ID: 1165864053

View in Genome Browser
Species Human (GRCh38)
Location 19:38925338-38925360
Sequence CTGTGGGGAAGGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1453
Summary {0: 1, 1: 1, 2: 9, 3: 155, 4: 1287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165864053_1165864063 21 Left 1165864053 19:38925338-38925360 CCCTTCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 9
3: 155
4: 1287
Right 1165864063 19:38925382-38925404 TCCCTGGTAGCCTGTAGTTCAGG 0: 1
1: 0
2: 1
3: 3
4: 165
1165864053_1165864069 30 Left 1165864053 19:38925338-38925360 CCCTTCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 9
3: 155
4: 1287
Right 1165864069 19:38925391-38925413 GCCTGTAGTTCAGGGGAAGTGGG 0: 1
1: 0
2: 4
3: 15
4: 158
1165864053_1165864068 29 Left 1165864053 19:38925338-38925360 CCCTTCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 9
3: 155
4: 1287
Right 1165864068 19:38925390-38925412 AGCCTGTAGTTCAGGGGAAGTGG 0: 1
1: 0
2: 1
3: 14
4: 227
1165864053_1165864065 22 Left 1165864053 19:38925338-38925360 CCCTTCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 9
3: 155
4: 1287
Right 1165864065 19:38925383-38925405 CCCTGGTAGCCTGTAGTTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 109
1165864053_1165864067 23 Left 1165864053 19:38925338-38925360 CCCTTCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 9
3: 155
4: 1287
Right 1165864067 19:38925384-38925406 CCTGGTAGCCTGTAGTTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 161
1165864053_1165864060 5 Left 1165864053 19:38925338-38925360 CCCTTCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 9
3: 155
4: 1287
Right 1165864060 19:38925366-38925388 TGACGCAGTTCACCCTTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165864053 Original CRISPR CTGTGGGGAAGGAGGAAGAA GGG (reversed) Intronic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900417852 1:2543268-2543290 CCGTGGTGAGGGAGGAGGAACGG + Intergenic
900607548 1:3530621-3530643 CTGTGGGGCTCCAGGAAGAACGG + Intronic
900685942 1:3947716-3947738 CCCTGGGGCAGGGGGAAGAAGGG - Intergenic
900878151 1:5360787-5360809 ATGAGAGGAAAGAGGAAGAATGG + Intergenic
901222971 1:7594362-7594384 CTGGGAGGAAGGAAAAAGAAAGG + Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
901293366 1:8141671-8141693 GGGTGGTGAAGCAGGAAGAATGG + Intergenic
901296820 1:8167229-8167251 CAGAGGGGGAGGAGGAACAATGG + Intergenic
901803610 1:11724042-11724064 CTTTGGGGAAGGAGCTTGAATGG - Exonic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902488673 1:16764850-16764872 TGGTGAGGAAGGAGGAAGAGAGG - Intronic
902879540 1:19362158-19362180 CTCTGGTCAAGGAGGTAGAAGGG + Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
902985072 1:20149976-20149998 GGGTGGAGAAGGAGGCAGAAGGG + Exonic
903033595 1:20480473-20480495 CTGTTGGGAAGCAGGGAGTATGG - Intergenic
903115032 1:21172292-21172314 GTCTGGGGAAGGAGGAATTAAGG - Intronic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903156408 1:21446559-21446581 AGGGAGGGAAGGAGGAAGAAAGG - Intronic
903202184 1:21750419-21750441 CTGTGGAGAAGAAGAAAGCAGGG - Intronic
903331812 1:22600470-22600492 CTGTGGAGACGAAGGAAGGAGGG - Intronic
903333366 1:22608884-22608906 CTTTGGGGATGGAGTAAGACGGG - Intergenic
903670247 1:25031171-25031193 CTGGAGGGATGGAGGATGAAGGG + Intergenic
904534604 1:31190811-31190833 CAGGGTGGAAGGAGGAAGAGTGG - Intronic
904573074 1:31482525-31482547 CTGTGGGGAATAAGGGAGAAAGG + Intergenic
904840560 1:33369380-33369402 CTCTGGGGAGGGAGGCAGACAGG + Intronic
904920142 1:34000993-34001015 GAAAGGGGAAGGAGGAAGAAGGG + Intronic
904941447 1:34166823-34166845 GTGGGGGGAGGGAGGAAGAGTGG - Intergenic
904941824 1:34169126-34169148 CTGTGAGGAAAGGGTAAGAAAGG + Intronic
904988484 1:34572578-34572600 TTGTGGGCCAGGAGGAAGAAGGG + Intergenic
905049604 1:35038764-35038786 GTGTGGGGAGTGAGGAATAAGGG + Intergenic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905173469 1:36122747-36122769 CTCTGGGGAACAAGGATGAAGGG - Intronic
905245864 1:36612822-36612844 GGGAGGGGAAGGAGGATGAAGGG + Intergenic
905449828 1:38048730-38048752 CTGGGAGGTAGGAGGAAGACTGG + Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905866512 1:41379779-41379801 CTGGTGGGAAGGAGGCAGGAGGG + Intronic
906065600 1:42978258-42978280 CTGTTGGGAAGAAGGAAGGAAGG - Intergenic
906149827 1:43581241-43581263 ATGTGGGGATGGAGCCAGAAGGG - Intronic
906166253 1:43688649-43688671 TCGTGGGGCAGGAGGAAGAATGG + Intronic
906565006 1:46793298-46793320 CTGGGTGGAAGGGGGAAGCAAGG + Intronic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906935786 1:50212959-50212981 CTGTGAGGCAGGAAGAGGAAGGG - Intergenic
907060924 1:51423925-51423947 CTATGGGGGAGGAAGAGGAAGGG + Intronic
907380423 1:54082710-54082732 GTGAGGGGAGGGAGGAAGGAGGG + Intronic
907975468 1:59427268-59427290 TTGTGGGGAGGGAGGCAGCAAGG - Intronic
908151850 1:61310711-61310733 GGGAGGGGAAGGAGGAAGAAAGG - Intronic
908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG + Intergenic
908352941 1:63303905-63303927 GTGTTGGGGAGGAGGAAGAAGGG + Intergenic
908534605 1:65066612-65066634 GTCTGGGGTAGGAGGGAGAACGG - Intergenic
908815100 1:68023630-68023652 CTGTAAGGAAGGAGGAACGAAGG + Intergenic
908816595 1:68041822-68041844 CTGTGGGAATGGAGAAAGACAGG - Intergenic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
909382145 1:75011002-75011024 ATGTGGAGAAGTAAGAAGAATGG + Intergenic
909585144 1:77281529-77281551 CTGTGGGGAAGGGGGAAAAGGGG - Intergenic
909686535 1:78355172-78355194 AAGAGGGAAAGGAGGAAGAAGGG - Intronic
909730040 1:78878783-78878805 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
910194111 1:84622861-84622883 CTGTGTGGAAGCATGAGGAAGGG + Intergenic
910369098 1:86497046-86497068 GTTAGGGGAAGGAGGCAGAAGGG + Intronic
910449594 1:87331844-87331866 CTGAGGGGGAGAGGGAAGAAGGG - Intronic
910490449 1:87764003-87764025 GGGAGGGGAGGGAGGAAGAAAGG - Intergenic
910603387 1:89055594-89055616 CTGTGGGGATGGGGGAACACTGG + Intronic
910622359 1:89270511-89270533 CTATGAGGAAGCAGGGAGAATGG - Intronic
910637328 1:89423520-89423542 CTGTGGGGATGGGGGAACACTGG - Intergenic
910938782 1:92510349-92510371 CTTTGGAGAAGGAGAAAGAAAGG - Exonic
910993499 1:93079578-93079600 GTTGGGGGAAGGAGGAAGAAAGG + Intronic
911013795 1:93309950-93309972 TTGTGGAGCAGGTGGAAGAATGG + Intergenic
911015753 1:93330275-93330297 CTGTGGGAAGGGAGAAAGAGAGG - Intergenic
911190090 1:94939841-94939863 AGGTTGGGAAGGTGGAAGAAGGG - Intergenic
911445631 1:97988147-97988169 CTGTGGGGTAAGAGGGAGAGAGG + Intergenic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
912455595 1:109794716-109794738 CTGATGGGGAAGAGGAAGAAAGG + Intergenic
912551818 1:110489823-110489845 CGGGGGTGGAGGAGGAAGAAGGG - Intergenic
913094934 1:115507448-115507470 CTGAGGGGAAAGGGGAAAAAGGG - Intergenic
913157658 1:116115813-116115835 CTGTGGTTAAGGAGGAGGAGGGG + Intronic
913250693 1:116910157-116910179 CGGCGGGGAAGGAGGAGGAGGGG + Exonic
913591747 1:120335678-120335700 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
913651610 1:120919467-120919489 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914169496 1:145209603-145209625 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
914341034 1:146760765-146760787 TGGCTGGGAAGGAGGAAGAAGGG - Intergenic
914524610 1:148453565-148453587 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
914599061 1:149182268-149182290 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914641791 1:149613575-149613597 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914725559 1:150324206-150324228 CTGCCTGGAAGTAGGAAGAATGG + Intronic
914755995 1:150561913-150561935 GAGTGGGGAAGGAGGCAAAAGGG + Intergenic
914783711 1:150809175-150809197 ATGTGGGGAAGGAGAAAAAAAGG + Intergenic
914848022 1:151293463-151293485 CTGTGGGGTAGGGGCAGGAATGG + Intronic
915047203 1:153028162-153028184 TTGGGGGGAAGGTGGAAGATGGG - Intergenic
915098235 1:153479252-153479274 CTGTGGAGAAGCAGGACCAAAGG + Intergenic
