691 1:151047899-151047921 CCCCGGGCGGCGGGGGCCCAAGG + Exonic
915224962 1:154405438-154405460 CCGAGCGCGGCGCGGGGCCGAGG + Exonic
915937825 1:160099087-160099109 CGGGGCGAGGCCGGGGTCCAGGG - Intergenic
916179146 1:162069541-162069563 CGTCGCGCGGCCGGGGGCGCGGG + Intergenic
920655121 1:207868903-207868925 CGGAGCGCGGCCGGGGCCCTGGG + Intergenic
922841623 1:228647368-228647390 CCGGGCGCGTCCGGAGGCCTGGG + Intergenic
922958538 1:229625761-229625783 CCGCCCGCCGGCGGGAGCCAAGG + Intronic
922958553 1:229625807-229625829 GCGCGGGCGGGCGGGGGCCGGGG - Intronic
1067467727 10:46513496-46513518 CAGCGTGCGGCCAGGGGGCAGGG - Intergenic
1067619459 10:47871109-47871131 CAGCGTGCGGCCAGGGGGCAGGG + Intergenic
1074137949 10:110644233-110644255 CCACGCGGGGGCGGGGGCCAGGG - Intergenic
1077008404 11:369609-369631 CCGCCCTCGGCCGCGGGCCCGGG - Intergenic
1077105951 11:842724-842746 CCGCGCGGGCCCGGGAGCCCCGG - Intergenic
1077919046 11:6629816-6629838 CCGAGCGCGGCGGGGAGCCGTGG + Exonic
1080540353 11:33258176-33258198 CCGCGCCTGGCCGGGGCCCGGGG + Intronic
1083610110 11:64000464-64000486 GCGGCCGCGGCCGGAGGCCACGG - Intronic
1084171170 11:67401670-67401692 CCGGGCCGGGCAGGGGGCCAGGG + Intronic
1084412600 11:69013181-69013203 CCGAGCGCGGCCCGGAGCCTTGG + Exonic
1084524231 11:69685991-69686013 CCGCGCAAGGCCGAGGGTCAGGG - Intergenic
1085332723 11:75667393-75667415 CCGCGGGCTGCCCGGGGCCCAGG - Intronic
1088481098 11:110296776-110296798 CCGGGCGTGGCCGGGGGTCGCGG + Intergenic
1090653143 11:128824288-128824310 ACGCGCGCGGGCGGGGAGCAGGG + Intergenic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1096459384 12:51814041-51814063 GCGCGCGCCCCCGGGGGCCTGGG - Intergenic
1096503615 12:52080057-52080079 CCGAGCGCAGCCGGGCGCCTAGG - Intergenic
1097218238 12:57430756-57430778 CCGCCCGCCGCCCGGGCCCACGG + Exonic
1097267838 12:57755892-57755914 CCGCGCCCGGCCAGGTGCCCAGG - Intronic
1099989554 12:89708555-89708577 CCGCCCGCGGCCGGGGGCGGCGG - Intronic
1101640114 12:106581568-106581590 CCGCGCGCTGCCAGGGGCCCGGG + Intronic
1102025842 12:109714016-109714038 CCGCGCGCCGCCCGGGGCCATGG + Intergenic
1102578399 12:113871864-113871886 CCCCGCGGGGCCGGAGGGCAAGG + Intronic
1102853941 12:116277460-116277482 TCGCGCGCCGGCGGGGGCCGAGG - Intergenic
1103562688 12:121800531-121800553 GCGCCCGCAGCCGAGGGCCACGG - Intronic
1103691080 12:122774720-122774742 CCGGGCGCGGCGGGGCGCCGCGG + Intronic
1104030862 12:125065255-125065277 GCGCCCGCGGCCGGGGGGCGTGG - Intergenic
1109284876 13:60397638-60397660 CCGCCCGCCGCCCGGGGCCCAGG - Intronic
1112278758 13:98044601-98044623 CCGCCCGCTCCCTGGGGCCAAGG + Intergenic
1112506334 13:99978553-99978575 CCGCGCGCGGCCGGGCGGTGGGG - Intergenic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1113437840 13:110307198-110307220 CCGCGCACCGCCGGGGGGGAGGG - Intronic
