ID: 1165862313

View in Genome Browser
Species Human (GRCh38)
Location 19:38915709-38915731
Sequence AGGTAGGACTGGAGGGCAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1008
Summary {0: 1, 1: 1, 2: 1, 3: 61, 4: 944}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165862297_1165862313 28 Left 1165862297 19:38915658-38915680 CCGATGTACTGGAGAGGCACGTG 0: 1
1: 0
2: 1
3: 10
4: 91
Right 1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG 0: 1
1: 1
2: 1
3: 61
4: 944
1165862305_1165862313 -10 Left 1165862305 19:38915696-38915718 CCGATCAGTGCCGAGGTAGGACT 0: 1
1: 0
2: 0
3: 6
4: 41
Right 1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG 0: 1
1: 1
2: 1
3: 61
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165862313 Original CRISPR AGGTAGGACTGGAGGGCAGG GGG Exonic
900164040 1:1237638-1237660 AGGCAGGACAGGAGCCCAGGAGG + Intergenic
900909679 1:5586248-5586270 AGGAAGTACTGGAGGGCGGCTGG + Intergenic
900932890 1:5747821-5747843 AGGGAGGAATGGAGGGAGGGAGG + Intergenic
901241772 1:7698472-7698494 AGGTAGTTCTGGGGGGCAAGGGG + Intronic
901249096 1:7759422-7759444 AGGTAGGCCTGAAGGAAAGGGGG - Intronic
901324112 1:8356807-8356829 AGATAGGAGGTGAGGGCAGGAGG - Intronic
901410232 1:9077804-9077826 AGGAAGGACAGGAGGGAGGGAGG + Intronic
901456749 1:9367540-9367562 AGGTAGGCCTTGAGGGAAGCCGG - Exonic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901730103 1:11273148-11273170 AGGGTGGGCTGGAGGGCGGGAGG - Intergenic
901798880 1:11695839-11695861 AGGTAGGACTCGAGTTCAGCAGG + Intronic
901849516 1:12006718-12006740 AGGTGGGGGCGGAGGGCAGGTGG + Intronic
902190293 1:14758158-14758180 AGGAAGGAATGGAGGGAGGGAGG - Intronic
902228032 1:15009075-15009097 AGCTAAGGCTGGAGGGAAGGGGG - Intronic
902270293 1:15299541-15299563 AGGTGGGACAGGAAGGCAGGTGG + Intronic
902289911 1:15429069-15429091 AGGGATGTGTGGAGGGCAGGCGG - Exonic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902464421 1:16607186-16607208 AGGGAGGGATGGAGGGCGGGTGG + Intronic
902466493 1:16621797-16621819 TGGGAGGACTGGAGGGGTGGTGG - Intergenic
903004908 1:20292168-20292190 AGGGAGGACAGGAGGGGGGGAGG - Intronic
903579492 1:24360073-24360095 AGGAAGCCCTGGAGAGCAGGTGG - Intronic
903859189 1:26354838-26354860 AGGGGTGCCTGGAGGGCAGGGGG - Intergenic
904127019 1:28248117-28248139 AGGTAGGACAGGATGGTGGGAGG + Intergenic
904298129 1:29536671-29536693 AGGCAGGAAGGGAGGGAAGGAGG - Intergenic
904384107 1:30130447-30130469 GGGGAGGCCTGGTGGGCAGGTGG - Intergenic
904384122 1:30130492-30130514 GGGGAGGCCTGGTGGGCAGGTGG - Intergenic
904401512 1:30259803-30259825 AGGGCGACCTGGAGGGCAGGAGG - Intergenic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
904757017 1:32773569-32773591 TGGCAGAACTGGAAGGCAGGAGG - Exonic
905258361 1:36700275-36700297 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
905309138 1:37037430-37037452 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
905322909 1:37130405-37130427 GGGTGGGACAGGAGGGGAGGAGG - Intergenic
905865493 1:41374193-41374215 AGGAAGGCCAGGAGGGAAGGAGG + Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907463738 1:54621687-54621709 GGGCAGGGCTGGAGGGCTGGAGG + Intronic
907526343 1:55056247-55056269 AGGGAGGGCGGGCGGGCAGGCGG + Intronic
907715084 1:56919052-56919074 AGGCATGACTGGAGGGCTGTGGG - Intergenic
907728114 1:57039351-57039373 AGGAAGGAAGGGAGGGCAGGAGG + Intronic
908524335 1:64973312-64973334 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
908921752 1:69202771-69202793 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
908945293 1:69488203-69488225 AGGTAGGACAGGATGGCTAGAGG - Intergenic
909138855 1:71836924-71836946 AGGAAGGACAGGAGGGAGGGAGG + Intronic
910597974 1:88999575-88999597 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
910751809 1:90639033-90639055 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
910819973 1:91336049-91336071 AGGGAGGAGGGGAGGGCAGGAGG - Intronic
911089918 1:94010189-94010211 AGGTAGGACTGGATTGCAGAGGG + Intronic
912368662 1:109155786-109155808 AGGGAGGAGTGGAAGGCAGCAGG - Intronic
912374724 1:109200925-109200947 AGGTCAGCCTGGAGGGCTGGAGG + Intronic
912471602 1:109910798-109910820 AGAGAGGACTGGGGGGCATGTGG - Exonic
912582976 1:110736829-110736851 AGTGAGGACTGCAGGGCAGCGGG - Intergenic
913194774 1:116446602-116446624 AAATAGGATTGGAAGGCAGGGGG - Intergenic
913400769 1:118430332-118430354 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
913940344 1:125097970-125097992 AGGAAGGAATGGAGGGCGGGAGG - Intergenic
914196343 1:145449945-145449967 AGGAAGGACTGGAGAGCGTGAGG - Intergenic
914880218 1:151540926-151540948 GGCTTGGACTGGAGGGCGGGGGG + Intronic
915289994 1:154877184-154877206 GGGTGGGAGTGGTGGGCAGGAGG - Intergenic
915388483 1:155518831-155518853 AGGAAGGAATGGAGGGAGGGAGG + Intronic
915580330 1:156809367-156809389 AGATAGGATTGGAGGGCTTGGGG + Exonic
915604970 1:156944756-156944778 GGGTAGAACTGGAGGTAAGGTGG - Intronic
915615286 1:157033104-157033126 AGCTTGGGCTGGAGGTCAGGAGG - Intronic
915716573 1:157950168-157950190 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
916565713 1:165975004-165975026 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
916608796 1:166369620-166369642 AAGGAGGAAAGGAGGGCAGGAGG - Intergenic
917149896 1:171932051-171932073 AGGGAGGAATGGAGGGAGGGTGG - Intronic
917461514 1:175234498-175234520 AGGGAGGCCAGAAGGGCAGGGGG + Intergenic
918139852 1:181711068-181711090 AGGTAGGCCTGGGGGGCTGCAGG + Exonic
919094223 1:193010410-193010432 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
919741694 1:200984834-200984856 AAGCAGGGCTGGAGGGCAAGTGG - Intronic
920162818 1:204012555-204012577 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
920276003 1:204804785-204804807 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
920403457 1:205692063-205692085 TGGAGGGACTGGGGGGCAGGGGG - Intergenic
920422071 1:205841754-205841776 AGGGAGGAGTGGAGGGCGGTAGG + Intronic
920428308 1:205896698-205896720 AGGAAGGAAGGGAGGGGAGGGGG - Intergenic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
920694216 1:208169546-208169568 AGGTATGCCTGGTGGGCAAGTGG + Intronic
920948807 1:210553879-210553901 AGGCAGGAGTGGAAGGCAGCTGG - Intronic
922117767 1:222631081-222631103 AGGAAGGAAGGAAGGGCAGGTGG - Intronic
922205847 1:223445473-223445495 AGGGAGGAAGGGAAGGCAGGAGG + Intergenic
922271966 1:224043321-224043343 AGGTAGTGTTGGAGGGGAGGGGG - Intergenic
922421583 1:225464140-225464162 AGGCAGTGCTGGAGGGCAGGAGG + Intergenic
922675024 1:227544515-227544537 GGCTAGGACTGGAGAGCTGGGGG + Intergenic
922945254 1:229508444-229508466 AGGTAGGTCGGGAAGGCAGCCGG + Intergenic
923635098 1:235687696-235687718 AGGTGGGACAGGAGAGCAGTTGG - Intronic
924415106 1:243850154-243850176 GGGGAGGACAGGAGGGGAGGAGG - Intronic
924585734 1:245359697-245359719 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
1062922863 10:1293084-1293106 AGGGAGGAAAGGAGGGAAGGGGG + Intronic
1063353109 10:5374213-5374235 AGGCTGGACGGGAGGGCAGCGGG + Exonic
1063566629 10:7177061-7177083 TGGGGGGACTGGAGAGCAGGTGG - Intronic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1064210515 10:13357247-13357269 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1064462740 10:15550853-15550875 AGGGAAGATTGGGGGGCAGGAGG + Intronic
1064526428 10:16260805-16260827 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1064720209 10:18221090-18221112 AGGGAGGAGAGAAGGGCAGGGGG + Intronic
1065005962 10:21380319-21380341 AGAAAGGACTGAAGGGCAAGAGG - Intergenic
1065167483 10:22994673-22994695 AGGAAGGACTGGAGGGGGTGAGG + Intronic
1065390481 10:25176325-25176347 AGGGAGGGCCGGGGGGCAGGGGG + Intronic
1065708278 10:28491252-28491274 GTGTAGGACTGGAAGGGAGGAGG + Intergenic
1065761370 10:28986317-28986339 TTGGAGGACTGGATGGCAGGTGG - Intergenic
1066253944 10:33660827-33660849 GGGAGGGGCTGGAGGGCAGGGGG - Intergenic
1066276123 10:33870549-33870571 AGGAAGAACTGGAGGACAGTTGG + Intergenic
1066487018 10:35856053-35856075 AGGTAGGAAGGGAGGGAGGGAGG - Intergenic
1067063228 10:43088947-43088969 CGGCAGGACGGGAGGGCTGGGGG - Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067384214 10:45804011-45804033 AGGAAGGAAGGTAGGGCAGGAGG - Intergenic
1067689797 10:48494421-48494443 AGGCAGCCCTGGAGGGCAGAGGG + Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1067879982 10:50034799-50034821 AGGAAGGAAGGTAGGGCAGGAGG + Intergenic
1067891901 10:50144581-50144603 AGGAAGGAAGGTAGGGCAGGAGG - Intergenic
1067977721 10:51044587-51044609 AGGAGGGAGTAGAGGGCAGGAGG + Intronic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1069794619 10:71044100-71044122 AGGCAGGACTGGCGTGAAGGTGG + Intergenic
1069824874 10:71248945-71248967 AGGAAGGAGTGGGGTGCAGGTGG - Intronic
1069841150 10:71340183-71340205 AGGCAGGGCTGGAACGCAGGTGG - Intronic
1069861267 10:71473153-71473175 AGGCGGGAATGGAGGCCAGGAGG - Intronic