915148055 1:153807166-153807188 CTCTGGGGATGGAGGAAGCCAGG + Exonic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915446475 1:155977510-155977532 CGCTGGGGGAGGAGGAGGAAGGG + Intronic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
915703276 1:157818503-157818525 TAGTGGGGAAGGAGGAATGAGGG + Intronic
915846164 1:159267564-159267586 CTCTGAGAAAGGAGGAAGTAAGG - Intergenic
916046677 1:161005278-161005300 GGGAGGGGAAGGAGGAAGGAGGG - Intronic
916069953 1:161164141-161164163 CTGGGGGAAAAGGGGAAGAAAGG - Intronic
916629796 1:166600135-166600157 CTTTGGGGAATGGTGAAGAAGGG + Intergenic
916649343 1:166820252-166820274 CTGAGGCCTAGGAGGAAGAATGG - Intergenic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918117064 1:181506886-181506908 CTGTGGGCTAGGTGAAAGAATGG - Intronic
918599013 1:186330818-186330840 TTGTGGGACAGAAGGAAGAAAGG + Intronic
919420605 1:197365492-197365514 CTCTGGGGAGGGGGGGAGAAGGG + Intronic
919640077 1:200038678-200038700 CTGAGGGGAAGCAAGAAGAAGGG - Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920248785 1:204608273-204608295 CCCTGGGGAAGGAGGAGGAGAGG + Intergenic
920260090 1:204683463-204683485 ATGAGGGGGAGGAGGAAGAGGGG + Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920676364 1:208041203-208041225 GGGTGAGGAGGGAGGAAGAATGG - Intronic
920807105 1:209245352-209245374 CAAGGGGGAAGGAGGAAGATTGG + Intergenic
920861352 1:209710051-209710073 CAGTGGGGTAGGAGAAAGAATGG + Intronic
921228938 1:213049562-213049584 GTGAGTGGAAGGAGAAAGAAAGG + Intergenic
921297677 1:213719999-213720021 GTGTGGGGAAAGAGGAAGGCAGG - Intergenic
921540001 1:216402491-216402513 CTGAGGAGGAGGAGAAAGAAGGG - Intronic
921924070 1:220697407-220697429 TGGCGAGGAAGGAGGAAGAAGGG + Exonic
922034152 1:221832080-221832102 CTCTATGGAAAGAGGAAGAAGGG - Intergenic
922183345 1:223253543-223253565 CTGGGGTGGAGAAGGAAGAAAGG + Intronic
922219907 1:223550542-223550564 CTTGAGGGAAGGAGGAAGGAAGG - Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922968074 1:229709278-229709300 CAGTGGGGAAGGAGAAAACATGG - Intergenic
923001888 1:230012939-230012961 CTGCGGGGAAGGAGGTTGAAGGG + Intergenic
923099495 1:230801057-230801079 CTGTTGGGAAGGAGGAGGCAGGG + Intronic
923199799 1:231700280-231700302 CTGAGGAGGAGGAGGAAGAGAGG - Intronic
923254655 1:232211232-232211254 CTGAGAGGAGGGAGGAAGAGAGG - Intergenic
923459704 1:234197585-234197607 ATGTGGAGAGGGAGCAAGAAGGG + Intronic
923531767 1:234817669-234817691 TGGTGAGGAAGGAGGAAGAGAGG + Intergenic
923688787 1:236173428-236173450 AGGGAGGGAAGGAGGAAGAAAGG + Intronic
924538509 1:244959198-244959220 CGGTGGGGAGGCAGGCAGAAAGG + Intergenic
1063774363 10:9244346-9244368 CACTGGGGAAACAGGAAGAAGGG - Intergenic
1064115976 10:12577805-12577827 GGGTGGGGAAGGAGGAAAATGGG - Intronic
1064194615 10:13234693-13234715 GTGGGGGCAAGGAGGAAGAGAGG + Intergenic
1064630521 10:17306210-17306232 CTGTCGGGAAGGAGGAAGGGAGG - Intergenic
1064816823 10:19274816-19274838 CTGGGGGGAGGCAGGAAGGAAGG + Intronic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065132428 10:22635665-22635687 CTGTGGGCAGCGAGGAAGCATGG + Intronic
1065386779 10:25142036-25142058 TTGTGGGGAAGGAGTAAAATAGG - Intergenic
1065402238 10:25318481-25318503 CTGTACGGAAGAAAGAAGAACGG - Intronic
1065494992 10:26318593-26318615 CAGGGAGGAAGGAGGAAGGAAGG + Intergenic
1065571104 10:27071927-27071949 CTGTGAGGTAGGATCAAGAATGG - Intronic
1065747713 10:28857372-28857394 CCGTAGAGAAGGAGGAGGAATGG - Intronic
1065790265 10:29254186-29254208 AGGAGGAGAAGGAGGAAGAAGGG + Intergenic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1065998724 10:31084194-31084216 CCCTGGGGCTGGAGGAAGAAAGG - Intergenic
1066027690 10:31380170-31380192 GGGGAGGGAAGGAGGAAGAAGGG - Intronic
1066093323 10:32048051-32048073 CTTTGGGGAAGGAATAACAATGG + Intronic
1067031662 10:42882193-42882215 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067342427 10:45416719-45416741 ATGAAGGGAAGGAGGAAGGATGG + Intronic
1067424225 10:46191317-46191339 GTTAGGGGAAGGAGGAAGAAGGG + Intergenic
1067432141 10:46251777-46251799 TTGTGTGGAGGGAGGAAGAGAGG - Intergenic
1067441089 10:46309567-46309589 CTGTGTGGAGGGAGGAAGAGAGG + Intronic
1067456186 10:46420900-46420922 GGGTGGGGAAGAGGGAAGAAGGG + Intergenic
1067577737 10:47418830-47418852 CTGTGTGGAGGGAGGAAGAGAGG + Intergenic
1067631013 10:47963739-47963761 GGGTGGGGAAGAGGGAAGAAGGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067700489 10:48568061-48568083 ATGTTGGGAAGGAAAAAGAAAGG + Intronic
1067705104 10:48600881-48600903 CTCTGGAGAAGGAGGACCAAAGG - Intronic
1067719804 10:48719740-48719762 CTGTGGGGAAGGCGGTGGACTGG + Intronic
1068255506 10:54504400-54504422 GTGGAGGGAAGGAGGAATAATGG - Intronic
1068345964 10:55778427-55778449 GTAAGGGGAAGGAGGAAGAAGGG - Intergenic
1068616977 10:59129626-59129648 GGGTGGGGAAGGAGTCAGAAAGG + Intergenic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1069165446 10:65152387-65152409 GTGTGGGGAATGAGGAAATAGGG + Intergenic
1069190590 10:65483158-65483180 AGGCGGGAAAGGAGGAAGAAAGG - Intergenic
1069465127 10:68631611-68631633 CTGTGGGGAAAGAGCCAGCAGGG + Intronic
1069772356 10:70907821-70907843 CTTTGGGGGAGGTGGAGGAAGGG + Intergenic
1069847234 10:71380679-71380701 CTGGGAGGAAGGAGACAGAAAGG + Intergenic
1070124029 10:73605826-73605848 CTTTGGGGAAGGAGGAATCGGGG + Intronic
1070500072 10:77064358-77064380 GTTGGGGGAAGGAGGGAGAAGGG + Intronic
1070537748 10:77392200-77392222 CAGTGGGGAGGAAGGAAGGAAGG + Intronic
1070630474 10:78081165-78081187 CTGGGGGGCAGGAGGAAGAATGG + Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1070833857 10:79435983-79436005 GAGCGGGGAAGGGGGAAGAAGGG + Intronic
1070860648 10:79656733-79656755 GTTAGGGGCAGGAGGAAGAAGGG + Intergenic
1070876616 10:79818831-79818853 GTTAGGGGCAGGAGGAAGAAGGG - Intergenic
1070913853 10:80140165-80140187 CTGAGGGACAGGAGGAAGACAGG - Intronic
1071317806 10:84420123-84420145 CTGAGTGGAAGTAGAAAGAAAGG + Intronic
1071619857 10:87109243-87109265 TTGTGGGGAAGGACCCAGAATGG - Intronic
1071698869 10:87907404-87907426 CTGGGGAGAAGCAGGAATAAAGG + Intronic
1071719670 10:88130816-88130838 CTGTGGGGTAGTAGGAAAATTGG + Intergenic
1071811297 10:89184719-89184741 CTGGGGGGCACCAGGAAGAAAGG - Intergenic
1072038938 10:91589775-91589797 GTGTGGGGGAGAAGGAAGGAGGG + Intergenic
1072695607 10:97600709-97600731 CTGGAGGGAAGGGAGAAGAAGGG + Intronic
1072758255 10:98035408-98035430 CTGTGGGGCAGGGGGAAGCCTGG + Intergenic
1073398629 10:103239000-103239022 CTGTGGACAAGAATGAAGAAAGG + Intergenic
1073471354 10:103724362-103724384 CTGTGGAGAGACAGGAAGAAAGG + Intronic
1073620956 10:105047831-105047853 ATGAGGGAAGGGAGGAAGAATGG + Intronic
1073679760 10:105690004-105690026 CTGGGGGCAGGGAGCAAGAAGGG + Intergenic
1074059190 10:109949470-109949492 CTATGGGGAGGGAAGAAGGATGG - Intronic
1074221886 10:111446047-111446069 CTGTGGAGGAGGCGGAAGAGTGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074518981 10:114199491-114199513 CGCTGAGGAAGCAGGAAGAATGG - Intronic
1074908566 10:117886663-117886685 CTGTGTGGAAGAAGGAAAAAAGG - Intergenic
1074974342 10:118568068-118568090 CTGTGGGAAGGAAGGAACAAAGG - Intergenic
1075000192 10:118791194-118791216 CTTTGGGGACTCAGGAAGAAGGG + Intergenic
1075380634 10:122015850-122015872 CTGTGATGAAGGAAGAGGAAAGG - Intronic
1075570902 10:123544235-123544257 CTGAAGGAAAGGAGAAAGAAAGG - Intergenic
1075646067 10:124097350-124097372 CTGTGGGGCAGGGCAAAGAACGG + Intergenic
1075746266 10:124730077-124730099 CTGTGTGGCATGAGGAAGGAAGG - Intronic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1076107116 10:127832363-127832385 GTGTGGGGAGGGAGGAAGACTGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076725331 10:132410451-132410473 CTGTGCGGGAGCAGGAAGGAGGG + Intronic
1076818872 10:132928243-132928265 CTGCTGGGAAGGAGGAAGTGGGG + Intronic
1076941456 10:133612777-133612799 CACAGGGGAATGAGGAAGAAAGG + Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1076988510 11:256869-256891 CTGTGAGGCCAGAGGAAGAAGGG + Intergenic