1113513376 13:110872919-110872941 CCAGGCGGGGCGGGGGGCCATGG - Intergenic
1114600994 14:23955191-23955213 CCGGGAGCGGCTGGTGGCCACGG + Exonic
1114605205 14:23990338-23990360 CCGGGAGCGGCTGGTGGCCATGG + Exonic
1117176763 14:53153337-53153359 GCGCACGCGGCCGGGGGGCGGGG - Intergenic
1121074928 14:91060244-91060266 CCGCGCGGGGCTGGGGGCGCGGG - Intronic
1121546964 14:94769812-94769834 GCCCGCGCCGCCGGGGGCCACGG + Exonic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1122344117 14:101047563-101047585 CCACGCTTGGCAGGGGGCCACGG + Intergenic
1122904583 14:104795833-104795855 CACCGCGCGGCCGGCGGCGAGGG + Intergenic
1122975105 14:105167813-105167835 CCGAGCGCGGGCGCGGGCCCGGG - Exonic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1125508740 15:40281898-40281920 GCGCGAGCGGCGGGCGGCCACGG - Exonic
1125603635 15:40928393-40928415 CAGGGCGCGGCCGGGGGCTTGGG + Intergenic
1125834443 15:42737139-42737161 CGGCGCGCCGCGGGCGGCCAGGG + Intergenic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129162110 15:73752841-73752863 GCGCGCGAAGCCGGGGGCCCCGG + Intergenic
1130276171 15:82477405-82477427 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130468530 15:84204798-84204820 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1130495734 15:84468744-84468766 CCGGGCCCTGCAGGGGGCCATGG + Intergenic
1130590823 15:85209397-85209419 CCGGGCCCTGCAGGGGGCCATGG - Intergenic
1131188541 15:90294816-90294838 CCGGGCCCTGCAGGGGGCCAAGG + Intronic
1131513997 15:93065643-93065665 CTGCGGGCTGCCGGGGGCCGGGG + Intronic
1132365081 15:101251430-101251452 CCGCGCGCGGCCGGCGCGCCTGG - Exonic
1132498843 16:275891-275913 CGGCGCGGGGCCGGCGGCCATGG + Exonic
1132572292 16:649415-649437 CCGCGCGCTACCTCGGGCCATGG - Exonic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1132903220 16:2269425-2269447 CCGCCCTCGGCCGGGGGCGGTGG - Intergenic
1132934530 16:2473975-2473997 GCGCGGGGGGCCGGGGGCCCGGG + Exonic
1132991754 16:2799010-2799032 CCGCGCGCGGGCGCTGGCCATGG + Intergenic
1133271956 16:4614639-4614661 CCGGGCGAGGGCCGGGGCCACGG - Intronic
1133784331 16:8963305-8963327 TCGCCTGCGGCCGGGGGCCGGGG + Exonic
1134070054 16:11255359-11255381 CCGCGGGCGCGCGGGGGCCGCGG + Exonic
1134070213 16:11255925-11255947 CCGCGCGCGGGGGGCGGCCTGGG + Intronic
1134143544 16:11742503-11742525 CAGCGCGCAGCCGAGCGCCACGG + Exonic
1135419683 16:22297502-22297524 CCGAGCGCGGACGGCGGCAACGG - Exonic
1136111082 16:28063823-28063845 CCGGGCGCGGGCGGGGGCCTGGG + Intergenic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136592222 16:31224412-31224434 GCGCCCGCGGCGGGGGGCCTCGG - Exonic
1140462166 16:75148667-75148689 CTCCGCGCGGCCTGGGGCCGAGG + Intronic