1069918800 10:71803439-71803461 AGGAAATACTGGTGGGCAGGAGG - Intronic
1070373194 10:75804930-75804952 AGGCAGGACTGAAGTGCAGGTGG + Intronic
1070597902 10:77845581-77845603 AGGGAGAAATGGAGGGAAGGAGG + Intronic
1071115195 10:82210461-82210483 AAGGAGAAGTGGAGGGCAGGGGG + Intronic
1071430374 10:85602245-85602267 AGGGTGGGCAGGAGGGCAGGCGG + Exonic
1071525725 10:86357115-86357137 AGGGTGGACTGGAGGGGATGAGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071545062 10:86522335-86522357 AGGAAGGACTGCAGGGCTGGAGG - Intergenic
1072443959 10:95481500-95481522 ACTTAGGACAGGTGGGCAGGAGG - Intronic
1072759434 10:98043714-98043736 AGGAAGGTCTGGAGGAAAGGAGG + Intergenic
1073123144 10:101133951-101133973 GCGTCGGACTGGCGGGCAGGAGG + Intronic
1073433061 10:103499396-103499418 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1073649103 10:105339990-105340012 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1074446707 10:113526685-113526707 AGGAAGCACTGGGTGGCAGGTGG - Intergenic
1074514192 10:114149659-114149681 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1074651420 10:115527883-115527905 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1074853044 10:117454146-117454168 AGGTAGGATTAGAGCCCAGGAGG - Intergenic
1074857245 10:117482443-117482465 AGGGAGGGAGGGAGGGCAGGTGG + Intergenic
1075174051 10:120143129-120143151 AGGTAGAACTGGAGGACAAATGG - Intergenic
1075483343 10:122800268-122800290 AGGAAGGGCTTGGGGGCAGGAGG + Intergenic
1075515403 10:123104281-123104303 TGGTAGGACCGGAGGGCACAAGG + Intergenic
1075557996 10:123447299-123447321 AGGAAGGACTGAGGGGCAAGTGG - Intergenic
1075870211 10:125767172-125767194 AGGCTGGACTGGAGTGCAAGTGG + Intronic
1075938391 10:126364814-126364836 AGGGAGGAGTTGAGGGAAGGAGG - Intronic
1075994962 10:126869794-126869816 AGGCAGCTTTGGAGGGCAGGAGG + Intergenic
1076201536 10:128562730-128562752 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1076220119 10:128727200-128727222 AGGTGGAACAAGAGGGCAGGAGG - Intergenic
1076274068 10:129181845-129181867 AGGTAGGGCAAGCGGGCAGGAGG - Intergenic
1076290571 10:129342552-129342574 GGGAAGGAAGGGAGGGCAGGAGG + Intergenic
1076290574 10:129342560-129342582 AGGGAGGGCAGGAGGGAAGGAGG + Intergenic
1076652783 10:132001390-132001412 AGGTAGGAAGGCAGGGAAGGAGG + Intergenic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1077247138 11:1545126-1545148 AGGCATTGCTGGAGGGCAGGAGG + Intergenic
1077268969 11:1666244-1666266 AGGGGGTCCTGGAGGGCAGGGGG - Intergenic
1077271633 11:1684600-1684622 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271681 11:1684712-1684734 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271723 11:1684807-1684829 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077278932 11:1733267-1733289 TGGTGGGATGGGAGGGCAGGAGG - Exonic
1077365534 11:2160084-2160106 ACCTAGGGCTGGCGGGCAGGCGG - Intronic
1078029034 11:7729724-7729746 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
1078093381 11:8281662-8281684 ATGGAGGACAGGATGGCAGGGGG - Intergenic
1078106490 11:8361314-8361336 AGGCAGGACAGGGGGCCAGGAGG - Intergenic
1078774642 11:14383060-14383082 ACATAGGACTGGAGGTTAGGAGG - Intergenic
1078932101 11:15920678-15920700 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1079913812 11:26343126-26343148 GGGTAGGATTGGGGGGCATGTGG - Intronic
1079964394 11:26963197-26963219 AAGGAGGAAAGGAGGGCAGGAGG + Intergenic
1080462617 11:32468833-32468855 AGTTAGGATTGGTGGGGAGGAGG + Intergenic
1081691676 11:45082558-45082580 AGGGAGCACTGGAGCCCAGGCGG + Intergenic
1081706907 11:45187580-45187602 AGGTGGGACTGGTGGCCTGGAGG + Intronic
1082278528 11:50246512-50246534 TGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1082973235 11:59045472-59045494 GGGTAGGAATGGAGGAGAGGAGG - Intergenic
1082977631 11:59089036-59089058 GGGTAGGAATGGAGGAGAGGAGG - Intergenic
1083205544 11:61146589-61146611 AGGGAGGGCTGCGGGGCAGGCGG + Intronic
1083308806 11:61774178-61774200 AGCAAGGAAGGGAGGGCAGGAGG + Intronic
1083681343 11:64353239-64353261 AGGTGTGGCTGGAGGGCCGGTGG + Exonic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083849305 11:65355721-65355743 AGCTAGGAAAGGAGCGCAGGAGG - Intronic
1083901287 11:65644756-65644778 AGGTAGGAAGGGATGGGAGGAGG - Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084111090 11:67014649-67014671 AGGTAGGACTGGGGTGGAGGTGG + Intronic
1084742664 11:71149744-71149766 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
1084888716 11:72225957-72225979 ATGTCAGACTGCAGGGCAGGAGG - Intronic
1084928688 11:72535958-72535980 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1084972109 11:72777662-72777684 AGGTCAGGCTGGAGGCCAGGAGG + Intronic
1085024245 11:73227507-73227529 AGGTAGGAGTGGGGAGGAGGGGG + Intronic
1085511573 11:77090863-77090885 AGGGAAGACAGGAGGGCAGCGGG + Intronic
1085746355 11:79117890-79117912 AGGTATGTCTGAAGGGAAGGGGG - Intronic
1085806675 11:79643105-79643127 AGGAAGGAAGGAAGGGCAGGAGG + Intergenic
1085847501 11:80083182-80083204 AGGGAGGACGGGAGGGAGGGAGG - Intergenic
1085853233 11:80145973-80145995 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1085868269 11:80320341-80320363 AGGTGGGACTGAATGCCAGGTGG + Intergenic
1086307162 11:85493789-85493811 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1086960087 11:92972535-92972557 AGGGAGGAGTGGAGGCAAGGTGG + Intronic
1087906107 11:103699724-103699746 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1088695480 11:112362482-112362504 AAGTAGGAAATGAGGGCAGGGGG + Intergenic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1088989056 11:114935617-114935639 AGGAAGCCCTGGAGAGCAGGGGG + Intergenic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1089479120 11:118791077-118791099 AGGTAGGGCTGGACAGCCGGGGG - Intronic
1089495721 11:118907856-118907878 AATTAGGGCTGGAGGGGAGGGGG + Intronic
1089572214 11:119418381-119418403 AGGCAGGCCTGCGGGGCAGGGGG + Exonic
1089628761 11:119770412-119770434 ATGTGACACTGGAGGGCAGGGGG - Intergenic
1090226188 11:125073491-125073513 AAGAAGGACTGGAGGGGTGGAGG - Intronic
1090507644 11:127335887-127335909 AGATAGGGATGGAAGGCAGGTGG - Intergenic
1090648263 11:128783984-128784006 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1091586668 12:1820835-1820857 AGGAAGGAATGGAGGGTTGGTGG + Intronic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1091806365 12:3359337-3359359 AGGCAGGGCAGGAGGGAAGGAGG - Intergenic
1092006491 12:5074553-5074575 AGGTGGGATGGGAGGACAGGTGG + Intergenic
1092022927 12:5217082-5217104 GGGAAGAACTGGAGGGCAGTGGG - Intergenic
1092286026 12:7129786-7129808 AGGCAGGACAGGTAGGCAGGAGG + Intronic
1092745571 12:11669342-11669364 AGGGAGGACAGGAGGACGGGAGG - Intronic
1092745574 12:11669350-11669372 AGGGAGGAAGGGAGGACAGGAGG - Intronic
1093152022 12:15633034-15633056 AGGCAGGACAGGAGGGAAGGAGG + Intronic
1093435605 12:19130654-19130676 AGGTGGGACTTGTGGGTAGGTGG + Intronic
1095384471 12:41634312-41634334 AGCTAGGACAGGAGAGCAGCTGG - Intergenic
1095562908 12:43586828-43586850 AGACAGGTCTTGAGGGCAGGTGG + Intergenic
1095999375 12:48116113-48116135 AGGAAGGAAGGGAGGGAAGGGGG - Intronic
1096009557 12:48201512-48201534 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1096048628 12:48586614-48586636 GGGAGGGGCTGGAGGGCAGGAGG - Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096504394 12:52083421-52083443 AGGTAAAACTGGAGGGGAGTCGG - Intergenic
1096526414 12:52212768-52212790 AGGTACCCCAGGAGGGCAGGTGG - Intergenic
1096539141 12:52294478-52294500 AGGGAGGAGGGGAGGGAAGGTGG + Intronic
1096677401 12:53232944-53232966 AGGCTGGAGAGGAGGGCAGGAGG + Intronic
1096740319 12:53688765-53688787 AGGTAAGGGTGGAGGGCAGCAGG - Intergenic
1096767039 12:53899521-53899543 AGGGAGGAAAGGAGGGGAGGAGG + Intergenic
1097182980 12:57181343-57181365 AGGTGGGGCTGTAGGGTAGGAGG - Intronic
1097922987 12:65096860-65096882 TGTTAGGAGTGGAGGGCAAGGGG + Intronic
1097968229 12:65603815-65603837 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1098300884 12:69053160-69053182 TGGGAGGTGTGGAGGGCAGGGGG + Intergenic
1098912253 12:76221254-76221276 GGGATGGACTGGAGGGCAGGAGG + Intergenic
1099079648 12:78160858-78160880 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1099962794 12:89412887-89412909 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1100351851 12:93791520-93791542 GGGTTGGGGTGGAGGGCAGGTGG + Intronic
1100370820 12:93967098-93967120 AGGGAGGGATGGAGGGAAGGGGG - Intergenic
1100457138 12:94763496-94763518 ACGTAAGACTGGAGGGATGGAGG - Intergenic
1100587139 12:95990781-95990803 AGGGAGGAAAGGAGGGCTGGAGG + Intronic
1102137748 12:110589281-110589303 AGGTAGAACACGAGGTCAGGAGG - Intergenic
1102501160 12:113353574-113353596 AGGGAGGAGTGGAGGGAGGGAGG - Intronic
1102543308 12:113637920-113637942 GGGGAGGAGGGGAGGGCAGGAGG - Intergenic
1102646319 12:114406202-114406224 AGGGAGGACGGGAGGGTGGGAGG - Intronic