1077069763 11:663490-663512 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069780 11:663603-663625 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077433258 11:2526432-2526454 CTGTGGGGAGGGAGGAACCCAGG + Intronic
1077914434 11:6602102-6602124 CTGAGGAGGAGGAGGAGGAAAGG - Exonic
1077922028 11:6648511-6648533 CAGTGGGAAATGAGAAAGAATGG + Intronic
1078042008 11:7874765-7874787 CTGTGGGGTAGGAGAAAAAAGGG + Intergenic
1078541558 11:12217507-12217529 CTGTGAGGCAGAGGGAAGAAGGG - Intronic
1078564510 11:12403063-12403085 CTGTGGGGAAGGAGGCAGCGAGG - Intronic
1078612264 11:12830948-12830970 ATGAAGGGCAGGAGGAAGAAGGG - Intronic
1078738181 11:14041190-14041212 CTTTGGGGAAGAAGGAGGATGGG - Intronic
1078947236 11:16083028-16083050 TTATGGGGAAGGATGCAGAATGG - Intronic
1079138124 11:17787998-17788020 CTGTGGGGTTGGCCGAAGAAGGG - Intergenic
1079525752 11:21385611-21385633 CTGTGAGGGAGGAGTAAGACTGG - Intronic
1080765073 11:35288456-35288478 GGGTGGGGTAAGAGGAAGAAAGG - Intronic
1080853161 11:36088953-36088975 GTGTGGGGAAGGATGAAGCAGGG - Intronic
1081144759 11:39548924-39548946 CTTTGGGGAACCAGGAGGAAGGG + Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081601951 11:44501423-44501445 CTAGGGAGAAAGAGGAAGAAAGG - Intergenic
1081634120 11:44709453-44709475 AGGTGGGGAAGGAGGAAGAGAGG - Intergenic
1081654422 11:44848180-44848202 TTGTGGGAAAGGAGGATGAGGGG + Intronic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1082181102 11:49120846-49120868 AGGAAGGGAAGGAGGAAGAAAGG - Intergenic
1082256112 11:50035279-50035301 CTGTGGGGACTGAAGAAGAGTGG - Intergenic
1082757399 11:57091745-57091767 TGGTGAGGAAGGAGGAAGGATGG - Intergenic
1082771151 11:57208597-57208619 CTCTGGGTAAGGAGGCAGATTGG + Intergenic
1083035933 11:59637433-59637455 AAGTGGGGAAGAAGGAAGCATGG + Exonic
1083313201 11:61796515-61796537 CTGGGGTGAAGGAGGTATAATGG - Exonic
1083413876 11:62512849-62512871 CTGTTAGGAAGAAGGAAGGAAGG + Intronic
1083587006 11:63867488-63867510 CTCTTGGGAAGGAGGTGGAAGGG - Intronic
1083602636 11:63958416-63958438 AGGTGGAGAAGGAGGAGGAATGG - Intergenic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1083946262 11:65924734-65924756 GGCTGGGGAAGGAGGCAGAAGGG + Intergenic
1084166361 11:67376460-67376482 GTTTGGGGAAGAAGGAAGAGAGG + Intronic
1084178908 11:67437106-67437128 TGGTGGGGAGGGAGGAAGAGGGG - Intronic
1084216557 11:67650066-67650088 CTGTGGGGAGTGAGGAACAAAGG + Intronic
1084268039 11:68014934-68014956 CTGTGCGGCAGGAAGAAGCATGG + Intronic
1084724001 11:70928605-70928627 CTGGGGGGGAAGAGGAAGACTGG + Intronic
1084772841 11:71355436-71355458 CTGGGGAGAAGGAGGAGGAGGGG - Intergenic
1085236915 11:75022376-75022398 CTTTGGGGAAAGAGGCAGCAAGG - Intergenic
1085326305 11:75609344-75609366 CTGTGGGAAAGGAGGAGTTAGGG + Intronic
1085574942 11:77594051-77594073 CTGTGGGGAGGAGGGAGGAATGG + Intronic
1085726129 11:78956111-78956133 CTGGTGGAAAGAAGGAAGAAAGG + Intronic
1085788712 11:79477206-79477228 CTGTGTGGTAGGAAGAATAATGG - Intergenic
1085857228 11:80188732-80188754 CAGGAGGGAGGGAGGAAGAAAGG - Intergenic
1086189444 11:84061046-84061068 CTGTTTGGAAGGAGGAAGTGGGG - Intronic
1086400382 11:86456629-86456651 CTCTGGGGAAGGACGGAGCAGGG + Intronic
1086684385 11:89714026-89714048 AGGAAGGGAAGGAGGAAGAAAGG + Intronic
1087060455 11:93972037-93972059 CTATGGGGAAGGCAGAAGACAGG - Intergenic
1087688466 11:101291932-101291954 CTTCGGGGAATCAGGAAGAAAGG - Intergenic
1088033132 11:105276645-105276667 CTGAAGAGAAGGAGGAAGAGGGG + Intergenic
1088139242 11:106595638-106595660 CTCTGGGGGAGGTGGAAGAAAGG + Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088536182 11:110864258-110864280 GTTTAGGGAGGGAGGAAGAAAGG + Intergenic
1088595097 11:111435372-111435394 CGGGTGGGAAGGAGAAAGAAGGG + Intronic
1088602866 11:111498238-111498260 CTGAGGGGAAGGAGGCTGAGGGG - Intronic
1088677024 11:112204546-112204568 CTGAGGGGGAGGAAGAAGAGGGG - Intronic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088980644 11:114860040-114860062 CTTTGAAGATGGAGGAAGAAGGG + Intergenic
1089012281 11:115141153-115141175 CGGTGGGGAAGGAAGAGGGAAGG - Intergenic
1089356189 11:117855550-117855572 CTCTCTGGAAGGAGGGAGAAAGG - Intronic
1089430598 11:118421029-118421051 CTCTGGGATAGGAGAAAGAAGGG - Intronic
1090033441 11:123227726-123227748 CTTAAGGGAAGAAGGAAGAAAGG + Intergenic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090442116 11:126732974-126732996 CAATGTGGAAGGAGGAAGATTGG + Intronic
1090584387 11:128194662-128194684 CGGGAGGGAGGGAGGAAGAAAGG - Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091297640 11:134485309-134485331 CTTTGGGGAAGAAGGAAGGGAGG - Intergenic
1091354049 11:134922080-134922102 CTGTGGGGAAGGAGAAAGAGAGG - Intergenic
1091409592 12:230265-230287 TTGGGGGGAAGGAGGAGGAGAGG + Intronic
1091549000 12:1523732-1523754 CTCTGGAGAGGAAGGAAGAAGGG + Intergenic
1091554191 12:1559886-1559908 CTGGGGAGAAGGAGTAAAAATGG - Intronic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092509801 12:9143358-9143380 AGGTGGAGAAGGAGGAAGAGTGG + Intergenic
1092658223 12:10710088-10710110 CTGGGGAGGAGGAGGAGGAAGGG - Exonic
1092961453 12:13600208-13600230 ATGAGGGGAAAGAGGAAGGAAGG - Intronic
1092961983 12:13605045-13605067 CTGTGGGGAGAGAGGAAGAGAGG - Intronic
1093267444 12:17020301-17020323 CAGGGAGGAAGGAGGGAGAATGG - Intergenic
1093363780 12:18266825-18266847 ATGAGGAGGAGGAGGAAGAAGGG - Intronic
1093514007 12:19964280-19964302 CTGCAGGGAAGGTGCAAGAAAGG - Intergenic
1093958652 12:25250454-25250476 CTCTCGGGGAGGAGGAAGGAAGG + Intronic
1094008471 12:25781571-25781593 ATGTTGGGAAGGAGGGAGGAGGG - Intergenic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1094283711 12:28769137-28769159 AGTTGGGGAAGGAGGCAGAAGGG - Intergenic
1094299941 12:28952162-28952184 CTTTGGGGGATGAGGCAGAAGGG - Intergenic
1095718035 12:45370192-45370214 CTATGTGGAAGCAGGAAGTAAGG - Intronic
1095731922 12:45515270-45515292 CTATGGGGAGAGAGAAAGAAGGG - Intergenic
1095735887 12:45555771-45555793 CTGGAAGGCAGGAGGAAGAAAGG - Intergenic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096420472 12:51452893-51452915 CTTTGGGGAAGGAGCGAGATGGG + Intronic
1096668847 12:53185774-53185796 CTTTGGGGAAGGAGGTGGAGTGG - Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096717288 12:53499275-53499297 CTGTGGGGATGGAGGAACTGGGG - Intronic
1096789906 12:54038169-54038191 CTGCTGGGAAGTAGGAAGATGGG + Intronic
1096995439 12:55835165-55835187 TTATGGGGAAGGGGGAGGAAGGG + Intergenic
1097070536 12:56351247-56351269 CTGGGGGAAAGAAGGAACAAGGG - Intronic
1097270024 12:57768329-57768351 CAGTGGGGAATGAGGGAGTAAGG - Intronic
1097282661 12:57854251-57854273 AGGGGAGGAAGGAGGAAGAAGGG + Intergenic
1097631098 12:62063152-62063174 CTGTGTGGCAGGCGGAATAACGG - Intronic
1097638337 12:62148542-62148564 AAGAGGGGAAGGAGGAAGGAGGG + Intronic
1097904057 12:64902220-64902242 AAGTAGGGAGGGAGGAAGAAAGG - Intergenic
1098237962 12:68436327-68436349 CTGTGGGCAAGCAAGAAGAGAGG + Intergenic
1098306923 12:69111571-69111593 CTGAGGAGGAGGAGGAAGAGGGG - Intergenic
1098384687 12:69906516-69906538 CTGTGGTGAAGGCTGAAAAAAGG + Intronic
1098523534 12:71460749-71460771 ATGTAGGAGAGGAGGAAGAATGG - Intronic
1098542374 12:71671041-71671063 CTGAGGAGGAGGAGGAAGAAGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098781299 12:74690174-74690196 TTGTGGGCAAGGATGAAGGAGGG - Intergenic
1099046369 12:77725966-77725988 GTGTGGAGAATGAGGCAGAAGGG - Intergenic
1099186797 12:79523756-79523778 CAGTAGGAAGGGAGGAAGAAGGG - Intergenic
1099285549 12:80710460-80710482 CTGTTGGGGAGGAGGAGGAAAGG - Intergenic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1099941604 12:89195630-89195652 TTGTGGGGGAGGAGGAAGGGAGG - Intergenic
1100143005 12:91641937-91641959 CTAGAGGGAAGGAGAAAGAAAGG - Intergenic
1100316465 12:93449166-93449188 TGATGGTGAAGGAGGAAGAAAGG - Intergenic
1100379060 12:94044762-94044784 CTGAGAGGAAGGAGGAGGACAGG - Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100524631 12:95407872-95407894 CAGGCGGGAAGGAGGATGAAGGG - Intergenic