1141700007 16:85638046-85638068 CCGCAGGCGGCTGGGGCCCAGGG - Intronic
1141989523 16:87602345-87602367 CGGCGCGCGGGCGGGGACCCCGG - Intronic
1142518017 17:445901-445923 CAGCGCACAGCCGGGAGCCAGGG + Exonic
1143112192 17:4558960-4558982 CAGCCCCAGGCCGGGGGCCAGGG + Exonic
1143116602 17:4584903-4584925 CCGGGCGCGGGCGGGGGGCTGGG - Exonic
1143491834 17:7289538-7289560 CTGCGGGCTGCCGGGGGCCAGGG + Exonic
1144764233 17:17724224-17724246 CTGCGCGCGGCGGCGGGCCGGGG - Intronic
1144775304 17:17782154-17782176 CCGCGCAGGGGCGGGGGCCGCGG + Intronic
1145049509 17:19648584-19648606 CCGAGCGCGGCCACGGGCCAGGG - Intronic
1145190594 17:20840749-20840771 GGGCGGGCGGCCGGGAGCCATGG + Intronic
1145269285 17:21396092-21396114 CCGGGCGCAGGCAGGGGCCAGGG + Intronic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1146371098 17:32266021-32266043 CGGCGCGGGGACCGGGGCCATGG + Intergenic
1148271726 17:46266917-46266939 GCGCGCGCGGCCGGGCGGCGGGG - Intergenic
1148323618 17:46771452-46771474 CCCAGCGCGGCCCGGGGCCCGGG - Intronic
1148356494 17:46979010-46979032 CCGCGCGGCGCCGGGGGTCTCGG + Exonic
1148603076 17:48908657-48908679 GCGGGCGGGGCCGGGGGCCCGGG + Exonic
1148680449 17:49470518-49470540 CCGCGGGCAGCCTGGGGCCTGGG + Intronic
1149595332 17:57861819-57861841 CCGCGCCAGGCCTGGGGCCCTGG - Exonic
1149626357 17:58083354-58083376 GCGCGCGCGGCGGGGGGGCGGGG + Intergenic
1150217151 17:63477105-63477127 CCTCGGGCCGCCGGGGGCCGGGG + Intergenic
1150239823 17:63622571-63622593 CCGCCCGCGGCCGGGCGCTGTGG - Exonic
1152108070 17:78342202-78342224 CCACGCCCGGCCCGTGGCCATGG - Intergenic
1152468431 17:80477941-80477963 CTGCGCGCAGCCGGGGGCTGGGG + Intergenic
1152586704 17:81192583-81192605 CCGCCCGCTGCCTGCGGCCAGGG + Exonic
1152781506 17:82229126-82229148 TCGCGCGCGGGCCGGGGCCCAGG + Intronic
1153457230 18:5295275-5295297 CCTCCCGCGGCCGGGGGCGGGGG + Intronic
1153514306 18:5890700-5890722 GCGCGCGCCGCCAGGGGGCAGGG - Exonic
1153794448 18:8609629-8609651 CCGCGCGCGGCGGAGGCCGAGGG + Exonic
1153805487 18:8705922-8705944 CCGGGCGCGGCCAGGGACCCCGG - Intronic
1153900676 18:9614670-9614692 CGGGGCGCGGCCGGGGGCCCGGG - Intronic
1154169208 18:12038631-12038653 CCGGGGGCGGCCTGGGGCCTTGG - Intergenic
1154210703 18:12376861-12376883 CCGCGTGCGGCCGGAGGGCGGGG + Intronic
1154360310 18:13655307-13655329 CCACGCGGGCCCGGGGGCCAGGG + Intergenic
1155054540 18:22171953-22171975 CCGCGCGGCGCCGTTGGCCATGG - Exonic
1157095106 18:44680213-44680235 CTCCGCGCGCCCGGGGGCCCCGG + Intronic
1157279162 18:46334406-46334428 CCGCGGGCGGCCGGGGGCTCAGG + Intronic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157464203 18:47930530-47930552 CCGGGCCCGGCCGGCGGCCCGGG + Exonic
1158137562 18:54224142-54224164 GAGCGCGGGGCCGGGGCCCAGGG - Exonic
1158954273 18:62524037-62524059 CTGCGCGCGGCCCGGGGCGAGGG + Exonic