1102705682 12:114878389-114878411 AGGAAGGAAGGGAGGGCGGGAGG - Intergenic
1102864047 12:116360321-116360343 AGGAAGGAATGGAGGGAGGGCGG - Intergenic
1102975994 12:117207628-117207650 AGGCAGAAGTGAAGGGCAGGGGG - Intergenic
1103282469 12:119771384-119771406 AGGAAGGACAGGAGAGGAGGGGG + Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104720113 12:131040665-131040687 AGGCAGCTCTGGAGGGCGGGTGG - Intronic
1105211576 13:18260249-18260271 AGGTAGAAGTTGAGGCCAGGAGG - Intergenic
1105818870 13:24062328-24062350 AGGAAGGACTAAAGGGCTGGGGG + Intronic
1106044293 13:26123417-26123439 AGATATGACTGGAGGGTAAGAGG + Intergenic
1106684334 13:32042180-32042202 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1108490210 13:50974412-50974434 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1108696832 13:52909595-52909617 ATGGAAGAGTGGAGGGCAGGAGG + Intergenic
1110241712 13:73274701-73274723 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1110369570 13:74725043-74725065 AGGTAGAACAGGAGGGCAACAGG + Intergenic
1110641501 13:77830138-77830160 AGGAAGGGCAGGAAGGCAGGAGG - Intergenic
1111086433 13:83380739-83380761 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1111452623 13:88438752-88438774 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1112611055 13:100955074-100955096 AGCTAGGACTGGAGGGGAAAAGG - Intergenic
1113420758 13:110170026-110170048 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1113507313 13:110826184-110826206 TGGTGGGAGTGAAGGGCAGGCGG - Intergenic
1113677107 13:112214888-112214910 GGGGAGGCCTGGAGGGGAGGAGG + Intergenic
1113727901 13:112618708-112618730 AGCTACAACAGGAGGGCAGGTGG + Intergenic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1114031636 14:18584646-18584668 AGCTGGGACTGGATTGCAGGTGG + Intergenic
1115329908 14:32186041-32186063 AGGTAGCACTGAAGGGCAATGGG - Intergenic
1115853594 14:37606374-37606396 GTGCAGGACTGAAGGGCAGGAGG + Intronic
1117508142 14:56422968-56422990 AGGAAGAACAGGAGGGCAGAGGG + Intergenic
1117531119 14:56661509-56661531 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1117918269 14:60701553-60701575 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
1118322513 14:64761573-64761595 AGGTAGGGATGCAGGGCAGAAGG + Intronic
1118701416 14:68437579-68437601 AGGCAGGAATGGAGGGAAAGGGG - Intronic
1118877367 14:69796779-69796801 AGGTAGGCCTGGGGGTGAGGAGG - Exonic
1119050074 14:71358567-71358589 AGGAATGAATGGAGGGCAGGTGG - Intronic
1119325019 14:73754699-73754721 AGGAAGGCCAGGAGGGGAGGAGG + Intronic
1119728595 14:76937250-76937272 AGGGAGGACTGGGGGTCAGGTGG - Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1121237096 14:92399864-92399886 AGGGAGGAGTCGATGGCAGGTGG + Intronic
1121561680 14:94880835-94880857 AAGTAGGACGGGCGGGCGGGCGG + Intergenic
1121797228 14:96745214-96745236 AGCTAGCACTGTAGGGAAGGAGG - Intergenic
1122276722 14:100594502-100594524 AGCCAGGATTGGGGGGCAGGAGG + Intergenic
1122691607 14:103534389-103534411 AGCTGGGACTGCAGGGCAGAGGG - Intronic
1122806222 14:104260071-104260093 AGGTGGGACAGGATGGCTGGAGG - Intergenic
1122874068 14:104655180-104655202 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
1122899065 14:104774638-104774660 AGGCAGGGCTGCAGGGCATGGGG + Intronic
1123395766 15:19933483-19933505 AGGAAGAAAAGGAGGGCAGGAGG + Intergenic
1127757589 15:62108020-62108042 AGGTAAAACTGGAGGTCAGCAGG - Intergenic
1127924962 15:63530282-63530304 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1128038510 15:64548670-64548692 AAGTAGGACTTGAGCTCAGGAGG + Intronic
1128066817 15:64770219-64770241 TGGTGAGACTGGAAGGCAGGGGG - Intronic
1128162584 15:65434091-65434113 AGGGAGAGCAGGAGGGCAGGAGG - Intergenic
1128214210 15:65923019-65923041 AGGGAAGAATGGAGGGAAGGGGG + Intronic
1128378435 15:67093741-67093763 AGGTAGCACTGGTTGGGAGGCGG + Intronic
1128718905 15:69931216-69931238 AGGTAGAGCTGGAGGGGAGGGGG + Intergenic
1129265184 15:74389502-74389524 AGGCAGGAGGGGAGGGCAAGGGG + Intergenic
1129315835 15:74743304-74743326 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1129332457 15:74834641-74834663 AGGTAGGTGTGGAGAGCAGTGGG - Intergenic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1130599597 15:85266529-85266551 GGGGAGGACTGGGGGGCTGGGGG + Intergenic
1130680554 15:85992549-85992571 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1130680563 15:85992573-85992595 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1131293576 15:91128262-91128284 AGGTGGGATGGGAGAGCAGGAGG + Intronic
1131353070 15:91719122-91719144 GGGTAGGACTATCGGGCAGGAGG + Intergenic
1131460045 15:92611291-92611313 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1131492620 15:92876107-92876129 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1131850731 15:96540944-96540966 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1131925883 15:97383370-97383392 AGAGAGGGATGGAGGGCAGGAGG + Intergenic
1132606523 16:795868-795890 ACCTAGGACAGGAGGGCAGCAGG - Intronic
1132665273 16:1078634-1078656 AGGAAGGAGCGGCGGGCAGGTGG - Intergenic
1132755870 16:1485115-1485137 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1133206377 16:4236563-4236585 AGGCAGGACTGGAGCTTAGGAGG - Intronic
1133978141 16:10614947-10614969 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1134290720 16:12901573-12901595 AGGGAGGGCAGGAGGGAAGGGGG - Intergenic
1134459083 16:14416120-14416142 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1134670049 16:16048003-16048025 AGATAGGTCGGGAGGGGAGGAGG + Intronic
1134846751 16:17446993-17447015 AGGGAGGGATGGAGGGGAGGAGG - Intronic
1135494450 16:22939354-22939376 AGATAGGAAAGGAGGGCAGGAGG - Intergenic
1135601151 16:23784704-23784726 AAGTAGGAATGGGGTGCAGGTGG + Intergenic
1135945191 16:26859030-26859052 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1136086043 16:27885799-27885821 TGGAAGGACAGGAGTGCAGGTGG - Intronic
1136095861 16:27955951-27955973 AGGAAGGACAGGAGGGAGGGAGG + Intronic
1136399434 16:30009841-30009863 AGGTAGGGGAGGAGGGCAGTGGG - Intronic
1136475434 16:30510279-30510301 AGGTAGGCCAGGAGGGCTGGTGG + Intronic
1136636553 16:31528027-31528049 AGATAGCCCTGCAGGGCAGGAGG + Intronic
1136769392 16:32822212-32822234 AGGAAGAAATGGAGGGCGGGAGG - Intergenic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137093351 16:36221895-36221917 AGGAAGAAATGGAGGGCGGGAGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137558011 16:49484787-49484809 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137599036 16:49743751-49743773 AGGTGGGCCTGGAGGGCCAGGGG + Intronic
1137694163 16:50450018-50450040 AGCTGGGCCTGGAAGGCAGGTGG + Intergenic
1137746856 16:50828571-50828593 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1137842574 16:51653677-51653699 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138247332 16:55477699-55477721 AGATAGGACTGGGGGTCAGCAGG - Intronic
1138347549 16:56329321-56329343 GGGGATGACAGGAGGGCAGGAGG + Intronic
1138383030 16:56616998-56617020 AGGCAATGCTGGAGGGCAGGAGG + Intergenic
1138536734 16:57664172-57664194 AGGGAGGACTGGGGGGCTGAGGG - Exonic
1138816551 16:60209570-60209592 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1138957935 16:61993655-61993677 AGGAGGAACTGGAGGACAGGGGG - Intronic
1138966381 16:62089150-62089172 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1138972060 16:62157317-62157339 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1139016256 16:62692451-62692473 AGGAAGGACGGGAGGGAAGGAGG + Intergenic
1139341382 16:66270137-66270159 AGGGAGGACGGGAGGGAGGGAGG + Intergenic
1139398229 16:66658214-66658236 AGGTAGGGAGGGAGGGAAGGAGG + Intronic
1139760387 16:69180213-69180235 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1140571503 16:76111860-76111882 AGGGAGGAATGGAGGGAGGGGGG - Intergenic
1141123195 16:81378785-81378807 AGATAGGAAAGGAGGGAAGGAGG - Exonic
1141795969 16:86274501-86274523 AGGTAAGAACAGAGGGCAGGGGG - Intergenic
1141989722 16:87602874-87602896 AGACAGGACCGGAGGGGAGGGGG - Intronic
1142030673 16:87836870-87836892 AGGGAGGAGAGGAGGGAAGGAGG + Intronic
1142221220 16:88856245-88856267 AGGTAAGACTGGAGCCCAGCGGG + Intronic
1203071808 16_KI270728v1_random:1084317-1084339 AGGAAGAAATGGAGGGCGGGAGG - Intergenic
1142505042 17:357887-357909 AGATACGAGTGGAGTGCAGGGGG - Intronic
1142625187 17:1187310-1187332 AGGCAGGACTGGACTGCAGAGGG - Intronic
1142958017 17:3534454-3534476 AGGCAAGACTGGGTGGCAGGAGG + Intronic
1143173087 17:4941180-4941202 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143656982 17:8300716-8300738 GGGGAGGCTTGGAGGGCAGGGGG + Intergenic
1143749865 17:9020819-9020841 AGGGAGCAGTGGTGGGCAGGAGG - Intergenic
1143869779 17:9949838-9949860 AGGGAGGGCAGGAGGGAAGGAGG - Intronic
1143869782 17:9949846-9949868 AGGGAGGGAGGGAGGGCAGGAGG - Intronic