1100685970 12:96986072-96986094 CTTTGGGGAAGAGGGAGGAAGGG + Intergenic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1100811398 12:98342385-98342407 CTCTGCGGAAGGAGGAAGGGAGG - Intergenic
1101063591 12:100996692-100996714 CAGTGGGGCAGGGAGAAGAATGG + Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1101590297 12:106119542-106119564 CTGTAGGGAAGCTGGAAAAATGG + Intronic
1101840117 12:108322025-108322047 TTGAGGGGAAGGTAGAAGAAGGG + Intronic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1102562007 12:113769121-113769143 CGGTGGGGGAGGATGAAGGAAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103215239 12:119196681-119196703 CTGTAGGGTGGGAGGGAGAAGGG + Intronic
1103238986 12:119397943-119397965 CTGTGTGGGAGGGGGAGGAAGGG + Intronic
1103325058 12:120115092-120115114 GGTTGGGGAAGGAGGTAGAAAGG - Intronic
1103443528 12:120979966-120979988 GTGTGGGGGAGAAGGAAGGATGG + Intronic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1103698346 12:122835056-122835078 CTGGGTGGAAGGAGGAGGGAGGG + Intronic
1103777817 12:123379577-123379599 CTGGGAGGCAGGAGGAAGAGAGG - Intergenic
1103859426 12:124000296-124000318 CTGCTGGGAAGCAGGAAGCAAGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1105580594 13:21692242-21692264 AAGTGGGGAGGGAGAAAGAAAGG - Intronic
1105639640 13:22249184-22249206 TTCTGGAGAGGGAGGAAGAAGGG - Intergenic
1105912616 13:24884895-24884917 CTAAAGGGAATGAGGAAGAAAGG - Intronic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106801848 13:33264027-33264049 ATGTGGGGAAGAAGGAAGCCTGG + Intronic
1106899498 13:34340333-34340355 CTGTGAGGAAGAAGTCAGAAAGG - Intergenic
1107250694 13:38357847-38357869 CTGAGGAGAAGGAAGAGGAAGGG + Intronic
1107269483 13:38598408-38598430 GTCTGTGGAAGGAGGAAGGAAGG + Intergenic
1107315640 13:39128527-39128549 TTGGGGGTAAGTAGGAAGAAAGG + Intergenic
1107448929 13:40491447-40491469 AGAAGGGGAAGGAGGAAGAAGGG - Intergenic
1107643167 13:42465391-42465413 GAGTGGAGAAGGAGGAAGAGGGG + Intergenic
1107858535 13:44638834-44638856 CTATTAGTAAGGAGGAAGAAGGG + Intergenic
1108000966 13:45905334-45905356 CTGTGGTGAAGGTAGAAGCAAGG - Intergenic
1108743758 13:53367765-53367787 CTGTAGGCAGGAAGGAAGAAAGG + Intergenic
1108754460 13:53482860-53482882 CTGGGGGGAGGGAGAAAGAGTGG + Intergenic
1109240980 13:59888062-59888084 CAGTGGGGAAAAAGGCAGAAAGG - Intronic
1109352624 13:61204469-61204491 ATGTGTGGAAGGGGGAATAAAGG - Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1110186755 13:72683800-72683822 CTGTTGGAAATTAGGAAGAAGGG - Intergenic
1110268456 13:73566538-73566560 CAGTGTGGAAGGTGGAATAATGG + Intergenic
1110559112 13:76891063-76891085 CTATGGGGAAAGGGGAAGAGAGG + Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111693280 13:91592329-91592351 CTGTTGTGAGGGAGGAAGAGAGG + Intronic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1111743192 13:92231291-92231313 CTGTGGAGAAGCATGAAAAAGGG - Intronic
1111775247 13:92653276-92653298 CTTTGGGGAAGGAAGTGGAAGGG + Intronic
1111792058 13:92870264-92870286 CTCTGTGCAAGGAGGCAGAAAGG - Intronic
1111994439 13:95150486-95150508 CAGTGGGGAAGGGGGAGGGAGGG - Intronic
1112331165 13:98477990-98478012 CCATGGGGAACGAGGAGGAAGGG + Intronic
1112382798 13:98908760-98908782 ATGTGGGAATGGAGGATGAAGGG + Intronic
1112540878 13:100311437-100311459 GTGTGAGGAAAGAGGAAGAAAGG - Intronic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1112649716 13:101381611-101381633 CTGAGGGAAAGAAGGAAGTAAGG - Intronic
1113043037 13:106125273-106125295 TGGAGGGGAAGGAGGAAGAAGGG - Intergenic
1113066043 13:106375118-106375140 CTGCTGGAAAGGAAGAAGAATGG - Intergenic
1113074601 13:106455331-106455353 CTGTGGGGCAGGAGGAGGTCTGG + Intergenic
1113144746 13:107196148-107196170 GAGTGGAGAAGGTGGAAGAAGGG + Intronic
1113813276 13:113154472-113154494 GTGTGGGGGAGGAGGAGGAAGGG + Intergenic
1113836050 13:113329189-113329211 CGGTGGCCAGGGAGGAAGAAAGG - Intronic
1114221929 14:20704443-20704465 CTGTGTGTAAGGAAAAAGAATGG - Intergenic
1114411366 14:22503682-22503704 CTGGAGGGAAGGAAGAAAAATGG + Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114484378 14:23054369-23054391 CTGTGGGGAGGGAGGAGGGCTGG - Intronic
1114526252 14:23368412-23368434 CTGCAGGGAAGGGGAAAGAATGG - Intergenic
1114600988 14:23955172-23955194 ATGTGGGGAAGGCGGAGGACCGG + Exonic
1114605199 14:23990319-23990341 ATGTGGGGAAGGCGGAGGACCGG + Exonic
1114633208 14:24172683-24172705 GGGTGGGGAAGGTGGGAGAATGG - Intronic
1114646404 14:24258885-24258907 CTAAGGGAAAGGAGGGAGAAGGG - Intronic
1115143431 14:30199639-30199661 CTGTGGGGAAGAAGGCAGGGTGG - Intergenic
1115495762 14:34002979-34003001 GAGTGGGGAAGAAGGAAGCAAGG + Intronic
1115498216 14:34027303-34027325 GGGAGGGGAAGGGGGAAGAAGGG + Intronic
1115569426 14:34652891-34652913 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
1115595029 14:34901140-34901162 CTGTGGGGAGAGAGAAAGAAAGG + Intergenic
1115710215 14:36042244-36042266 CTGTTGGTCAGAAGGAAGAATGG - Intergenic
1115814849 14:37152975-37152997 AAGTGGGGAAGGAGGAAAAGAGG + Intronic
1116144019 14:41040365-41040387 GTTTGGAGAAGGAGGAGGAATGG + Intergenic
1116305438 14:43248042-43248064 AAGTAGGGAAGGAGGGAGAAAGG - Intergenic
1116455009 14:45109946-45109968 CTGTAAGGAAGGACGAAGAGAGG - Intronic
1116472724 14:45305146-45305168 ATGTGGGTCAGGAGGAAGAGAGG + Intergenic
1116663796 14:47748718-47748740 CTGAGATGGAGGAGGAAGAAGGG - Intergenic
1116665125 14:47764851-47764873 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118589716 14:67392428-67392450 CTAGGGGGAAGGAGGGAGCAAGG + Intronic
1119023640 14:71135783-71135805 CTGTGGGGAAGGCTAAATAAAGG + Intergenic
1119042106 14:71284061-71284083 CTGGGGGGAGGGAGGAAGAAAGG + Intergenic
1119049809 14:71356109-71356131 ATGTAGGGAAAGTGGAAGAAGGG - Intronic
1119059026 14:71455366-71455388 CTAGGAGAAAGGAGGAAGAATGG + Intronic
1119519075 14:75272259-75272281 CTGTGAGGAAGAGGGAAGAGTGG + Intergenic
1119618620 14:76114914-76114936 TTGTGGGGAAGGACGAAGGAGGG + Intergenic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119941809 14:78649243-78649265 TTGCGGAGAAGGGGGAAGAAAGG - Intronic
1119949637 14:78730985-78731007 CTGAAGGGAGGGAGGAAGAAAGG - Intronic
1120492657 14:85196204-85196226 CTGTGGGCAAGGTGGATGGACGG + Intergenic
1120635554 14:86946374-86946396 CTGGAGGGAGGGAGGAAGGAAGG - Intergenic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1120719060 14:87870696-87870718 TTTTGGGGAGGAAGGAAGAAGGG - Intronic
1120995111 14:90411633-90411655 ATGGGGGGAAGGAGGCAGAAAGG - Intergenic
1121666633 14:95677312-95677334 GTCTGGGGAAGGAGAAAGAATGG + Intergenic
1121708592 14:96019949-96019971 CTCTGGGGATGGAGCAGGAAGGG + Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121800201 14:96768663-96768685 AGGAAGGGAAGGAGGAAGAAGGG - Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1121971833 14:98365280-98365302 GTATGGGGAAGGAGGAAAAGAGG - Intergenic
1122155657 14:99748813-99748835 CTGTGGGGAGGAAGCTAGAAGGG - Intronic
1122411628 14:101528764-101528786 ACCTGGGGAAGGAGGAAGAGGGG + Intergenic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122451130 14:101808433-101808455 CTCTGGGGAAAGAGGGGGAAGGG + Intronic
1122651490 14:103229359-103229381 GTGTGGGGCAGGAGGAAGGGAGG - Intergenic
1122986204 14:105212775-105212797 CTGTGGGGAAGGACGCAGCGGGG + Intronic
1123998720 15:25736746-25736768 GTGGGGGGAAGGAGGAAGAAGGG + Intronic
1124135564 15:27032918-27032940 CTCTGGGGAACGATGCAGAAAGG - Intronic
1124689391 15:31809333-31809355 CTGATGGGAAGGCAGAAGAAAGG - Intronic
1125121234 15:36161151-36161173 CTGAAGGGAAGAAGGAAGGAAGG + Intergenic
1125499661 15:40231567-40231589 TTGTTGGGAAGGAGAAAGGAAGG + Intergenic
1125500692 15:40238908-40238930 CTGAAGGGGAGGAGGAGGAAGGG - Intronic
1125989433 15:44091855-44091877 CTGAGGGGAAGCAGGGAGAGAGG - Intronic
1126333685 15:47563472-47563494 ATGGGGGGAGGTAGGAAGAAAGG - Intronic
1126851165 15:52798150-52798172 CGGCGGGGACGGAGGAAGAGGGG - Intergenic
1126951241 15:53884199-53884221 CTGTGGAGCAGGAAGACGAAGGG + Intergenic
1127180722 15:56414385-56414407 AAGTGGGGAAGGTGGAAAAAGGG - Intronic
1127608475 15:60614290-60614312 CTGCTGGGGAGGAGGAAGGAAGG + Intronic