1159586751 18:70289291-70289313 GGGTGCGCGGGCGGGGGCCAGGG + Intronic
1159798223 18:72868195-72868217 CTGCGCGCGGCCGGCGCCCCGGG + Intergenic
1160025550 18:75212165-75212187 CCGGGGGAGGCCGGGGGCCGCGG + Intronic
1160163402 18:76491743-76491765 GCACGCGCGGCCAGGGGCCGGGG - Intronic
1160698072 19:494231-494253 CAGCGGGCGGGCGGGGGACAGGG + Intronic
1160729258 19:633350-633372 CCCCGCGCGGCCGGGGCCTTTGG - Intronic
1160921234 19:1521736-1521758 CCGCGGGCGGCCAGGGGAGAGGG + Intergenic
1160930320 19:1567159-1567181 CTGCGGGCGGCCGAGGGCCTGGG + Intronic
1160996721 19:1885389-1885411 GGGCGGGCGGCCGGGAGCCATGG - Exonic
1161293074 19:3506225-3506247 CCGCGCGCGGCGTGGGGGCGTGG + Intergenic
1161333817 19:3700393-3700415 CCGCGCGCGGACGGCGGCGGGGG + Exonic
1161702360 19:5802507-5802529 CCCGCCGCGGCTGGGGGCCATGG - Intergenic
1161943869 19:7422350-7422372 CTGCGCGGGGCGGGGGGGCATGG - Intronic
1162727066 19:12696150-12696172 GTGCGCGGGGCCGGGGGCCGGGG - Intronic
1162985339 19:14265898-14265920 CCGAGCCAGGCCGGGGGCCAGGG - Intergenic
1163277482 19:16294452-16294474 CTGCGCCCGGCCGAGGGACAGGG - Intergenic
1163532698 19:17859985-17860007 CGCGGCGCGGCAGGGGGCCAAGG + Intronic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165165260 19:33849505-33849527 CTGAGGGCTGCCGGGGGCCAAGG + Intergenic
1165349359 19:35267990-35268012 CCGCGCGGGGCGGGGGACCGGGG + Intergenic
1165375330 19:35437730-35437752 CCGCGCCCGGCTGGAGTCCATGG - Intergenic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166042959 19:40214194-40214216 CCGCCCGAGCCCGCGGGCCATGG + Exonic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1166363698 19:42268179-42268201 ACGCGCGCGGCCTGGGGCCCGGG - Intergenic
1166873858 19:45885771-45885793 CGGCGCGCGGACTGGGGCCATGG - Exonic
1167001131 19:46746301-46746323 CCGGGCCCGGCCCGGGGGCAGGG + Exonic
1167528549 19:50000680-50000702 GAGAGCTCGGCCGGGGGCCAGGG - Intronic
1168400599 19:56084199-56084221 CCGGGTGGGGCTGGGGGCCAGGG - Intergenic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
929604754 2:43226809-43226831 CCGGGCGGGGCCGGCGGCCCGGG + Intergenic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
933847459 2:86337410-86337432 GCGCGCGCAGCCCGGGGCCGGGG + Intronic
933847571 2:86337786-86337808 CCGCCTTCAGCCGGGGGCCAGGG - Intronic
934655642 2:96115669-96115691 GCCCGCGCGGCTGGGGGCCCTGG + Exonic
934670326 2:96208455-96208477 CCGCGAGCTTCCGGGGCCCAAGG + Exonic
935899873 2:107780002-107780024 CCGCTGGGGGCAGGGGGCCAGGG + Intergenic
938277119 2:130037041-130037063 CCGCGCCCAGCCCGAGGCCAGGG + Intergenic
938438264 2:131300348-131300370 CCGCGCCCAGCCCGAGGCCAGGG - Intronic
940640753 2:156342371-156342393 CCGCCGGGGGCCGGGGGCCGGGG - Intergenic