1143994758 17:10996965-10996987 AGATGGGACTGTTGGGCAGGAGG - Intergenic
1144213016 17:13031213-13031235 AGGAAGGAGTGGAGGGGAGAAGG - Intergenic
1144582303 17:16465860-16465882 AGGCAGGATGGGAGGGAAGGAGG + Intronic
1144872065 17:18377820-18377842 AAGGAGGGCAGGAGGGCAGGTGG - Exonic
1145004594 17:19330174-19330196 AGGTGGGCCTGGAGGGGTGGAGG + Intronic
1146466610 17:33091195-33091217 AGGGAGGACTGGATGGAATGAGG + Intronic
1146520539 17:33522214-33522236 AGATAGGACTGGAGGTTTGGGGG - Intronic
1146537179 17:33662733-33662755 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1146698492 17:34931410-34931432 ATGAAGAACTGGAGGGCATGTGG - Intronic
1146829656 17:36057687-36057709 AGGGAGGACATGATGGCAGGAGG - Intergenic
1146910464 17:36645433-36645455 GGGTAGGACCAGAGGGGAGGGGG - Intergenic
1146951174 17:36907613-36907635 CGGTGGGACTGGAGAGCTGGTGG - Intergenic
1146972939 17:37087114-37087136 AGGTGTGACTGGTGGGCTGGAGG + Exonic
1147318497 17:39632409-39632431 AGGTAAGGCAGGAGAGCAGGTGG - Intronic
1147565408 17:41533273-41533295 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1147916472 17:43890512-43890534 GGGTTGGAGTGGAGGGCAGAGGG - Intronic
1148033814 17:44642544-44642566 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1148074256 17:44926503-44926525 AGGGAGGAAAGGAGGGAAGGTGG + Intronic
1148730999 17:49836537-49836559 AGATAGGACTGGGGAGCAGAAGG + Intergenic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148789589 17:50165973-50165995 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1149254417 17:54808562-54808584 AGGTAGCATTGGGGGGAAGGTGG - Intergenic
1149578028 17:57727684-57727706 AGGGAGGAGGGAAGGGCAGGAGG + Intergenic
1150578974 17:66454986-66455008 AGGCAGCAGTGGAGGGAAGGTGG + Intronic
1151078445 17:71301188-71301210 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1151169735 17:72236584-72236606 AGGCAGGACGGGAGGGAGGGAGG + Intergenic
1151385948 17:73755424-73755446 AGGTAGGACTGCTGTTCAGGAGG + Intergenic
1151569979 17:74921293-74921315 AGCCAGGACTGGAGGGGAGGAGG + Intronic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1151918822 17:77139212-77139234 AGGCTGGAGTGCAGGGCAGGTGG + Intronic
1152095379 17:78269101-78269123 AGGGAGGACGGGAAGGGAGGCGG + Intergenic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152215256 17:79028139-79028161 AGGCAGGAGTCGAGGGGAGGAGG + Intronic
1152246245 17:79186131-79186153 AGGTGAGGCTGGAAGGCAGGTGG - Intronic
1152490107 17:80625562-80625584 AGGACTGGCTGGAGGGCAGGTGG + Intronic
1152582239 17:81171201-81171223 GGGCAGGGCTGGAGGCCAGGAGG + Intergenic
1152756891 17:82090730-82090752 GGGCAGGACGGGAGGGGAGGAGG - Intronic
1153025836 18:671580-671602 AGGGAGAAGTGGTGGGCAGGTGG + Intronic
1153565192 18:6412291-6412313 AGGTAGGTTTGGTGGGCTGGAGG - Intronic
1153620526 18:6973334-6973356 AGGCAAGACTGGAAGCCAGGAGG - Intronic
1153804718 18:8702344-8702366 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155085484 18:22453936-22453958 AGGTGGGAGGGGAGGGCAAGTGG + Intergenic
1155208180 18:23578526-23578548 AGGCAGGCCTGGGGGCCAGGAGG - Intronic
1156825946 18:41430128-41430150 AGGGAAGACAGGAGGGAAGGGGG + Intergenic
1156925852 18:42577552-42577574 AGATATGTCAGGAGGGCAGGTGG + Intergenic
1157210171 18:45735412-45735434 AGGGAGACCTGGGGGGCAGGTGG - Intronic
1157220365 18:45825124-45825146 AGGTAGGAAAGGAGGGAGGGAGG + Intergenic
1157431036 18:47626945-47626967 AGGCTGGACTGGAAGGGAGGGGG - Intergenic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1157488614 18:48107179-48107201 AGGGAGGAAGGGAGGTCAGGAGG + Intronic
1158103432 18:53857369-53857391 AGGGACGACTAGAGGGCAGAAGG + Intergenic
1158159158 18:54460625-54460647 AGGAAGGATTGAAGGGAAGGAGG - Intergenic
1158300538 18:56047227-56047249 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158844643 18:61428853-61428875 AGGAATGGCTGGAGGGCTGGTGG - Intronic
1159847819 18:73486960-73486982 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1159961273 18:74557455-74557477 AGGGAGGCCTGGGGAGCAGGAGG + Intronic
1160118296 18:76103084-76103106 AGTTAGGAATGGAGGCCAGAGGG + Intergenic
1160234113 18:77072153-77072175 AGGCAGGAGGGGAGGGGAGGCGG - Intronic
1160488128 18:79312046-79312068 GGGAATGACTGGAGGGAAGGCGG - Intronic
1161141653 19:2651436-2651458 AGGGAGGAAAGGAAGGCAGGAGG - Intronic
1161371991 19:3917750-3917772 AGGAAAGACTGAAGGCCAGGAGG + Exonic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1161620007 19:5292869-5292891 AGGTCGGGCTGGGGGCCAGGCGG + Intronic
1161637552 19:5398364-5398386 AGGGAGGAATGGAGGGAGGGAGG + Intergenic
1161659336 19:5536456-5536478 AGGAAGGACCGGAGGGCACAAGG + Intergenic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1162364168 19:10237989-10238011 AGGTAGGAATGGGGGTCAGAGGG - Intergenic
1163137801 19:15325328-15325350 AGATAGGACTGGATGCCAAGAGG + Intronic
1163204176 19:15790184-15790206 AGGGAGTGCTGGAGGGTAGGAGG + Intergenic
1163378522 19:16949039-16949061 AGGAAGGACGGGAGGGGGGGAGG + Intronic
1163440281 19:17319269-17319291 AGGTAGGCCTGGAGTACAGTGGG - Intronic
1163578880 19:18126350-18126372 ACTGAGGCCTGGAGGGCAGGAGG + Intronic
1163772268 19:19198265-19198287 AGGCAGGAATGAAGGCCAGGAGG - Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164578367 19:29419180-29419202 AGGGAGGAGTGTGGGGCAGGTGG - Intergenic
1164731021 19:30504495-30504517 AGGGAGGAAGGGAGGGAAGGTGG - Intronic
1164769281 19:30795797-30795819 CGTTAGGACTGATGGGCAGGTGG + Intergenic
1164816058 19:31204338-31204360 AGGAAGGACGGGAGGGAAGGAGG - Intergenic
1164975629 19:32570953-32570975 AGGTAGGAAGGGAGGGAAGGAGG - Intergenic
1165438267 19:35808784-35808806 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1165670281 19:37672419-37672441 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166128244 19:40729436-40729458 GGGCAGGGATGGAGGGCAGGGGG + Intronic
1166347780 19:42177049-42177071 AGGGAGGAAGGGAGGGCAGGCGG + Intronic
1166395166 19:42434308-42434330 AGGTATGAGGAGAGGGCAGGAGG - Intronic
1167476226 19:49702793-49702815 GGGAAAGACTGGAGGGCGGGAGG + Intronic
1167476272 19:49703128-49703150 AGGTAGGAAAGGAGGGAGGGAGG - Intronic
1167567852 19:50268034-50268056 GGGCAGGACTGAGGGGCAGGAGG - Intronic
1167782330 19:51607021-51607043 AGGTAGGAATGGATGCCTGGAGG - Intergenic
1168093238 19:54099622-54099644 AGGAAGGAATGGAGGGAGGGAGG + Intronic
1168294514 19:55372381-55372403 AGGCAGGAGAGGAGTGCAGGGGG + Intergenic
1168334831 19:55591837-55591859 AGGGGGGATTCGAGGGCAGGGGG + Exonic
1168464982 19:56594989-56595011 AGGAGGGACAGGAGGGAAGGGGG - Intergenic
1168636410 19:58000571-58000593 AGGTGGGGCTTTAGGGCAGGTGG - Intronic
924986714 2:277709-277731 AGGTAGCACTGGGGAGCAGAGGG - Exonic
925073222 2:987739-987761 AGAGAGGCCTGGAGGACAGGAGG + Intronic
925265455 2:2563537-2563559 AGGTGAGATAGGAGGGCAGGTGG + Intergenic
925265476 2:2563631-2563653 AGGTGAGACAGGTGGGCAGGTGG + Intergenic
925356687 2:3246818-3246840 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
926106488 2:10155434-10155456 AGGGAGGAGTGGAGGGGATGTGG + Intronic
927192081 2:20523892-20523914 AGTTAGGCCTGGAAGGGAGGAGG - Intergenic
927260861 2:21088447-21088469 AGGTAGGACTAGACAGGAGGTGG - Intergenic
927350370 2:22105523-22105545 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
927821124 2:26266060-26266082 AGATAGGACTGGGAGGTAGGGGG - Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928164794 2:28962812-28962834 AGGGAGGAAAGGAGGGAAGGAGG - Intronic
928201530 2:29250516-29250538 TGGTAAGACTGGAGGGCTGGTGG - Intronic
928308846 2:30193506-30193528 AGGCAGGGCTGGAGACCAGGAGG - Intergenic
928387673 2:30884019-30884041 AGGGAGGTATGCAGGGCAGGTGG + Intergenic
928491464 2:31788210-31788232 AGGGAGGAATGGAGGGAGGGAGG + Intergenic
929411811 2:41705162-41705184 AAGCAGGAGTGGTGGGCAGGAGG - Intergenic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
929624295 2:43390529-43390551 AGATAGGAGAGGAGGGCAGTTGG - Intronic
930356481 2:50327618-50327640 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
930406269 2:50960334-50960356 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
930704912 2:54495184-54495206 AGGTTGGTCTGGAGGACAGCAGG + Intronic
931484570 2:62677075-62677097 AGGTAGAGCTGGGGGGCAAGGGG + Intronic
931640092 2:64374398-64374420 AGGTAGGACAGGTATGCAGGAGG - Intergenic
931909176 2:66876334-66876356 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
932437020 2:71707946-71707968 AGTGAGGGGTGGAGGGCAGGTGG - Intergenic
932575994 2:72962782-72962804 GGGAAGGACTGGAAGACAGGTGG - Intronic
932580690 2:72991105-72991127 AGGCAGGGCTGGAGAGCAGCGGG + Intronic
932595793 2:73092830-73092852 AGGTGGGGCTGGAAGGGAGGTGG - Intronic
932766657 2:74474809-74474831 AGGCAGGAGTGGAAGGTAGGTGG + Intronic
933027323 2:77276371-77276393 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
933259391 2:80115075-80115097 AGGTAGTACTGGATGTCTGGGGG + Intronic
933654001 2:84872525-84872547 AGGAAGGACTAGAGGGAGGGAGG + Intronic