1127733319 15:61819699-61819721 CTGAGAGGAAGGATGGAGAAGGG - Intergenic
1128260508 15:66229674-66229696 CTCTGGGGAAGGAAGAGGAATGG + Intronic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1128607521 15:69047807-69047829 CTGAGGGGAGGCAGGAGGAAGGG - Intronic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1130044896 15:80436013-80436035 CGGGGGGGAAGGATGAAGGAGGG - Intronic
1130052538 15:80495796-80495818 GTGTGGGGAAAGTGGAAGGAGGG - Intronic
1130108493 15:80946541-80946563 ATGTGGTGATGGAGGAAGGAAGG - Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130668403 15:85889146-85889168 CAGGGGAGAAGGTGGAAGAAGGG + Intergenic
1130839217 15:87682058-87682080 ATGGAGGGAAGAAGGAAGAAAGG + Intergenic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1130924569 15:88375398-88375420 TAGTGGGGGAGGAGGCAGAATGG - Intergenic
1130989976 15:88870356-88870378 CCCAGGGGAAGAAGGAAGAAGGG + Intronic
1130990278 15:88871905-88871927 CAGAGGGGATGGAGGAGGAAAGG - Intronic
1131040015 15:89255837-89255859 ATAAGTGGAAGGAGGAAGAAGGG + Intronic
1131262672 15:90895841-90895863 CCTTGGGGAAGGAGGAGGACAGG + Intergenic
1131397488 15:92098088-92098110 TTGTGGGGAAGGAGCAAGGCAGG + Intronic
1131486437 15:92824747-92824769 TCGTGGGGGAGGAGGAAGGAAGG + Intergenic
1131579217 15:93625599-93625621 CTGAGGGGGAGGAAGAGGAATGG + Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132199026 15:99935227-99935249 TTGTGGTGCAGGAGGAAGTAAGG + Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133023634 16:2977917-2977939 CTTGGGGGCAGGTGGAAGAAAGG - Intronic
1133033572 16:3022819-3022841 TTGTGGGGAAGAAGGAAGGTGGG + Exonic
1133070067 16:3240367-3240389 CTCTGGGGAATGGGGGAGAATGG + Intergenic
1133197173 16:4179330-4179352 CTGTGGGGTATTAGGAATAAAGG + Intergenic
1133438596 16:5801583-5801605 CTTTGGGGAATGAGGTTGAAAGG + Intergenic
1133593974 16:7272899-7272921 GGGAGGGGAGGGAGGAAGAAAGG - Intronic
1133760616 16:8795868-8795890 GTGTGGGCAAGGCTGAAGAAAGG - Exonic
1133873333 16:9710116-9710138 CTGTGTGGAAGGCGGAAGATGGG - Intergenic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134210847 16:12275294-12275316 CTGGGGAGAGGGAAGAAGAATGG + Intronic
1134219889 16:12345628-12345650 CTGTGGAGGAGGTGGATGAATGG + Intronic
1134360953 16:13530690-13530712 CTGTAAGGAAGGAAGAAAAAGGG - Intergenic
1135044040 16:19140151-19140173 CTGGGGAGAAGAAAGAAGAAAGG - Intronic
1135050015 16:19185145-19185167 AGGAGGGGAAGGAGGGAGAAAGG - Intronic
1135050744 16:19191017-19191039 GTTTGGGGAAGGAAGAACAAGGG + Intronic
1135511288 16:23086092-23086114 TTTGGAGGAAGGAGGAAGAAGGG - Intronic
1135869556 16:26136804-26136826 ATGTGGGGAGGGAGGAAGTCAGG - Exonic
1135938608 16:26801834-26801856 CCCTGGGGCAGGAGGAAGCAAGG - Intergenic
1135953373 16:26935849-26935871 CTGTGGGGAGTTGGGAAGAAGGG + Intergenic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136985778 16:35103019-35103041 CAGTGGGGAAGGGGCAGGAAGGG - Intergenic
1137252964 16:46753261-46753283 GTGTGGGGCAGGAGGAGGGATGG - Intronic
1137253440 16:46756973-46756995 GTGAGGGGCAGGAGGAGGAAGGG + Intronic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137800876 16:51260919-51260941 CTGAGGGAGAGAAGGAAGAAGGG - Intergenic
1137803716 16:51284573-51284595 GTTTGGGGAAGGAGGAGGATGGG + Intergenic
1138085196 16:54127093-54127115 GTGTGGGGAAGCAGAGAGAATGG - Intergenic
1138170073 16:54840675-54840697 CTGTGGGGACTGTGGAAGCATGG - Intergenic
1138316548 16:56075225-56075247 TTGGGGGGAAGGAGGAAGAGAGG - Intergenic
1138343859 16:56308093-56308115 CTGCAGGAAAGGAGGAAGAGTGG + Intronic
1138510815 16:57507616-57507638 CTGTGGGGCTTGAGGAAGACTGG + Intergenic
1138786453 16:59852170-59852192 CTGGGGGGAAGGATGAAGATTGG - Intergenic
1139509607 16:67419552-67419574 CTGGGGTGGAGCAGGAAGAATGG - Intergenic
1139592727 16:67942497-67942519 CTGTGGCCAATGAGGAAGACAGG + Exonic
1139641443 16:68294525-68294547 CTGTAGGGAAGGGGGGAGCAGGG + Intronic
1139690147 16:68635955-68635977 TTTAGGGGAAGGATGAAGAATGG + Intergenic
1139993251 16:70956641-70956663 TGGCTGGGAAGGAGGAAGAAGGG + Intronic
1140067089 16:71620801-71620823 CTGCAGGGAGGGAGGAAGAAAGG - Intergenic
1140236122 16:73160512-73160534 CTGTGGGGTAGGAAAAAAAAAGG - Intergenic
1140237481 16:73172304-73172326 CTGGCGGGCAGGAGGAAGGAGGG - Intergenic
1140638437 16:76943857-76943879 CAGAGGGGGAGAAGGAAGAAAGG - Intergenic
1141053914 16:80798412-80798434 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1141216970 16:82033759-82033781 ATGAGGGGCAGGAGGAGGAAGGG - Intergenic
1141233281 16:82191355-82191377 TTGGGGGGAAGGGGGGAGAAGGG - Intergenic
1141514559 16:84535091-84535113 TGGGGGAGAAGGAGGAAGAAGGG - Intronic
1141632192 16:85294176-85294198 GTGGAGGGAAGGAGGCAGAAGGG - Intergenic
1141801481 16:86312379-86312401 GTGCGGGGAAGGAGAAAGCAGGG - Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141964427 16:87432414-87432436 CTGGGCAGCAGGAGGAAGAAAGG - Intronic
1142219050 16:88844042-88844064 CTGTTTGGAAGCAGGTAGAAGGG + Intronic
1142244017 16:88960585-88960607 CAGGCAGGAAGGAGGAAGAAGGG - Intronic
1142478718 17:204949-204971 CAGTCGGGAAGGAGGGAGCAGGG + Intergenic
1142684875 17:1571968-1571990 CTGGCGGGAAGGAGCAGGAAGGG - Intronic
1143157290 17:4846035-4846057 TCATGGGGAAGGAGGAAAAAGGG + Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143391498 17:6561548-6561570 ATGAGGAGAAGGAGGAAGAGGGG - Intergenic
1143555182 17:7655504-7655526 CTGTGGGGGTGCAGGAAGATAGG - Intronic
1143592468 17:7893906-7893928 CTGGGTGGCAAGAGGAAGAAAGG + Exonic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144162716 17:12577628-12577650 CTCTGAGGCAGGAAGAAGAATGG - Intergenic
1144713759 17:17420372-17420394 CAGTGTGCAAGGAGGAAGCAGGG + Intergenic
1144844416 17:18208930-18208952 CTCTGCCGCAGGAGGAAGAAAGG - Exonic
1145037595 17:19552136-19552158 CAGGAGGGGAGGAGGAAGAAAGG + Intronic
1145259931 17:21348759-21348781 CAGAGGGGAAGGAGAAGGAAGGG - Intergenic
1145409072 17:22640228-22640250 GTTAGGGGAAGGAGGAAGAAGGG - Intergenic
1145863571 17:28226681-28226703 GCGGGTGGAAGGAGGAAGAAGGG + Intergenic
1145869274 17:28260149-28260171 GTGTGGAGAAGGAGGAAACAGGG - Intergenic
1145924231 17:28633796-28633818 CTGGAGTGAAGGAGGAAGAGAGG - Intronic
1145978554 17:28998120-28998142 CTATGGGGAGGGAGGAGGGATGG + Intronic
1146123890 17:30217305-30217327 CTGGGGTGAAGGAGAAAGAAAGG + Intronic
1146200510 17:30853435-30853457 TTGGCGGGAAGGAGGAAGATGGG - Intronic
1146918358 17:36692599-36692621 GTGGGAGGAAGGAGGAAGAGAGG - Intergenic
1147043691 17:37737140-37737162 GTGAGGAGAAGGAGGAAGAGGGG - Intronic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147219907 17:38922466-38922488 TTGTGAGGAAGAAGGAAGAAAGG - Intergenic
1147252388 17:39160788-39160810 CTGTGAGGCAGTAGGAAGGAAGG - Intronic
1147269448 17:39257596-39257618 CTGTTGGATATGAGGAAGAAAGG - Intergenic
1147387087 17:40089118-40089140 GTGTGGGGACGTGGGAAGAAAGG - Intronic
1147390538 17:40106647-40106669 ATGTGGGGGAGGTGGAGGAAAGG + Intergenic
1147478734 17:40738721-40738743 ATGTGGGCCAGGAGGCAGAAAGG - Intergenic
1147558197 17:41492966-41492988 CTTGGGGGCAGGAGGAAGAAGGG + Intergenic
1147597321 17:41725323-41725345 CTGGTGGGAGGGAGGAAGAATGG + Intronic
1147627240 17:41908081-41908103 CCCTGGGGGAGGAGGAAGATGGG - Intronic
1147976791 17:44252647-44252669 ATGTGGGGGAGAAGAAAGAAGGG - Intronic
1148012426 17:44494134-44494156 CTGTAGGGAATGAGCTAGAAAGG - Intronic
1148075521 17:44933243-44933265 CTGGGGGGAGGGAGGAAGAGAGG + Intronic
1148266722 17:46231895-46231917 CAGTGGGGAACGGGGAAGAGAGG + Intergenic
1148340980 17:46873281-46873303 GAGTGGGGAGGGAGGTAGAATGG - Intronic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1148794665 17:50191246-50191268 CAGAGGGGAAAGGGGAAGAAGGG + Intronic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149136757 17:53375750-53375772 CTAGAGGGAAGGAGGAGGAAGGG - Intergenic
1149536632 17:57438409-57438431 AGGAGGGGATGGAGGAAGAAGGG - Intronic
1149657062 17:58315797-58315819 CACTGGGGAAAGAGAAAGAAGGG - Intronic