941111607 2:161423517-161423539 CCGGGCGCGGGCGCGGGCCCCGG + Exonic
942463962 2:176188988-176189010 GCGGGGGCGGCCGGGGGCGAAGG - Exonic
943658675 2:190534832-190534854 CCGCCCGCGGCCTCGGGGCACGG + Intergenic
944154139 2:196593255-196593277 CCGAGCGCGGGCGGGAGCCATGG - Intronic
946351871 2:219160596-219160618 GCGCGCGCTGCCGGGGTCCAGGG - Intronic
946391375 2:219418640-219418662 TCGGGCGGGGCCGGGGGCCTGGG + Exonic
948046713 2:234951559-234951581 CCGCGAGCGGGCGTGGGCGAGGG - Intergenic
948140865 2:235670843-235670865 GCGCGCGCGGGCGGCGGCCGGGG + Intronic
948421763 2:237864352-237864374 CCCCTCCCGGCCTGGGGCCAGGG - Intronic
948645269 2:239400552-239400574 CCGCGCGCGGCCGTGGGAGGCGG - Exonic
948824693 2:240568529-240568551 CCGCGCCGGGCCGCGGGCGAGGG - Intronic
949014588 2:241702211-241702233 GCGGGCGCGGCCGGGCGCGACGG + Intronic
1168753096 20:297646-297668 CCCCGCGCGGCCCGCGGCCCGGG + Exonic
1170756814 20:19212505-19212527 CCGCGCTCGGCCTGGGGCGGCGG - Intergenic
1172118636 20:32585217-32585239 CCGCGGGCGGCCGGGGGAGGCGG + Intronic
1175215910 20:57391624-57391646 CCGGGGGCGGCCAGGGGCCGCGG - Exonic
1175847420 20:62065932-62065954 GGGCGCGCGGCCGGGGGGCGGGG + Intergenic
1175921237 20:62451444-62451466 CCGGGCGCGGTGGGGGGCCTAGG - Intergenic
1176131732 20:63499209-63499231 ACGCGCGCGGGCGGGCGCCACGG + Exonic
1176555783 21:8253474-8253496 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176574720 21:8436508-8436530 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176611334 21:8987801-8987823 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1178493762 21:33070522-33070544 CAGCGCCCGGCCGGACGCCAAGG + Exonic
1178513903 21:33230155-33230177 CCGGGCGCGGCTGGGGCCCGAGG + Exonic
1178534891 21:33403322-33403344 CCGCGCGGGGGCGGTGGCCTCGG + Exonic
1178555648 21:33588326-33588348 CCGCGAGCAGCCGGAGGCCCCGG - Exonic
1178707679 21:34888946-34888968 CCGCACGCGGGCGGGGCCCCGGG - Intronic
1179976861 21:44873382-44873404 CGGCGGGCGGCCTGGGCCCACGG - Intronic
1180014726 21:45074651-45074673 CCTCGCGCGGCCCGGAGCCCCGG - Intronic
1181094315 22:20495507-20495529 TGGCGCTCGGCCAGGGGCCAGGG - Intronic
1181299079 22:21867038-21867060 CCGCGCTGCGCCCGGGGCCAAGG + Intronic
1181334657 22:22118281-22118303 GGGCGGGCGGCCGGGAGCCATGG - Intergenic
1181943815 22:26499482-26499504 CAGCGCGAAGCCGGGGGCCTTGG + Exonic
1181965969 22:26657138-26657160 CTGCGCGCGACCGCGGACCAGGG - Intergenic
1182236992 22:28883773-28883795 CCGCGCTCGGGCGGGCGCCCAGG + Exonic
1182440711 22:30362366-30362388 CCTCGCCCGGCCTGGGGCCCTGG + Intronic
1182697184 22:32205498-32205520 CTGCCCGCGGCCGGGGGGCGGGG + Intergenic
1183683672 22:39349906-39349928 GCGCGCGCGGCCGGCGGCCCAGG - Intronic
1183744828 22:39686239-39686261 CCGGGCCAGGCCGTGGGCCAGGG - Exonic