933794082 2:85906197-85906219 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
933837995 2:86261200-86261222 AGGAAAGGCTGGATGGCAGGAGG + Intronic
933971687 2:87474738-87474760 AGGGAGCACTGGAGGTCAGGGGG + Intergenic
934249410 2:90336350-90336372 AGGAAGAAAAGGAGGGCAGGAGG - Intergenic
934260169 2:91467116-91467138 AGGAAGAAAAGGAGGGCAGGAGG + Intergenic
934302050 2:91782208-91782230 AGGTAGAAGTTGAGGCCAGGAGG + Intergenic
934851148 2:97702098-97702120 AGGCAGGACTGAAGGGCTGTGGG - Intergenic
935118752 2:100161255-100161277 AGGTAGGTCCGGAGGGCCAGAGG + Intergenic
935173702 2:100629722-100629744 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
935634300 2:105238016-105238038 AGGCAGGAATGGAGGGAGGGAGG + Intergenic
935976877 2:108586909-108586931 AGGTGGGAGTGGAAGGCAGATGG - Intronic
936048100 2:109202244-109202266 AGGCAGCACTGGAGGCAAGGTGG - Intronic
936322042 2:111475461-111475483 AGGGAGCACTGGAGGTCAGGGGG - Intergenic
936616890 2:114057193-114057215 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
937072297 2:119073417-119073439 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937421543 2:121760407-121760429 AGGTAGGACAGTAGAACAGGTGG + Intronic
937850937 2:126635367-126635389 AGGGAGAGCTGGAGGGCAAGAGG + Intergenic
937964167 2:127488585-127488607 AGGATGGATTGGAGGGCAGTGGG - Intronic
938992370 2:136642813-136642835 AGGTGGAACTGGAGGGCTGAGGG - Intergenic
939733915 2:145819528-145819550 AGGGAGGAGTGAAGGGAAGGAGG - Intergenic
939738492 2:145879260-145879282 AGGGAGGATGGGAGGGCAGATGG + Intergenic
939825927 2:147015522-147015544 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
940492229 2:154377427-154377449 AGGTAGGAAGGGAGGGAGGGAGG + Intronic
940951968 2:159685876-159685898 AGGAAGGAGTTGAGGTCAGGGGG - Intergenic
941222038 2:162794220-162794242 AGGAAGGAAGGAAGGGCAGGAGG + Intronic
941336054 2:164245112-164245134 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
942874352 2:180776113-180776135 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
944206499 2:197163651-197163673 AGGGAGGACTGGGGAGCAGAAGG + Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
945058320 2:205887334-205887356 GGGTAGGAATGGCAGGCAGGTGG - Intergenic
945269107 2:207921038-207921060 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
945819605 2:214647799-214647821 AGGTAGGAGAGGAGGCCATGAGG - Intergenic
946159934 2:217829919-217829941 AGGCAGGAAAGAAGGGCAGGTGG + Intronic
946524817 2:220507271-220507293 AGGAAGGGCTGGAGGGACGGAGG - Intergenic
947077684 2:226363836-226363858 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
947077694 2:226363860-226363882 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
947077761 2:226364022-226364044 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
947228439 2:227862020-227862042 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
947629907 2:231645392-231645414 AGGAAGGACAGGAGGGAGGGAGG - Intergenic
948080327 2:235200334-235200356 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
948179316 2:235967097-235967119 AGGTGGCACTGGAGAGGAGGGGG - Intronic
948368894 2:237475200-237475222 GGGAAGGGCTGGAGGGCCGGGGG + Intergenic
948668220 2:239549555-239549577 AGGGAGGTCTGGAAGGCTGGAGG - Intergenic
948695156 2:239729550-239729572 AGGTAGGACTGGAAAGGAGGTGG - Intergenic
948803526 2:240443357-240443379 AGGGAGGCCTGGGGGCCAGGAGG + Intronic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948865141 2:240771396-240771418 GGGCAGGCCTGGGGGGCAGGCGG - Intronic
948922040 2:241070381-241070403 AGGAAGGACTCATGGGCAGGTGG + Intronic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1168893677 20:1309704-1309726 GGGTAGGACTGTGGGGCAGTGGG - Intergenic
1169075491 20:2757455-2757477 AGGGAGGGCGGGAGGGCAAGGGG + Intronic
1169339105 20:4782643-4782665 AGGTATGAATCGGGGGCAGGAGG + Exonic
1170301685 20:14890994-14891016 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
1170522091 20:17197182-17197204 AGGGAGGGCAGGAGGGGAGGAGG + Intergenic
1170561600 20:17563357-17563379 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
1170613165 20:17930089-17930111 TGGGAGGTCAGGAGGGCAGGTGG - Intergenic
1170907522 20:20529088-20529110 AGGCAGGAGAGGAGGGCAGTGGG + Intronic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1172027326 20:31957399-31957421 TGGTAGGACAGGAAGGCAGGTGG + Intergenic
1172636309 20:36412262-36412284 AGCTCTGACTGCAGGGCAGGCGG - Intronic
1172706642 20:36887073-36887095 AGGCAGCACTGAAGAGCAGGCGG + Intronic
1173024243 20:39293245-39293267 AGGTAAGATTTGGGGGCAGGTGG + Intergenic
1173164506 20:40677176-40677198 GGGTGGGACTGCAGGGGAGGGGG - Intergenic
1173305241 20:41841362-41841384 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1173575436 20:44110349-44110371 AGGAAGCACAGGAGGGGAGGTGG - Intergenic
1173652938 20:44678782-44678804 GGGTTGGCCTGGGGGGCAGGCGG + Intergenic
1173662722 20:44745529-44745551 AGGGAGGAAGGGAGGGGAGGGGG + Intergenic
1174482187 20:50839012-50839034 AGGTAGGGCTAGATGGCAGGAGG + Intronic
1174724311 20:52845330-52845352 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175182122 20:57156174-57156196 ACGTAGGACTGGAGAGTAGCTGG + Intergenic
1175390594 20:58624920-58624942 CGGCAGGGCTGGAGAGCAGGGGG + Intergenic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1175479993 20:59304007-59304029 AGGCAGGAAGGGAGGGAAGGAGG - Intronic
1175586275 20:60142967-60142989 AGGTGAGACTGGAAGGCTGGAGG + Intergenic
1175984011 20:62755280-62755302 AGGAATGAATGGAGGGAAGGAGG - Intronic
1176020769 20:62961405-62961427 AGGGAGGACTGAGGGGCACGGGG - Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176093387 20:63328817-63328839 AAGGAGGACAGGAGGGCGGGAGG - Intronic
1176388234 21:6150383-6150405 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1177575472 21:22949609-22949631 TGGTAGCAATGAAGGGCAGGGGG - Intergenic
1177775403 21:25561426-25561448 AGATGGGAGTGGAGGGCAGGGGG + Intergenic
1178247617 21:30968978-30969000 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178307619 21:31503542-31503564 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1178741592 21:35206779-35206801 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1178887892 21:36497176-36497198 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1179061441 21:37983114-37983136 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
1179525515 21:41973671-41973693 AGGTAGGTCAGGAGGACACGAGG - Intergenic
1179564725 21:42240095-42240117 AGGCAGGAGAGGAGGGCAGGTGG + Intronic
1179609961 21:42543834-42543856 AGGGAGGACAGGAGGACGGGAGG - Intronic
1179735238 21:43387865-43387887 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1179847681 21:44120322-44120344 AGGCAGGACAGGAGGGGCGGGGG - Intronic
1180455748 22:15511703-15511725 AGCTGGGACTGGATTGCAGGTGG + Intergenic
1180606582 22:17063460-17063482 TGGTAAGGCTGCAGGGCAGGCGG + Intergenic
1180764649 22:18339168-18339190 AGGTAGAAGTTGAGGTCAGGAGG + Intergenic
1180814381 22:18780515-18780537 AGGTAGAAGTTGAGGTCAGGAGG - Intergenic
1181036363 22:20171632-20171654 AGGGAGGGCTGGAGGGGAGTGGG + Intergenic
1181200567 22:21214852-21214874 AGGTAGAAGTTGAGGTCAGGGGG - Intronic
1181282672 22:21730907-21730929 AGGTAGTACTTGAGCACAGGTGG - Intronic
1181312404 22:21952503-21952525 GGGCAGAACTGGGGGGCAGGCGG - Intronic
1181352334 22:22267816-22267838 AGACAGGACTGGAGAGGAGGAGG + Intergenic
1181539138 22:23564080-23564102 AGGCAGGGCGGGAGGGCTGGAGG - Intergenic
1181701169 22:24622125-24622147 AGGTAGAAGTTGAGGCCAGGAGG + Intronic
1181876801 22:25946018-25946040 AGGTGGGAGGGGAGGGGAGGTGG - Intronic
1181876810 22:25946035-25946057 AGGTGGGAGGGGAGGGGAGGTGG - Intronic
1181969480 22:26679486-26679508 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1182085137 22:27556144-27556166 AGGAAGGACTGAAGGGCCCGGGG + Intergenic
1182126081 22:27816815-27816837 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1182148198 22:28010501-28010523 AGGAAGAGGTGGAGGGCAGGAGG - Intronic
1182246503 22:28962362-28962384 AGGTAGGCTTGGAGTGCAGAGGG + Intronic
1182351908 22:29704266-29704288 AGGTGGGAGGGGAGGGGAGGGGG - Intergenic
1183108258 22:35629974-35629996 ATGTAGGCTTGGAGGGCATGGGG + Intronic
1183258340 22:36777583-36777605 AGGTTGGCCTGGAGGGGAGCCGG - Intergenic
1183467417 22:37986691-37986713 AGGTGGGCCTGCAGGGCGGGTGG + Intronic
1183698788 22:39438142-39438164 AGGAAGGAAGGGAGGGAAGGGGG - Intergenic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1184119028 22:42438424-42438446 AGGGAGGGAGGGAGGGCAGGTGG - Intergenic
1184293531 22:43510209-43510231 AGGGAGGTGTGCAGGGCAGGGGG + Intergenic
1184515617 22:44960264-44960286 AGGTAGCTGTGGAGGGAAGGGGG - Intronic
1184638402 22:45854819-45854841 AGGTAGCACTGCAGAGCATGGGG + Intergenic
1184823766 22:46933145-46933167 AGATAGGAATGGAAGGCAGATGG - Intronic