1149658086 17:58320606-58320628 CTGGAGGGAAGGAGAAGGAATGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1149857907 17:60099487-60099509 TTATGGGGCAGGAGGAGGAAAGG + Intergenic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150325893 17:64257236-64257258 CTGTGTGGAAGCTGGGAGAATGG - Intronic
1150371792 17:64645055-64645077 AGGTGGGGAAGGAGGAAGATGGG + Intronic
1150494904 17:65599955-65599977 CTGAAGGGAAGGAGGAAGTTGGG + Intronic
1150628619 17:66859879-66859901 AGGTGGAGAAGAAGGAAGAAGGG - Intronic
1151080439 17:71323250-71323272 AGGTGGGGCAGGAAGAAGAAAGG + Intergenic
1151523567 17:74648257-74648279 CCATGGGGAAGGAGGGAGAGGGG + Intergenic
1151597922 17:75089091-75089113 CTTTGGGCAAGGAGGTAGACAGG - Exonic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1151828219 17:76535417-76535439 CAGTGGGGGAAGGGGAAGAAAGG - Intronic
1152203657 17:78961810-78961832 ATCTGGGGAATGAGGAAGAGTGG + Intergenic
1152243020 17:79170049-79170071 GGGAAGGGAAGGAGGAAGAAAGG + Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152367933 17:79867629-79867651 GAGAGGGGAAGAAGGAAGAAAGG + Intergenic
1153201895 18:2655707-2655729 CTGTGGCGCAGGAGGAAGAGCGG - Intergenic
1153332043 18:3883412-3883434 CTGGGAGACAGGAGGAAGAAAGG - Intronic
1153343757 18:4004405-4004427 CGGAAGGGAAGGGGGAAGAAGGG - Intronic
1153439875 18:5104479-5104501 CTCTGGGGAAGGTGGTAGGAAGG - Intergenic
1153501745 18:5756548-5756570 CTATGCGGGAGGAGGAAGAGTGG - Intergenic
1153629372 18:7054740-7054762 CTGAGGAGGAGGAGGAAGAGGGG - Intronic
1153756772 18:8291914-8291936 CTCTAGGGAAGGAAGAATAAAGG + Intronic
1153927135 18:9843963-9843985 CTCTGGGGCAGGTGGAGGAAGGG + Intronic
1154002514 18:10494517-10494539 GTGTGGGGAAGGAGGATGGGAGG - Intergenic
1154046956 18:10915217-10915239 CTGTGTGTAAGAGGGAAGAATGG + Intronic
1154174706 18:12077811-12077833 CTGTGTGTAAGAGGGAAGAATGG - Intergenic
1154284020 18:13034863-13034885 CTGTCGGCAAGGAGGAAGGCAGG - Intronic
1154369640 18:13748133-13748155 CTTTTGGGAAGGAAGAAGATTGG + Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155433681 18:25788230-25788252 CTGTGCGGAAGGATAAAGCAGGG - Intergenic
1155438034 18:25833515-25833537 CTGTGGGGAATTAGGCTGAAAGG - Intergenic
1156009912 18:32484900-32484922 CTGAGAAGGAGGAGGAAGAAAGG + Intergenic
1156233660 18:35180080-35180102 CAGTGGGGAAGTCGGAAGTATGG - Intergenic
1156233685 18:35180257-35180279 CTATGGAGAAAAAGGAAGAAGGG - Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1157139081 18:45087606-45087628 GTGTGGGCAAAGAGGATGAATGG + Intergenic
1157569812 18:48704873-48704895 GGTTGGGGAAGGAGGAAGCATGG + Intronic
1157615651 18:48986269-48986291 TTTTGGGGAGGGAGAAAGAATGG - Intergenic
1157636963 18:49168169-49168191 CTCTGAGGAAGGAGGAAAAAGGG + Intronic
1157897987 18:51486636-51486658 CTATGAGGAGGGAGGGAGAAGGG + Intergenic
1158169834 18:54585437-54585459 CTGGGGGAAAGTAGGAAGAGTGG - Intergenic
1159046917 18:63377593-63377615 AAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1159320767 18:66845048-66845070 CTATAGGGAAGAAGGAAGCAGGG + Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1160002600 18:75040991-75041013 CTGAAGGGAAGGAAGAACAAGGG + Intronic
1160181073 18:76636943-76636965 CTGGGAGGAAGGAGAAGGAATGG - Intergenic
1160255966 18:77249558-77249580 CTGGGGAGGAGGAGGAGGAAAGG + Intergenic
1160323225 18:77915551-77915573 CTGTGGGGCAGGGGCAAAAAAGG - Intergenic
1160480704 18:79237315-79237337 CAGTGGGGAAGGAGCAGGAGTGG - Intronic
1160847938 19:1174539-1174561 TTCTGAGGAAGGAGGAAAAAAGG - Intergenic
1161139617 19:2639760-2639782 GAGGGGGGAAGGGGGAAGAAGGG + Intronic
1161141648 19:2651420-2651442 CAGGAGGGAGGGAGGAAGAAAGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161398710 19:4058441-4058463 CCGAGGGGAAGGCGGAAAAAAGG - Intronic
1161874564 19:6897953-6897975 GGGTGGGGAAGTAGGAAGGAAGG - Intronic
1161878058 19:6927206-6927228 AAGAGGGGAGGGAGGAAGAAGGG - Intronic
1161879424 19:6937451-6937473 CGGTGGGGAAGGGGGGAGAGGGG - Intronic
1162300980 19:9844821-9844843 CCATGGGGAAGGAGGGAGACAGG - Intronic
1162317009 19:9945654-9945676 CTCTGGGGGAGGAGGAGGGAAGG + Intergenic
1162331135 19:10030548-10030570 CTGTGTAGTAGGAGGAAGAGAGG + Intergenic
1162583763 19:11546645-11546667 GAGTGGGGAAGGGGTAAGAAAGG - Intronic
1162729669 19:12710772-12710794 CCCTGGGGAAGGGGGAACAATGG + Exonic
1162732466 19:12727077-12727099 CTTTGGGGGAGGAGGAGGTAGGG + Intergenic
1162761700 19:12892294-12892316 CTGTTGGGGGGGAAGAAGAAAGG - Intronic
1162792867 19:13072096-13072118 TTGTGGGGCAGGAGGAAGCCAGG - Intronic
1162823189 19:13235731-13235753 CTGGGGAGATGGAGGAAGAGGGG + Intronic
1162913779 19:13863881-13863903 CTGTGGTGGAGGAGGCTGAAAGG + Intronic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163298334 19:16427082-16427104 ATGGAGGGAGGGAGGAAGAAGGG + Intronic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163588454 19:18176803-18176825 CACTGTGGAAGGAGGATGAAGGG + Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1164249714 19:23466213-23466235 TTTTGGGGAAGGAGGAGGAGAGG - Intergenic
1164324718 19:24181190-24181212 CTGTGGAGGAGGAGGAGGAGAGG + Intergenic
1164730966 19:30504298-30504320 CTGGTGGGAGGGAGGAAGGAAGG - Intronic
1164794444 19:31014771-31014793 TTGGAGGGAAGGAGGAAGAGAGG + Intergenic
1164876550 19:31694623-31694645 CTGTGATGAAAGATGAAGAAAGG + Intergenic
1165028215 19:32977511-32977533 CCGGGGGGAGGGAGGAACAAAGG - Exonic
1165176014 19:33930359-33930381 CCTTGGGGAAGGAGGAGGAGCGG + Intergenic
1165205889 19:34185434-34185456 GTGTGGGTAAGGGTGAAGAAGGG + Intronic
1165577895 19:36837444-36837466 GTTTGTGGAGGGAGGAAGAAAGG - Intronic
1165855492 19:38877468-38877490 GTGTGGGAAGGGAGGAAGAGGGG - Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1166870538 19:45867808-45867830 ATGGGCTGAAGGAGGAAGAAAGG + Intronic
1167040780 19:47021393-47021415 CTGGTGGGAAGGAGGAGGAAGGG - Intronic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167526660 19:49988491-49988513 CCCTGGGGAAGGAGGAGTAAAGG + Exonic
1167741399 19:51326739-51326761 GTGGGGGGAAGGAGGAGGAGGGG - Intronic
1167752075 19:51387450-51387472 CTGTGGGGAAGGGGAGAGATGGG + Intronic
1168434916 19:56309291-56309313 CTGAGGGGAGGAAGGAACAAGGG + Intronic
1168682886 19:58328789-58328811 ATGAGGGGAAGGAGGAGCAAGGG - Intronic
924972500 2:141793-141815 GGCTGGAGAAGGAGGAAGAAAGG + Intergenic
924972506 2:141836-141858 CGCTGGAGAAGGAGGAAGAAAGG + Intergenic
925027264 2:619946-619968 CTGTGGGCATGCAGGAAGAGGGG + Intergenic
925719536 2:6813714-6813736 CGGGGAGGAAGAAGGAAGAAAGG + Intergenic
926123803 2:10259038-10259060 CTCTGGGGAAGCAGACAGAAGGG - Intergenic
926198134 2:10775820-10775842 CTGGTGGGCATGAGGAAGAAGGG - Intronic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926884185 2:17582225-17582247 GTGAGGGGAAGGAGGAAGGTGGG + Intronic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927343780 2:22012823-22012845 CTGTAGGGAAGCAGGAGGAATGG - Intergenic
927397642 2:22672280-22672302 GGGTGTGGAGGGAGGAAGAAAGG + Intergenic
927696734 2:25244452-25244474 CTGTGGGGAAGGGAGAGGAGGGG + Intronic
927702146 2:25275544-25275566 CTGTGGAGAGGGAAGAACAAAGG + Intronic
927726755 2:25430706-25430728 CAGTGGGGAAGGTGGAGGCAAGG + Intronic
927734430 2:25506146-25506168 GGGTGGGGAAGGATGAAGAGAGG + Intronic
927739474 2:25554924-25554946 CTCTGAGGAAGGAGGAAAATGGG + Intronic
927890281 2:26743841-26743863 CTGAGGGGAAGGAGGTGGAGTGG - Intergenic
927932500 2:27054069-27054091 CTGTGTGGCAGGAGTAAGAATGG - Intronic
928202139 2:29254508-29254530 ATCTGGTGAGGGAGGAAGAAGGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
928875915 2:36039357-36039379 CTTTGGGGAAGGAGTAAGATTGG - Intergenic
929399896 2:41567516-41567538 CTGTGTGGTAGGGGGAAGAGTGG - Intergenic
929580298 2:43078021-43078043 CTGTTGGGAAGGATGAGGCAGGG + Intergenic
930231034 2:48843976-48843998 CACTGGGGTAGGAGGAAGGATGG + Intergenic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930928546 2:56851697-56851719 GAGGAGGGAAGGAGGAAGAAAGG - Intergenic
931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG + Intergenic