1183958331 22:41395962-41395984 CCCCGCCCGGGCGGGGGGCACGG - Exonic
1183961319 22:41413542-41413564 GAGCGCGCGGCCGGGCCCCAGGG + Intergenic
1184035043 22:41914257-41914279 GCGCTCGCGGCCGGGGTCCCGGG + Exonic
1184106301 22:42369221-42369243 CCGCGGCCGGCCGCTGGCCACGG + Intergenic
1184276399 22:43411753-43411775 CCGAGCCCGGGCGGGGGCCGAGG + Intronic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184640204 22:45866587-45866609 CCGCGCGGGGCCGAGCTCCACGG + Intergenic
1185341615 22:50293631-50293653 CAGCGCGGGGGCGGGGCCCACGG + Intronic
1185397481 22:50600471-50600493 CCGCGCGGGGCGGGAGGCCGAGG - Intronic
1203252768 22_KI270733v1_random:125559-125581 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203260824 22_KI270733v1_random:170645-170667 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
949896005 3:8768115-8768137 CGCCGCGCCGCCGGGGGCCGAGG - Exonic
951544436 3:23810664-23810686 TCGCGCGCGGTCTCGGGCCAAGG + Intronic
953657078 3:44862267-44862289 CCGCCCGCGGCCCGGGGCCCCGG - Intronic
953748699 3:45594042-45594064 CGGCGCGCGGGCGGGCGCCCAGG - Intronic
954632826 3:52056372-52056394 GCGCGGGCGGCCCGGGGCCGGGG + Exonic
954912583 3:54122067-54122089 CCGGGCGGGGTCGGGGGCCGCGG - Intergenic
955161486 3:56468472-56468494 CCGGGCGGGGCCGGCGGCCGAGG + Intergenic
958779318 3:98522654-98522676 CCGTGCTCGGCCCCGGGCCAGGG + Intronic
960047541 3:113212167-113212189 CAGCGCTCGGCCGGGCGCCCGGG + Intronic
964720391 3:159763914-159763936 CCGCCCGCGGCTGGGAGCCCGGG - Intronic
965763854 3:172109453-172109475 CCGCGCCCGGCCGAAGGCCTTGG + Intronic
966594205 3:181711785-181711807 CCCCGCGCGGCCGGCGGCGCGGG + Intergenic
967924142 3:194633232-194633254 CGGCGCGGGGCCGGGGACCTGGG + Exonic
968046786 3:195628589-195628611 CCGGGCACTGCCAGGGGCCACGG + Intergenic
968150000 3:196330120-196330142 CCGCGCGCGGTGGGAGGCCGAGG - Intronic
968307868 3:197661455-197661477 CCGGGCACTGCCAGGGGCCACGG - Intergenic
968506623 4:973918-973940 TCCTGCGCGGCCGGGGGCCTCGG - Intronic
968616317 4:1579248-1579270 GCGGGCGGGGCCGGGGGCCGGGG - Intergenic
969714278 4:8860949-8860971 CCGGGCGGGGGCGGGGGCGAGGG + Intronic
970637081 4:18021559-18021581 CCGCGCGGAGCCCGGGGCCCCGG + Intronic
971196079 4:24472318-24472340 GAGCGCGCGGCAGGGGGCAAGGG + Intergenic
976765503 4:88593215-88593237 CTGGGCGGGGCCGGGGGCGAGGG + Intronic
982712255 4:158769142-158769164 CAGCGCGCAGCCGGGGGCGGCGG - Exonic
983656497 4:170090024-170090046 CCGCGGGCGGCCATAGGCCACGG - Intronic
985068403 4:186144876-186144898 CCGGGCGCGCCCGGGGTCCGCGG - Exonic
985685144 5:1277963-1277985 CCCAGAGCGGCCGGGGGCCTTGG - Intronic
986858874 5:11903967-11903989 CTGAGCGCGGCCGCGGGACAAGG + Exonic
987090566 5:14505270-14505292 CAGGGAGCGGCCGGAGGCCAGGG + Intronic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