1184924484 22:47627314-47627336 AGGTACTTCTGGAAGGCAGGTGG - Intergenic
1185037018 22:48484709-48484731 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1185085773 22:48740257-48740279 TGGGAGGACGGCAGGGCAGGAGG + Intronic
1185275472 22:49948752-49948774 GGGCAGGGCTGGAGGGCGGGGGG - Intergenic
1185415337 22:50706227-50706249 AGGTGGTACGGGAGGGCAGGCGG + Intergenic
1203237697 22_KI270732v1_random:21802-21824 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1203264480 22_KI270734v1_random:6203-6225 AGGTAGAAGTTGAGGTCAGGAGG - Intergenic
949401074 3:3665877-3665899 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
949608969 3:5684186-5684208 AGGTGGGGTGGGAGGGCAGGTGG + Intergenic
949788953 3:7771940-7771962 TGGTTGGGCTGGAGAGCAGGGGG - Intergenic
950315439 3:11997965-11997987 AGGCAGGACTGAAGGGTCGGGGG + Intergenic
950658628 3:14452850-14452872 AGGTCGCCCTGGAGGACAGGCGG + Intronic
950661518 3:14469653-14469675 AGGGTGGGCTGGATGGCAGGAGG - Intronic
951162422 3:19441018-19441040 AGGGAAGACTGGCAGGCAGGAGG + Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951829369 3:26907306-26907328 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
952145334 3:30525986-30526008 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
952334545 3:32392677-32392699 AGGGGGCTCTGGAGGGCAGGGGG + Intronic
952373988 3:32749900-32749922 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952814900 3:37438697-37438719 GGGAAGGAAAGGAGGGCAGGTGG + Intergenic
952952907 3:38538892-38538914 AGGCAGGGCAGGAGGGCTGGTGG - Intronic
953687251 3:45087621-45087643 AGGAAGGACTGGCTTGCAGGAGG - Intronic
953783493 3:45893108-45893130 TGGGAGGGCAGGAGGGCAGGTGG - Intronic
954104612 3:48403276-48403298 AGTTGGGTCTGTAGGGCAGGGGG - Intergenic
957220849 3:77380692-77380714 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
958656907 3:97014325-97014347 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
958933185 3:100229351-100229373 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
960008209 3:112803870-112803892 ATGTACTCCTGGAGGGCAGGAGG - Intronic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
960935001 3:122893771-122893793 AGGAAGGGCTGGAGGGAGGGAGG + Intergenic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961381367 3:126498349-126498371 AGGCAGGGATGGAGGGCTGGGGG - Intronic
962040723 3:131705038-131705060 AGGTAGGAAGGGAGGGAGGGAGG - Intronic
962368502 3:134801920-134801942 AGGGAGGCCTGGAGGGCAGTGGG + Intronic
962619886 3:137167898-137167920 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
962803829 3:138913169-138913191 AGGGAGGACTGGAGGGGACTTGG - Intergenic
963853018 3:150226478-150226500 AGGAAGGAATGGAGGGGAAGGGG + Intergenic
964236454 3:154535994-154536016 AGGAAGGAAAGGAGGGGAGGAGG - Intergenic
964969488 3:162542189-162542211 AGGTAGGAATGGATGGAGGGAGG - Intergenic
965125700 3:164626712-164626734 AGATAGGATTGGAGGACAGAAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965498944 3:169433583-169433605 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
966204772 3:177394848-177394870 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
966777980 3:183559623-183559645 AGACAGGACAGGAGGGTAGGAGG + Intergenic
967104197 3:186242262-186242284 GGGCAGGGCTGGAGGGCAGGAGG - Intronic
967290868 3:187918867-187918889 AGGGAGGAGTGGGGGGCAGTTGG + Intergenic
967350723 3:188511195-188511217 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
968978511 4:3834410-3834432 GGGTGGGACGGGAAGGCAGGAGG - Intergenic
969929123 4:10613210-10613232 TGGAAGGACTGTAGAGCAGGTGG + Intronic
970434713 4:16022203-16022225 AGCCAGGACAGGAAGGCAGGAGG + Intronic
970670197 4:18387945-18387967 AGGAATGAGTGGGGGGCAGGAGG - Intergenic
971152040 4:24043623-24043645 GGGTTGGACTGGAGAGCAGTGGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972316961 4:37935767-37935789 AGGTAAGACTGGAGGGGAAACGG - Intronic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
972351942 4:38244228-38244250 AGGGAGGGCAGGAGGGCAGGAGG - Intergenic
973157667 4:46977214-46977236 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
973786192 4:54334965-54334987 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
974374830 4:61062297-61062319 AGGAAGGACGGGAGGGAGGGAGG + Intergenic
974757255 4:66225673-66225695 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
975373581 4:73615844-73615866 AGGCAGGAATGCAGAGCAGGGGG - Intronic
975544454 4:75547073-75547095 GGGAAGGACTTGGGGGCAGGAGG - Intronic
975850991 4:78572501-78572523 AGGTTAAAATGGAGGGCAGGGGG + Intronic
975852716 4:78588773-78588795 AGAGGGGACTGGAAGGCAGGAGG - Intronic
976245513 4:83002438-83002460 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
976476688 4:85492091-85492113 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
976512537 4:85928319-85928341 AGGAAGGACGGGAGGAAAGGAGG - Intronic
976810248 4:89092416-89092438 AGGAAGGACGGGAGGGAGGGAGG + Intronic
977997989 4:103517676-103517698 AGGCAGGAGAGGAGGGAAGGAGG - Intergenic
979506425 4:121502669-121502691 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
979506439 4:121502701-121502723 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
979506451 4:121502729-121502751 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
980714225 4:136611162-136611184 AGGGAGGAATGGATGGCAGAAGG - Intergenic
980743546 4:136984504-136984526 AGGTAAGAGTGGGGTGCAGGAGG - Intergenic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
980868936 4:138587883-138587905 AGGTAGGACAGCAGAGCATGTGG + Intergenic
981183229 4:141770032-141770054 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
981676667 4:147350816-147350838 AGGAAGGGCAGGAAGGCAGGAGG + Intergenic
981736954 4:147963272-147963294 AGGCAGGACTGAGGGGCAAGGGG - Intronic
982558625 4:156900878-156900900 AGGGAGGAAAGGAGGGAAGGAGG + Intronic
982931039 4:161407750-161407772 AGGGAGGGCTGTAGGGTAGGTGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985099706 4:186446731-186446753 AGGGAGGGAGGGAGGGCAGGCGG - Intronic
985485653 5:146733-146755 AGGGAGGACTGTAGGGCCAGGGG - Intronic
985629971 5:1009096-1009118 CGGTAGGGCGGGAGGGCGGGCGG + Intronic
985797405 5:1973164-1973186 AGGAAGGACAGGAAGGAAGGAGG - Intergenic
985817114 5:2135321-2135343 AGATAGTGCTGGAGGGAAGGGGG + Intergenic
985866676 5:2519552-2519574 AGGGAGGAGAGGAGGGCAGAGGG - Intergenic
985958046 5:3278994-3279016 AGGAAGGAATGGAGGGATGGTGG - Intergenic
986623732 5:9703798-9703820 AGGCAGGACTGGATGTCAGAAGG + Intronic
986901002 5:12433470-12433492 AGGAAGGAATGGAGGGGGGGAGG - Intergenic
987330417 5:16852112-16852134 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
987335853 5:16896981-16897003 AGGGAGGACGGGAAGGCAGAAGG + Intronic
988246441 5:28688721-28688743 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
988251557 5:28764791-28764813 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
988394078 5:30674308-30674330 AGGGAGGAATGGAGGGAGGGAGG + Intergenic
988784488 5:34553493-34553515 AGCTAGGACTGGAGCCCATGTGG - Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
989007057 5:36826801-36826823 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
989097301 5:37793189-37793211 AGGTTAGACTTGAGGGCAGAAGG - Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
989981929 5:50655727-50655749 AGGAAGGAAGGGAGGGGAGGAGG - Intergenic
990000183 5:50883365-50883387 AGGTTGGGGTGGAGGGTAGGGGG + Intergenic
990317853 5:54601065-54601087 AGGGAGGACGGGAGGGATGGAGG - Intergenic
991418476 5:66416323-66416345 GGGTAAGACTGGAGGGTGGGAGG - Intergenic
991562730 5:67971615-67971637 AGGTAGTAATGAGGGGCAGGAGG - Intergenic
992186434 5:74249021-74249043 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
992705438 5:79386921-79386943 AGGAAGGAAGGGAGGGGAGGAGG - Intronic
992865891 5:80956862-80956884 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
993536970 5:89098578-89098600 AGGAAGGAATGAAGGGAAGGAGG - Intergenic
993536979 5:89098630-89098652 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
993735267 5:91468899-91468921 AGGTAAGACTGAAAGGCAGTTGG + Intergenic
994353919 5:98774205-98774227 AGGTAGGACGGGAGCGCGCGAGG + Exonic
994596412 5:101843259-101843281 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
995038041 5:107557274-107557296 AGGGAAGCCTGGAGGTCAGGTGG + Intronic
995038058 5:107557375-107557397 AGGGAAGCCTGGAGGTCAGGTGG + Intronic
995396200 5:111689651-111689673 AGGTATGACTGTAAAGCAGGAGG - Intronic
995876592 5:116796726-116796748 ATGTAGGAGCGGAGGGCAAGTGG - Intergenic
996035735 5:118756756-118756778 AGATAGGAAGGGAGGGTAGGAGG - Intergenic
996365566 5:122696924-122696946 AGGAAGGAAGGGAGGGGAGGAGG + Intergenic
997411912 5:133697039-133697061 AGGAATGAGTGGAGGGTAGGGGG + Intergenic
998039587 5:138943950-138943972 TGGTAGGACAGGAGGGGAGAGGG - Intergenic