931707572 2:64960035-64960057 CAGTGGGGAAGCAGGGGGAAAGG - Intergenic
931847923 2:66223524-66223546 CTGGGAGGGAGGAGGAAAAAAGG + Intergenic
931977471 2:67658502-67658524 TGGAGGGGAAGGAGCAAGAATGG - Intergenic
931992796 2:67807891-67807913 AAGTGGAGGAGGAGGAAGAAGGG - Intergenic
931998269 2:67859756-67859778 TTGTGGGGAAGGTGGAAGCTTGG - Intergenic
932475051 2:72000278-72000300 CTGGGGGCAAGGACGAAGCAGGG - Intergenic
933191064 2:79334623-79334645 ATGGAGGGAGGGAGGAAGAAAGG + Intronic
933581258 2:84129471-84129493 CTTTGGGGAAGGGTTAAGAAGGG + Intergenic
933747690 2:85582906-85582928 ATTTGGGGAGGGAGGAGGAAAGG + Intergenic
934524387 2:95042628-95042650 CTGTGGGGTCGGAGGAAGTCTGG + Intronic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934719117 2:96560756-96560778 CTGTGGGGATGTGGTAAGAAGGG - Intergenic
934769752 2:96900264-96900286 CTGTGAGGAAGGAAGAACAGAGG - Intronic
934859126 2:97749365-97749387 GTGTGGGAAAGGAGGGAGATGGG + Intergenic
935214827 2:100967760-100967782 CTCTGGGGAAGGGGGAAGCCTGG + Intronic
935269695 2:101423288-101423310 AGGATGGGAAGGAGGAAGAAAGG + Intronic
935369725 2:102332646-102332668 TTGTGGTGGAAGAGGAAGAATGG + Intronic
935558646 2:104538198-104538220 AAGTGGGGAGGGAAGAAGAAGGG + Intergenic
935675751 2:105593966-105593988 CTGTGGGGAAGGCTGAAGAGAGG - Intergenic
935794483 2:106628159-106628181 CTGGGGGCAAGAAGCAAGAAGGG - Intergenic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936865801 2:117075050-117075072 CTATGGGGAAGGAGCAAGCAGGG - Intergenic
936919561 2:117673897-117673919 CTGTGGGGCAGAAGGAAATAGGG + Intergenic
936992610 2:118382204-118382226 CTGAGGAGGAGGAGGAAGAGGGG - Intergenic
937197568 2:120173273-120173295 CTGGGGAGAGGGTGGAAGAAAGG + Intronic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
937962142 2:127468358-127468380 GTGTGAGGAGGGAGGCAGAATGG - Intronic
937997999 2:127709571-127709593 CTGTTGTGTAGGAGGAAGGAAGG - Exonic
938003910 2:127771771-127771793 CTGTTGGAAAGAAGGAAGGAGGG + Intronic
938117011 2:128608972-128608994 CTGTGTGGAGGGTGGAAGCATGG + Intergenic
938122584 2:128644383-128644405 CTGGGGGGATGGGGGAAGAGGGG - Intergenic
938164449 2:129014574-129014596 CTGGGAGGGAGGAGGAAGAGGGG - Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
938909354 2:135872042-135872064 CTGTGGGGAAAAAGGATCAATGG + Intronic
938976784 2:136486312-136486334 CAGTGGGGAATGAGAAAGACTGG + Intergenic
939081568 2:137668893-137668915 CTGAGGAGGAGGAGGAAGAAAGG + Intronic
939238691 2:139531379-139531401 CTGTGTGGAAGGAGAGAGATTGG + Intergenic
939570279 2:143832483-143832505 CTGGGGTGAAGGAGGAGGGAAGG + Intergenic
939688444 2:145227875-145227897 CTGTGAGGGTGGAGAAAGAAGGG + Intergenic
939914148 2:148020132-148020154 CTTTGGGGAAGGAGCAGGCAGGG - Intronic
939922676 2:148136316-148136338 CTGGGGGGTAGGGGGAAGAATGG + Intronic
940215985 2:151304050-151304072 CTGTGGTTAAATAGGAAGAAGGG - Intergenic
940300420 2:152171149-152171171 CTCGGAGAAAGGAGGAAGAATGG + Intronic
940317934 2:152344319-152344341 CTTTGGGGTAGGAAGAAAAAGGG - Intronic
940372909 2:152922623-152922645 ATGGAGGGAAGGAGGAAGGAAGG - Intergenic
940684270 2:156826764-156826786 ATGTGCGGAAGAAGGAAAAAGGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941395830 2:164971622-164971644 CTGGGAAGAAAGAGGAAGAAAGG - Intergenic
941399012 2:165007805-165007827 TTGAGGGGAATGAGGAAGTAGGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941733442 2:168945592-168945614 CGGAAGGGAAGAAGGAAGAAAGG + Intronic
941770353 2:169338137-169338159 AAGTAGGGAAGGAGGAAGAGAGG + Intronic
941819877 2:169833686-169833708 CTGAGGGGTAGGATGGAGAAAGG - Intronic
942588621 2:177515467-177515489 CTTGGGGGCAGAAGGAAGAAGGG - Intronic
942618165 2:177816377-177816399 GTTGGGGGAGGGAGGAAGAAAGG + Intronic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
943548255 2:189308253-189308275 ATGATGGGAAGGAGGAAGGAGGG + Intergenic
943806217 2:192130280-192130302 CAGAGGAGAAGGAGGAGGAAGGG - Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944916025 2:204361117-204361139 GGGTGGGCAGGGAGGAAGAAAGG - Intergenic
944994450 2:205277948-205277970 TTTGGGGGAAGGAGAAAGAAAGG + Intronic
945614784 2:212054068-212054090 CTGTGGGGCAAGAGGAGGAGGGG - Intronic
945618406 2:212103163-212103185 CTTTGGGGCAGGAGGAAGTTAGG - Intronic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
946143961 2:217714566-217714588 CTGAGGGGAATTAGGAAGACAGG + Intronic
946350741 2:219150227-219150249 ATGTGGGGAGGTGGGAAGAAAGG + Intronic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946693392 2:222327433-222327455 CTGAGGAGGAGGAGGAAGAGGGG - Intergenic
946928123 2:224645707-224645729 CTCTGGGGCAGGAGAAAGACTGG + Intergenic
947291215 2:228576756-228576778 GTGGGGGGAAGGAAAAAGAAAGG - Intergenic
947295819 2:228628839-228628861 ATGTGGAGAAGGAGGCAGATTGG + Intergenic
947374358 2:229480976-229480998 CTGGGGTGTAGGAGGAAGCAGGG + Intronic
947531138 2:230909251-230909273 TTCTGGGGAAGGAAGAAGACAGG - Exonic
947778578 2:232735839-232735861 CTTTGGGGAAAAAGGAAGGAGGG - Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948159895 2:235814959-235814981 CTATGGGGACAGAGTAAGAAGGG - Intronic
948316552 2:237031805-237031827 GTATGGGGAAAGAGGAAGGAGGG + Intergenic
948440653 2:237985358-237985380 GAGTGGGGAAGGGGGCAGAATGG - Intronic
948485738 2:238279701-238279723 CTGGTGGGAAGGAGGTGGAAGGG - Intronic
948811280 2:240479671-240479693 GTGTGGGGGAGGGGGAAGAGGGG + Intronic
948813211 2:240495889-240495911 AAGTGGGGAAGGAGGAGGAGAGG - Intronic
948875358 2:240824076-240824098 CTCTGGGGAGGGAGGCAGCAAGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168780286 20:483490-483512 CTCAGGGGAGGCAGGAAGAAAGG - Exonic
1168928646 20:1603590-1603612 GTGTGCTGAATGAGGAAGAAAGG - Intronic
1169354782 20:4897358-4897380 CTGTGGGGAGGATGGAAGCAGGG + Intronic
1169359668 20:4937411-4937433 CAGTGGGGAAGGAGGAGCAGAGG + Intronic
1169451524 20:5716080-5716102 CGGAGGTGAAGGAGGTAGAAGGG + Intergenic
1169813245 20:9630115-9630137 GTGTGAGGAAAGAGGAAGATTGG + Intronic
1170277921 20:14613485-14613507 CAGTGGGGAGGAAGAAAGAAGGG + Intronic
1170501867 20:16982613-16982635 AAGTGGGGAGGGAGGAAGAAGGG - Intergenic
1170858625 20:20081632-20081654 GTGTAGGAAAGGAGGCAGAAAGG - Intronic
1170982565 20:21228475-21228497 CCATGGGGAAGGAGCGAGAACGG - Intronic
1172480294 20:35267459-35267481 ATGTCGGGGAGGAGGAGGAAAGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173010741 20:39179347-39179369 ATGTGGGGAATGAGGAACAGAGG + Intergenic
1173660393 20:44729289-44729311 CTGCTGGGAAGGTGGAAGAGAGG + Intergenic
1173722621 20:45272825-45272847 CTGGGGGGATGGAGAAAGCATGG - Intergenic
1173741669 20:45406433-45406455 CTGGGCGGAGGGAGGAAGGATGG + Intronic
1173801956 20:45899588-45899610 GTGTGAGGATGGAGGAAGAAAGG - Intronic
1173923222 20:46761601-46761623 CTGTCGGGAAGGAGGGAGCTGGG - Intergenic
1173951569 20:46997570-46997592 CCCTGGGGGAGGATGAAGAAGGG + Intronic
1174137554 20:48391035-48391057 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1174413015 20:50348271-50348293 CTGTTAGGAAGGAGGAAGTGGGG - Intergenic
1174724310 20:52845322-52845344 AGGGAGGGAAGGAGGAAGAAAGG - Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1175163644 20:57027631-57027653 CAGTGAGGAAGAAGGAAGAATGG + Intergenic
1175700619 20:61134327-61134349 CAGCAGGAAAGGAGGAAGAATGG - Intergenic
1175773533 20:61638667-61638689 ATGTGGGCAGAGAGGAAGAAAGG - Intronic
1175916150 20:62426976-62426998 CTGTGGGGAAGCAGCCACAAAGG - Intronic
1175938473 20:62526143-62526165 CTGAGTGGAAGGAAGAATAATGG - Intergenic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1176956830 21:15115305-15115327 AAGCGGGGAAGCAGGAAGAAAGG + Intergenic
1176993443 21:15525171-15525193 ATGGGGAGGAGGAGGAAGAAGGG - Intergenic
1177140488 21:17352903-17352925 CTGTTGGGAAGGGGCAAGATGGG + Intergenic
1177335707 21:19723384-19723406 CTGAGGGCTAGGAGAAAGAAAGG + Intergenic
1177552928 21:22649264-22649286 CTGTGAGGAAAGGGAAAGAATGG + Intergenic
1177922799 21:27173782-27173804 GTTGGGGGAAGGAGGAAGAAAGG + Intergenic
1178000431 21:28156463-28156485 CTGAGGAGGAGGAGGAAGAAAGG - Intergenic