992769702 5:80035499-80035521 CCCCGCGAGGCCGGGGGCGACGG - Exonic
995724688 5:115170299-115170321 CAGCGCAGGGCCAGGGGCCAGGG - Intronic
996900755 5:128538841-128538863 CCTCGCCCGGCCGCGGACCAGGG + Intronic
998149366 5:139748042-139748064 CCGCGGGCGGGAGGGGGCGAAGG + Intergenic
1001646184 5:173283960-173283982 CCGCGCACAGCCGGCGGGCAGGG - Intergenic
1002140227 5:177133518-177133540 CCGCTCGCGGCCGGGGCCTACGG - Intronic
1002487704 5:179550822-179550844 CTGCGCGCGGCCGCGGGGCTGGG + Exonic
1003324940 6:5084590-5084612 CCGCTCTCGGCTGCGGGCCATGG + Exonic
1006717594 6:36130451-36130473 CCGCGCGAGGGCGGGGGCCCCGG - Exonic
1007631434 6:43275430-43275452 CCGCCCCCGCCCCGGGGCCAGGG - Intronic
1007902268 6:45422975-45422997 CCGCTCCCGGCCGGGGGCGGGGG - Intronic
1013170747 6:107634735-107634757 CCGCCCGCGCCCGGGGGGCCCGG - Exonic
1016328229 6:142927015-142927037 CGGCGCGGGGCGGGCGGCCAGGG + Intronic
1018046450 6:159969714-159969736 CCTCGCGCGGCCGGGCGTCCGGG + Intronic
1018652897 6:166006133-166006155 CCGCGGGCGGGCGGGGGGCCCGG - Intergenic
1018876596 6:167827088-167827110 CCGCGCGGGGCCGGGGCCGGAGG - Exonic
1019298516 7:291210-291232 CCGCGCGCGGGGGGCGCCCAGGG + Intergenic
1019429060 7:990420-990442 CAGCGCTGGGACGGGGGCCAGGG - Intergenic
1019436932 7:1027382-1027404 GCGCGCACAGCCGGGGGCCGTGG - Intronic
1019526043 7:1480958-1480980 CTGGGCGCGGCCAGGGGCCAGGG + Intronic
1019764997 7:2843760-2843782 CCGCCCGCGGCGGCGGACCACGG + Intronic
1019765106 7:2844186-2844208 CCGCCGGCGCCCGGGGGCCATGG + Exonic
1021969357 7:25951367-25951389 CCGCGCGGGGCTGGGGGCGGGGG + Intergenic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1026985917 7:74555229-74555251 CAGCGCGGGGTCGGGAGCCATGG + Intronic
1027001648 7:74658197-74658219 CCGCGCGCGGTGTGGGGCCTTGG + Intronic
1027138290 7:75639439-75639461 CCGTGCGAGCCCGGGGGCCGCGG - Intronic
1029424339 7:100486859-100486881 CCGCGGCCGGCCAGGGGCCTGGG + Exonic
1031011190 7:116526250-116526272 CCGCCCGCCGCCAGGGGTCAGGG - Intronic
1031927431 7:127651888-127651910 CCGCGGGGCGCGGGGGGCCATGG - Intergenic
1032239927 7:130152914-130152936 CCACGCAGGGCAGGGGGCCATGG - Intergenic
1034268015 7:149790528-149790550 CCGCGCATGGCCGGGGGCGCGGG - Intergenic
1034441212 7:151086852-151086874 CGGCGCGGGGCCCGGGGCCGGGG + Exonic
1035265159 7:157686010-157686032 CCGCGCGGGGCCGCGGGACCTGG + Intronic
1035373887 7:158395337-158395359 GCGCGAGGGGCCAGGGGCCAGGG + Intronic
1037768946 8:21787957-21787979 CCGAGCGGGGCCGGGCGGCAGGG - Intronic
1039463130 8:37762615-37762637 CCACGGGCTGCCGGGGGCCTGGG + Exonic
1047203172 8:122782722-122782744 CCGCGCGGGGCGGGGGGCCGAGG + Intronic
1048345527 8:133572030-133572052 CCGGCCGGGGCCGGGTGCCAGGG + Intergenic