999423555 5:151466182-151466204 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
999689334 5:154133131-154133153 AGGGAGGCCTGGAGGCCAGAAGG + Intronic
1000092897 5:157945788-157945810 AGGCAGGAAGGGAGGGAAGGAGG - Intergenic
1000373853 5:160561257-160561279 AGATGAGGCTGGAGGGCAGGTGG - Intergenic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1000782015 5:165494039-165494061 AGGTAGGAAGAGAGGGTAGGAGG - Intergenic
1001235474 5:170025779-170025801 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1001313794 5:170629049-170629071 AGGTGGGAGTGGAGGGCGGGAGG - Intronic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002447154 5:179296601-179296623 AGGAAGGACCGCAAGGCAGGTGG + Intronic
1002488187 5:179553943-179553965 AGGTAGGACAGGAGCAGAGGTGG + Intronic
1002917665 6:1542038-1542060 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1002917714 6:1542182-1542204 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1003007084 6:2392203-2392225 ATGCAGGAAAGGAGGGCAGGAGG + Intergenic
1003133690 6:3416892-3416914 AGGCAGGATTGGAGGGGATGGGG + Intronic
1003194293 6:3901472-3901494 AGGGAGGACTTGAGGACAGTGGG + Intergenic
1003254599 6:4463858-4463880 AGGAAGGGATGGAGGGCAGCTGG + Intergenic
1003414822 6:5898390-5898412 AGGAAGGGAGGGAGGGCAGGAGG - Intergenic
1003504956 6:6733430-6733452 AGGTGGGACTGGTTGGCAGTGGG - Intergenic
1003558472 6:7161575-7161597 AGATAGGAAAGGAGGGCATGGGG - Intronic
1003598894 6:7500358-7500380 TGGGAGCACTGGAGCGCAGGGGG + Intergenic
1004035487 6:11919004-11919026 AGGCAGGAGTGGGGTGCAGGGGG + Intergenic
1004182089 6:13389989-13390011 AGGTAGCAAAGGAGGGAAGGTGG - Intronic
1004341835 6:14814494-14814516 AGGGAGGGCTGGAGGGAGGGAGG + Intergenic
1005018948 6:21399547-21399569 AGGGAGGAGGGGAGGGGAGGGGG + Intergenic
1005264764 6:24100430-24100452 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
1005277753 6:24238159-24238181 AGGGAGGAATGGAGGGAGGGAGG + Intronic
1005365345 6:25070486-25070508 AGGTAGGAAGGGAGGGAGGGAGG + Intergenic
1006050997 6:31344226-31344248 AGGTGGGCCTGGAGGGAGGGAGG + Intronic
1006117066 6:31781116-31781138 AGGTAGACCTGCAGAGCAGGTGG + Exonic
1006338325 6:33432287-33432309 AGTTGGGGCTGGAGGGGAGGGGG - Intronic
1006451158 6:34106521-34106543 TGGTAGGAAGGGAGGCCAGGGGG - Intronic
1006503572 6:34473590-34473612 AGGCAGGGCTGGAGGGCTGGGGG + Intronic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1006898719 6:37486566-37486588 TGGTGGGGCTGCAGGGCAGGGGG - Intronic
1007741064 6:44009687-44009709 AGGTAGGAAGGGAGGGAGGGCGG + Intergenic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1008315143 6:50030519-50030541 GGGAGGGACTGGCGGGCAGGCGG - Intergenic
1009617139 6:66024257-66024279 AGGTAGGCCAGAAGGGCTGGAGG + Intergenic
1009828899 6:68904072-68904094 AGGGAGGGCTGGAGGGCGGGAGG + Intronic
1010533521 6:76995222-76995244 AGGTAGGAAGGGAAGGCAGATGG - Intergenic
1011222226 6:85066896-85066918 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1011695734 6:89911187-89911209 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1011744760 6:90398821-90398843 AGCTAGCACTGGAGTGCAGGTGG - Intergenic
1012287868 6:97415195-97415217 AGTTAGGGCTGGAGGGGTGGTGG - Intergenic
1012575311 6:100789110-100789132 AGGAAGGAAGGGAGGACAGGAGG + Intronic
1012848930 6:104424193-104424215 AGGAAGGAAGGGCGGGCAGGAGG + Intergenic
1012848955 6:104424277-104424299 AGGAAGGAAGGGCGGGCAGGAGG + Intergenic
1013039945 6:106423662-106423684 ACTGAGGACTGGAGGGCTGGAGG - Intergenic
1013137903 6:107300099-107300121 ATGTAGGCCTGAAGTGCAGGGGG - Intronic
1013536911 6:111071385-111071407 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1013598371 6:111681607-111681629 AGGTGGGACTGGAGCTGAGGAGG - Intronic
1014134390 6:117871277-117871299 CGGAAGGAGTGGGGGGCAGGTGG + Intergenic
1014190806 6:118494564-118494586 AGGCGGGACAGGATGGCAGGAGG - Intronic
1014490215 6:122053382-122053404 AGGTGGGGCTGCGGGGCAGGAGG + Intergenic
1015214310 6:130732228-130732250 AGCTTGGAATGGAGTGCAGGTGG - Intergenic
1016244842 6:141969196-141969218 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1016534224 6:145092672-145092694 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1016681717 6:146837845-146837867 AGGAAGGAAGGGAGGGCGGGAGG + Intergenic
1016686283 6:146885980-146886002 AGGGAGGAGAGGTGGGCAGGAGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1018061613 6:160094055-160094077 AGGTAGGGCTGGTGGACAGGAGG - Intronic
1018613989 6:165668766-165668788 AGGTAGGAAGGGAGGGAGGGAGG + Intronic
1018759398 6:166878089-166878111 AGGTAGGACTGTATGCCAAGTGG + Intronic
1018911017 6:168101061-168101083 GTGTTGGACTGGAGGGGAGGTGG + Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019273968 7:166263-166285 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1019937715 7:4267257-4267279 AGGAAGGAAGGGAGGGAAGGAGG - Exonic
1021530096 7:21634657-21634679 AGTTGAGAGTGGAGGGCAGGAGG + Intronic
1021725882 7:23547872-23547894 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1022702608 7:32775835-32775857 AGGTGGGTCTGTAAGGCAGGAGG - Intergenic
1022797300 7:33742385-33742407 AGGCAGGACTGGAGAGTAAGGGG + Intergenic
1022850725 7:34258998-34259020 AGGGAGGACTGGAAGTCAGAAGG + Intergenic
1023352592 7:39335170-39335192 AGGTATGAATGGAAGGGAGGTGG - Intronic
1024042873 7:45568589-45568611 AGGGAGAACTGGTTGGCAGGAGG - Intergenic
1024300344 7:47882688-47882710 AGGGAGGGAGGGAGGGCAGGAGG + Intronic
1025093423 7:56081017-56081039 AGGGAGGGCTAGGGGGCAGGTGG - Exonic
1025216436 7:57060547-57060569 AGGGAGGGCTGGGGGCCAGGTGG - Intergenic
1025474792 7:60905773-60905795 AGGAAGAAATGGAGGGCTGGAGG + Intergenic
1025512211 7:61584101-61584123 AGGAAGAAATGGAGGGCTGGAGG - Intergenic
1025627186 7:63232998-63233020 AGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1025654946 7:63510183-63510205 AGGGAGGGCTGGGGGGCAGGTGG + Intergenic
1026007419 7:66610999-66611021 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1026403774 7:70043536-70043558 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1026662827 7:72317182-72317204 AGGCAGGAGGGGAGGGAAGGAGG + Intronic
1026846719 7:73702809-73702831 GGGCTGGAGTGGAGGGCAGGGGG + Intronic
1027565647 7:79789967-79789989 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1028364839 7:90015876-90015898 AGGAAGGGCAGGAGGGCCGGGGG + Intergenic
1028519332 7:91712344-91712366 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1029139537 7:98400549-98400571 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
1029177062 7:98672362-98672384 AGGTAGCACTGGAGGGATGGTGG - Intergenic
1029524296 7:101085698-101085720 AGGCAGGAGGAGAGGGCAGGAGG + Intronic
1029576996 7:101410077-101410099 AGGTTGGTTTGGTGGGCAGGGGG + Intronic
1029607878 7:101609824-101609846 AGGGAGGAATGGAGGGAGGGAGG - Intergenic
1029813800 7:103074572-103074594 GGGGAGGAGTGGAGGGAAGGCGG - Intronic
1030011321 7:105170774-105170796 AGGAAGGACGGGAGGGAGGGAGG + Intronic
1030217501 7:107060603-107060625 AGGGAGGGCGGGAGGGAAGGAGG - Intronic
1030629932 7:111884717-111884739 AGGTAGGGAGGAAGGGCAGGTGG + Intronic
1030708024 7:112715288-112715310 AGGTAAGAATGGAGTTCAGGAGG + Intergenic
1030925021 7:115441067-115441089 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1031049931 7:116934785-116934807 AGGGAGGAAGGGAGGACAGGAGG - Intergenic
1031357457 7:120804758-120804780 AGGTCCGACTGGAGGACAGTGGG + Intronic
1031970126 7:128058827-128058849 AGGAAGGAGGGGAGGGAAGGAGG - Intronic
1032231644 7:130079845-130079867 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1032231673 7:130079933-130079955 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1032262152 7:130346625-130346647 AGGGAGGACTGGCTGGGAGGAGG + Intronic
1032530862 7:132618543-132618565 AGGCAGAACTGGAGGGAAGCAGG - Intronic
1032833030 7:135648002-135648024 AGGGAGGACAGGAGGGTAGGTGG - Intronic
1033437275 7:141344548-141344570 AGGGAGGAATGGAGGGAGGGAGG - Intronic
1033587963 7:142788170-142788192 AGGCAGGAGTGGAAGGCAGCAGG + Intergenic
1033624685 7:143097316-143097338 GGGTAAGGCTGTAGGGCAGGGGG - Intergenic
1034278995 7:149838634-149838656 AGGTAGGACTGGAAGGCCCGGGG + Exonic
1034310239 7:150081191-150081213 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1034411725 7:150945601-150945623 AGGATGGACGGGAGGACAGGAGG + Intronic
1034467033 7:151235855-151235877 GGGGAGGTGTGGAGGGCAGGGGG - Intronic
1034487570 7:151375591-151375613 AGGAAGGGATGGAGAGCAGGTGG - Intronic
1034584204 7:152074853-152074875 AGGTATGACAGGAAGGCTGGAGG + Intronic
1034704438 7:153127818-153127840 GGGTAAGACTGGAGGGCAGGAGG + Intergenic
1034796602 7:154019450-154019472 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1034967313 7:155399255-155399277 AGGCAGGGCTGGAGAACAGGAGG - Intergenic
1035031667 7:155864991-155865013 AGCTAAGACTGGAGGTCATGAGG + Intergenic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035574587 8:696584-696606 AGGAAGGAGTGGAGGGTAAGAGG - Intronic
1035911136 8:3567496-3567518 AGGAAGGAAGGGAGGGGAGGGGG + Intronic
1036071262 8:5442073-5442095 AGGCAGGAATGGAGGTCATGAGG + Intergenic
1036662078 8:10715199-10715221 AGGCAGGTCTGTAGGGAAGGTGG + Intergenic
1037330078 8:17735658-17735680 AGGGAGAACTGGAGGAGAGGCGG - Intronic
1037344436 8:17883930-17883952 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1038157679 8:25006069-25006091 AGGGAGGGAGGGAGGGCAGGAGG + Intergenic
1038157682 8:25006077-25006099 AGGGAGGGCAGGAGGGAAGGAGG + Intergenic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1038900771 8:31841227-31841249 AGGTAGGAATGGGGGGTGGGTGG + Intronic
1039471001 8:37813903-37813925 AGGCTGGACTGGAAGGGAGGGGG - Intronic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039617758 8:38969815-38969837 AGGGAGGACTTGAGAGAAGGAGG + Exonic
1039644189 8:39262616-39262638 AGGGAGGGATGGAGGGAAGGAGG - Intronic
1039929285 8:41969523-41969545 AGCTAGGACTAGAGGGGTGGTGG - Intronic
1040399563 8:47034626-47034648 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1040488310 8:47895624-47895646 GGGAAGGGCTGGAGGGCAGTGGG - Intronic
1040625858 8:49149347-49149369 AGCCTGGGCTGGAGGGCAGGGGG + Intergenic
1041238053 8:55824592-55824614 AGCTGGGCCTGGAGGGCAAGTGG + Exonic
1041411726 8:57563559-57563581 AGGAAGGAAGGAAGGGCAGGCGG + Intergenic
1041749585 8:61245799-61245821 AGGGATGGCTGGAGGGCAGGAGG + Intronic
1041802325 8:61813512-61813534 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1041953594 8:63533072-63533094 AGGGAGGAAGGGAGGGAAGGAGG - Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042705935 8:71665633-71665655 AGGGAGGAATGGAGGGTAGAAGG - Intergenic
1042938327 8:74082771-74082793 AAATATGACTGGAGGGCAGAAGG + Intergenic
1043322698 8:79009472-79009494 AGGGAGGGATGGAGGGCAGGAGG - Intergenic
1043405891 8:79932506-79932528 AGGTCAGACAGGAAGGCAGGAGG + Intronic
1043941862 8:86205161-86205183 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1045251345 8:100485612-100485634 TGGTAGGAATGGAGGTGAGGAGG + Intergenic
1045662555 8:104453067-104453089 AGGTAGGACATGAGGGCATCCGG - Intronic
1047061845 8:121235748-121235770 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048193123 8:132308369-132308391 AGGGATGGATGGAGGGCAGGGGG + Intronic
1048315091 8:133355916-133355938 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
1048522157 8:135166431-135166453 AGGAAGGAATGGAGGGAGGGAGG - Intergenic
1048551083 8:135433981-135434003 AGGTAGGATTTGAATGCAGGTGG + Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049094105 8:140538293-140538315 AGGGAGGACCGGAAGGCAGAGGG - Intronic
1049174456 8:141182976-141182998 AGGCAGCACTGCAGGGCGGGGGG + Intronic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049361164 8:142213115-142213137 AGGAAGGATTGGAGAGAAGGTGG - Intronic
1049469797 8:142770203-142770225 AGGAAGGTCTGGTGGGAAGGAGG + Intronic
1049700102 8:144006958-144006980 AGGGTGGAATGGAGAGCAGGTGG - Intronic
1050356575 9:4789113-4789135 AGGAAGGACGGGAGGGAGGGAGG + Intergenic
1051245788 9:15109451-15109473 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1051873171 9:21762697-21762719 AGGGAGGACTGGAGGGAATCAGG + Intergenic
1052325426 9:27212558-27212580 AGGGAGCACTGGGGGACAGGAGG - Intronic
1052386260 9:27827139-27827161 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1052433973 9:28402582-28402604 AGGAAGGAAGGGAGGGAAGGAGG - Intronic
1053072692 9:35110557-35110579 GGGCAGGACTGCAGGGGAGGGGG + Exonic
1053173887 9:35908956-35908978 AGCTAGGAGTGGAGGGAGGGCGG + Intergenic
1053346802 9:37384211-37384233 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1053354251 9:37432972-37432994 AGACAGGAAGGGAGGGCAGGAGG - Intronic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055379863 9:75694569-75694591 AGGTAGGGATGGAGAGCATGAGG - Intergenic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056368225 9:85928014-85928036 AGGAAGGAAGGGAGGGAAGGAGG - Intergenic
1056588465 9:87944743-87944765 AGGTAGGCCCGTGGGGCAGGCGG + Intergenic
1057260528 9:93580484-93580506 AGGCAGGAGTGGAGGGCATGGGG - Intronic
1057559646 9:96117138-96117160 AGGTAGGACTAGGGGGCAGCGGG - Intergenic
1058767339 9:108194631-108194653 AGGCAGGACTGGAGGCAGGGAGG - Intergenic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059407138 9:114108329-114108351 AGGATGGACCGGGGGGCAGGGGG - Intergenic
1059460822 9:114428825-114428847 AGGTAGGAACCGAGGTCAGGGGG - Intronic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1059878352 9:118661039-118661061 AGGAGGGAAGGGAGGGCAGGAGG + Intergenic
1060230281 9:121820781-121820803 AGGCAGGACAGGTGGGAAGGTGG - Intergenic
1060716113 9:125930780-125930802 AGGATGGGCTGGAGGGCAGTAGG - Intronic
1060807586 9:126587444-126587466 AGGATGGACTGGAGCGTAGGTGG - Intergenic
1060840810 9:126791929-126791951 AGGGGAGACTGGAGGGAAGGAGG - Intergenic
1061016984 9:127986992-127987014 AGGGAGGGAGGGAGGGCAGGAGG + Intergenic
1061275276 9:129566610-129566632 AGGCAGGGCGGGAGGGCTGGAGG - Intergenic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061725875 9:132581775-132581797 GGGTACGGCTGGAGGGGAGGGGG - Intergenic
1061999329 9:134207884-134207906 AGGTAGGTAGGGAGGACAGGTGG - Intergenic
1062447172 9:136599859-136599881 AGGTGGCCCTGGAAGGCAGGCGG + Intergenic
1062494993 9:136827452-136827474 AGGCGGGACTGGAGGGGAGCCGG - Intronic
1062529335 9:136992992-136993014 AGGAAGGACGGGTGGGGAGGAGG + Intronic
1062698390 9:137886890-137886912 AGGAAGGACTGGAGAGCGTGAGG + Intronic
1185623420 X:1466895-1466917 AGGAAGGACGGGAGGGAGGGAGG - Intronic
1185954805 X:4477970-4477992 AGGGAGGAAGGGAGGGAAGGAGG + Intergenic
1186559675 X:10598132-10598154 AAGAAGCACTGGAAGGCAGGTGG - Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188242705 X:27809578-27809600 CGGTAGGACAGGAGGGGGGGTGG - Intronic
1188699193 X:33237188-33237210 AGGGAGGAAGGGAGGGAAGGAGG - Intronic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189588663 X:42488554-42488576 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1190055949 X:47181200-47181222 TGGGAGGCCTGAAGGGCAGGTGG - Exonic
1190128425 X:47725275-47725297 AGGGATGGCTGGAGGGCAGGTGG - Intergenic
1190248825 X:48707398-48707420 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1190739540 X:53280176-53280198 AGGGAGGACGGGAGGGGAAGGGG + Intronic
1190872285 X:54434318-54434340 AGGAAGGAAGGGAGGGCGGGAGG - Intergenic
1190935235 X:54993814-54993836 AGGTAGGAGTGGATGGCAAGGGG + Intronic
1191867778 X:65719491-65719513 AGGTAGGGCTAGCTGGCAGGGGG + Intronic
1192093161 X:68182408-68182430 AGGGAGGAAGGGAGGGAAGGAGG + Intronic
1192245970 X:69371769-69371791 AGGTATGACTGGAAGCTAGGAGG - Intergenic
1192531960 X:71895661-71895683 AGGGAGGAATGGAGGGAGGGAGG + Intergenic
1192644271 X:72888168-72888190 GGGGAGGGCTGGAGGGGAGGGGG - Intronic
1192657012 X:73003123-73003145 GGGGAGGGCGGGAGGGCAGGAGG - Intergenic
1192665108 X:73079878-73079900 GGGGAGGGCGGGAGGGCAGGAGG + Intergenic
1194766192 X:97846935-97846957 AGATAGGACGCGAGGGGAGGGGG - Intergenic
1195129579 X:101839829-101839851 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195176660 X:102320000-102320022 AGGCAGGAGTGGAAGGCAGAGGG + Intronic
1195182204 X:102367093-102367115 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195249850 X:103032319-103032341 ATGTAGGACTAGAGGGCTGGGGG + Intergenic
1195254926 X:103081610-103081632 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195263055 X:103152967-103152989 AGGTACTACTGCAGGGGAGGAGG - Intergenic
1195505629 X:105653514-105653536 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
1195658789 X:107358677-107358699 AGGGAGGACTGGAAGACTGGAGG + Intergenic
1195892729 X:109713041-109713063 AGGAAGGAAGGGAGGGAAGGAGG + Intronic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1196650063 X:118159329-118159351 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1196986980 X:121284607-121284629 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1197360084 X:125490941-125490963 AGGTAACTTTGGAGGGCAGGAGG + Intergenic
1197530351 X:127616623-127616645 AAGCAGAACTGGTGGGCAGGTGG - Intergenic
1198963501 X:142205416-142205438 AGGAAGGGTTGGAGGGCAGCTGG - Intergenic
1200145315 X:153923352-153923374 AGGTAGGGATGCTGGGCAGGCGG - Intronic
1200311855 X:155086344-155086366 AGGGAGGAAGCGAGGGCAGGCGG - Intronic
1201146007 Y:11066182-11066204 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1201146059 Y:11066373-11066395 AGGTAAGAAGGGAGGGAAGGAGG + Intergenic
1201146435 Y:11067547-11067569 AGGAAGGAAGGGAGGGAAGGAGG + Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201458953 Y:14201436-14201458 AGGAAGGAAAGGAGGGCTGGAGG + Intergenic
1201550406 Y:15211864-15211886 AGGAAGGAATGGAGGGAGGGAGG + Intergenic
1201610789 Y:15840661-15840683 AGGAAGGAGTTGAGGTCAGGAGG + Intergenic