1049556253 8:143283679-143283701 GCTCGCGCGGCTGGGGGCCATGG - Intergenic
1049621078 8:143598570-143598592 CCGCCCTCGGCCGGGGGCGGCGG - Exonic
1049762667 8:144338152-144338174 CCGCGCGGGGCCGGGCGGCCGGG - Intergenic
1051936263 9:22446747-22446769 CCGCGCTGGGCCGGGAGCCTGGG + Intergenic
1053138270 9:35665227-35665249 CCGCTCGCGGGCGGGAGCCGCGG + Exonic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1057298203 9:93861389-93861411 CCGCGTGCGGCCTGGGGGCCTGG + Intergenic
1057546176 9:96021633-96021655 CCGCAGGCCGCCGGGGGCCCAGG + Intergenic
1057758392 9:97854257-97854279 CCGCGCGAGGCCGGCCGCCCGGG + Exonic
1059769870 9:117414918-117414940 CCGGGCGCCGGCGGCGGCCATGG + Exonic
1060477948 9:123999685-123999707 GCGCGTGCGGCCGGGGGCGGGGG - Intergenic
1060478142 9:124000193-124000215 CTGCGGGCGGCCCCGGGCCAGGG - Intergenic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061062556 9:128257991-128258013 CCGGGCCCTGCAGGGGGCCATGG - Exonic
1061242660 9:129383465-129383487 CCGCGCTTTGCCGGGGTCCAGGG + Intergenic
1061559520 9:131393909-131393931 CCGGGCGAGGGCTGGGGCCAGGG - Intergenic
1061961770 9:133992348-133992370 CCGCGCGCGCGCGGGGCTCAGGG + Intronic
1061976073 9:134068448-134068470 CCGTGCGCGGCCGGGGTTCGAGG - Intronic
1062204803 9:135330001-135330023 CCGCACCTGGCCCGGGGCCAGGG + Intergenic
1062234125 9:135500064-135500086 CCGCGGGTGGCTGGGGGCCTGGG - Intronic
1062491795 9:136808377-136808399 CCGCGCGGCGCCCGGGGCCTGGG - Intronic
1062658964 9:137618578-137618600 CCGCGCCAGGCCGCGGCCCAGGG + Exonic
1203469171 Un_GL000220v1:108710-108732 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203476992 Un_GL000220v1:152682-152704 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1185600179 X:1333715-1333737 CCGCGCCCGGCCTGCCGCCATGG + Intergenic
1185778874 X:2829026-2829048 CTGGGCGCGGCGGGGGGCCGGGG + Intronic
1188811394 X:34657257-34657279 CGGCGCGGGGCCGGCGGCGAAGG - Exonic
1188974558 X:36657515-36657537 CTGCCAGGGGCCGGGGGCCAGGG + Intergenic
1189332836 X:40153787-40153809 CCCCGCGCGGCCGGAGGCTCGGG + Intronic
1189407248 X:40735889-40735911 CCGCGCGCCGCCGGAAACCAGGG + Intergenic
1195216889 X:102712139-102712161 CAGCGGGCGGCTGGGGGCCCGGG - Intergenic
1198276383 X:135098630-135098652 CTGCGCGGGGCCCGGGCCCATGG - Intergenic
1198310127 X:135422113-135422135 CTGCGCGGGGCCCGGGCCCATGG + Intergenic
1199179640 X:144838524-144838546 CAGGGCGCGGCCGGCGGGCAGGG - Intergenic
1199772775 X:150984533-150984555 ACGCGCGGGGCCGGGGGCGGCGG - Intronic
1200097974 X:153673113-153673135 CCCCGCCCCGCCGGGGGCAAGGG + Intronic
1200147620 X:153934792-153934814 CCGGGCTCGGCCGGGGCCCTCGG + Intronic
1201282563 Y:12354125-12354147 CCGCCCGCCGCCAGGTGCCAGGG + Intergenic
1201291151 Y:12421478-12421500 CTGGGCGCGGCTGGGGGCCGGGG - Intergenic