1178085888 21:29111650-29111672 CTTTGGAGAAGGGGGAAGAAAGG - Intronic
1178300633 21:31450013-31450035 CTGTGGGGAGGGAAGAGGCAAGG - Intronic
1178411268 21:32365647-32365669 CTGTGTGGGAGTAGGCAGAAAGG - Intronic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1178832841 21:36070728-36070750 ATTGGGGGAAGGAGGATGAAGGG - Intronic
1178941880 21:36913408-36913430 GGGTGGGGTAGGAGGGAGAAGGG + Intronic
1179005234 21:37508072-37508094 GTGTGGGGAAAGAGGGAGAGAGG - Intronic
1179127656 21:38605037-38605059 CTGTGTGGAAGCTGGAAGAGAGG - Intronic
1179223137 21:39427280-39427302 GGGCAGGGAAGGAGGAAGAAAGG + Intronic
1179286910 21:39985347-39985369 ATGCAGGGATGGAGGAAGAAGGG - Intergenic
1179619755 21:42605953-42605975 CTCTGGGGAAACAGGTAGAAAGG + Intergenic
1180738303 22:18035076-18035098 CCTTGGGGAAGGCTGAAGAATGG + Intergenic
1180951250 22:19721618-19721640 CCTGGGGGAAGGAGGGAGAAAGG - Exonic
1181359979 22:22327081-22327103 CACAGGGGAAGAAGGAAGAAGGG - Intergenic
1181370002 22:22408529-22408551 CACAGGGGAAGAAGGAAGAAGGG - Intergenic
1181853982 22:25769325-25769347 CTCTGGAGAAGGATGCAGAAAGG + Exonic
1182051042 22:27313096-27313118 GTGTGGGGGAGGAGGAGGAAAGG + Intergenic
1182103481 22:27673011-27673033 ATGAGGAGAAGGAGAAAGAAAGG + Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1182282718 22:29226467-29226489 CTGCGGGGAGGGAGGAAGCTGGG - Intronic
1182322733 22:29489082-29489104 AGGAGGGCAAGGAGGAAGAAGGG + Exonic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182755143 22:32673229-32673251 CTGTGGGGAAGAGGGAAGAGGGG + Intronic
1183194042 22:36341002-36341024 CTGTGGGGAAGAAGCAAGAAAGG + Intronic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183269156 22:36849947-36849969 CTGTAGGGATGGAGGAGGAGAGG + Intergenic
1183275487 22:36894493-36894515 CTGTGAGGTTGGAGGAAGAGAGG + Intergenic
1183698795 22:39438154-39438176 ATGGAGGGAAGGAGGAAGGAAGG - Intergenic
1184066872 22:42126263-42126285 ATGTGGGGAAGGGGCCAGAATGG - Intergenic
1184069600 22:42139969-42139991 ATGTGGGGAAGGGGCCAGAATGG - Intergenic
1184096187 22:42317726-42317748 CAGTGGGGAGGGTGGAAGAAGGG + Intronic
1184157957 22:42681118-42681140 ATCCGGGGAAGGAGGAAGAGAGG - Intergenic
1184484280 22:44766694-44766716 CTGGGGAGAGGAAGGAAGAAAGG - Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184612349 22:45612862-45612884 CTCTGGGGAAGGAGGAAAACAGG + Intergenic
1184730096 22:46367093-46367115 CAGTGGAAAAGGAGGACGAAGGG + Exonic
1184749229 22:46474728-46474750 AGGTGAGGAAGGAGGAAGAGGGG - Intronic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
1185363767 22:50425153-50425175 CTGTGGAGAGGGAGAATGAATGG - Intronic
949161120 3:883393-883415 ATGTGGGGAATGAGGCAGATGGG - Intergenic
950011097 3:9724409-9724431 ATGTGGGGGAGAAGGAAGCAAGG + Intronic
950156886 3:10728080-10728102 CTCTGGGAAAGGATAAAGAAAGG - Intergenic
950195257 3:11005139-11005161 CTCAGAGGCAGGAGGAAGAAAGG + Intronic
950378861 3:12594178-12594200 CTGTGGGGACTCAGAAAGAAGGG + Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950617070 3:14168458-14168480 CTGCTGGGAAGGAGGAAGTGAGG + Intronic
950630117 3:14276677-14276699 AGGTGAGGAAGGAGGAAGGAGGG + Intergenic
951261240 3:20512123-20512145 CTGTAGGAAAGGATGAAGATAGG + Intergenic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951435007 3:22651928-22651950 CTTTGGGGACGCAGGAGGAAAGG + Intergenic
951510025 3:23489910-23489932 ATGGGGGGAAGGGGAAAGAAAGG - Intronic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951708752 3:25568939-25568961 CTGTGCTGCAGGAGGAAGCACGG + Intronic
951826359 3:26873581-26873603 TTGTGGTGAAGAAGGAAAAAAGG + Intergenic
951928587 3:27937986-27938008 GTATAGGGAAGGAGGAAAAATGG + Intergenic
952373989 3:32749908-32749930 AAGGAGGGAAGGAGGAAGAAAGG + Intronic
952487690 3:33831676-33831698 CTATGGGGCAGTAGGAATAATGG - Intronic
953016332 3:39080251-39080273 ATGTTTGGAGGGAGGAAGAATGG + Intronic
953228369 3:41041878-41041900 CTGTTGGAAAGGAGGAGGAAGGG + Intergenic
953357400 3:42266569-42266591 AAGGAGGGAAGGAGGAAGAAAGG - Intergenic
953496307 3:43390272-43390294 CAGTGGGGAAGGAGGAGGGGAGG - Intronic
953988292 3:47462863-47462885 CTATGGGGAAGCAGGAAGGGAGG - Intronic
954366787 3:50150696-50150718 CAGTGCAGAAGGATGAAGAAGGG + Intergenic
954635411 3:52068382-52068404 TTGTGGAGGAGGAGGAAGAAAGG + Intergenic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955162294 3:56476117-56476139 CTGTGGCCAAGGAGGAAAAGTGG - Intergenic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
955213776 3:56966504-56966526 TGGTGGGGAAGGAGGCAGAAAGG + Intronic
955400822 3:58590309-58590331 CTGTGGGGTTGCAGGAAGACAGG - Intronic
955460259 3:59174337-59174359 GTGGGGGGGAGGAGGAAGTAGGG - Intergenic
955483676 3:59414505-59414527 CTCTGGGGAAGGGTGAAGAAGGG - Intergenic
955723708 3:61910208-61910230 CTGTGGGGAATGGGTAAGAATGG - Intronic
955929923 3:64046331-64046353 TTGAGTGGAAGAAGGAAGAAAGG - Intergenic
955977187 3:64490239-64490261 CTGTGGGAAAGGAGGATGCCTGG - Intergenic
956468806 3:69543641-69543663 TGGAGGAGAAGGAGGAAGAAAGG - Intergenic
956741443 3:72279290-72279312 GTGAGGGGAGGGAGGGAGAAAGG + Intergenic
956873824 3:73442982-73443004 TTCAGGTGAAGGAGGAAGAAAGG - Intronic
957206243 3:77202701-77202723 ATGTGAGGAAGAAGGAAGGAGGG - Intronic
957320758 3:78627392-78627414 CTGTGGGGAGGGAGTCAGAGTGG + Exonic
957337714 3:78853229-78853251 GTGATGGGAGGGAGGAAGAAAGG + Intronic
957794187 3:84981663-84981685 AGGGAGGGAAGGAGGAAGAAAGG - Intronic
957982471 3:87526853-87526875 CAGTAGGTAAAGAGGAAGAAAGG - Intergenic
958054597 3:88393040-88393062 CAGGAGGAAAGGAGGAAGAATGG + Intergenic
958426503 3:93984461-93984483 CTGAGGAGAAAGAGGAAGAGGGG + Intronic
958912196 3:100006388-100006410 TTATGGGGAAGGAGGAAAAAAGG - Intronic
958915887 3:100049663-100049685 CTGAGAAGGAGGAGGAAGAAGGG - Intronic
958923092 3:100127810-100127832 GTGAAGGGAAGCAGGAAGAAAGG + Intronic
959416179 3:106078743-106078765 CTATAGGGAGGGAGGAAGGAAGG - Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
961048002 3:123722505-123722527 GTGTGGTGGAGGAGGAAGACGGG + Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961697810 3:128718093-128718115 CTGTGGGAAAAGAGGAGAAAAGG + Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962378231 3:134876289-134876311 CAGGGATGAAGGAGGAAGAAAGG - Intronic
963080375 3:141386948-141386970 CACTGGGGAAGGAGGAGGCAAGG - Intronic
963192310 3:142486452-142486474 AGTTAGGGAAGGAGGAAGAAAGG - Intronic
963223486 3:142836760-142836782 CTATGGGGAAGGAATAAAAAGGG + Intronic
963782539 3:149501327-149501349 ATGAAGGGAGGGAGGAAGAAAGG - Intronic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964564323 3:158033129-158033151 GGGTGGGGGAGGAGGATGAAGGG + Intergenic
964814277 3:160700494-160700516 TTGGGGGGAAGGAAGAAGGATGG + Intergenic
964883058 3:161445825-161445847 CTGAGGGGAGGTAGGAAGAAGGG - Intergenic
966575215 3:181493396-181493418 CTTGAAGGAAGGAGGAAGAAAGG + Intergenic
966774051 3:183528571-183528593 CCGTGGGGAGGGAGCAGGAAAGG - Intronic
966792129 3:183682949-183682971 TTTTGGGGAAGGGGGGAGAACGG + Exonic
966830861 3:184007337-184007359 ATCTGGGAAAGAAGGAAGAATGG - Intronic
966880217 3:184345765-184345787 CTGAGCGGGAGGTGGAAGAAAGG + Intronic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967213139 3:187186602-187186624 CTGTGTGGAAAGAACAAGAAAGG - Intergenic
967818303 3:193817136-193817158 CTGTGAGGGCGGAGGAAGACTGG - Intergenic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
968089726 3:195892589-195892611 GGGTGGGAAATGAGGAAGAACGG + Intronic
968091687 3:195901954-195901976 CTGTGAGGAAGTCTGAAGAAGGG + Intronic
968164287 3:196452108-196452130 GTTAGGGGAAGGAGGAAGAAAGG - Intergenic
968310795 3:197681705-197681727 AAGTAGGGAAGGAGAAAGAAAGG - Intronic
969143477 4:5100340-5100362 CTGGGGGGAGGAAGGAAGGAAGG - Intronic
969260458 4:6030240-6030262 ATGGGGGGAGGGAGGGAGAAGGG + Intronic
969316291 4:6383202-6383224 CTGAGGGGGAGGAGGAAGAGTGG + Intronic
969430852 4:7153486-7153508 GTTTGGGGAAGGAGGAGCAAGGG - Intergenic
969481358 4:7448713-7448735 CGGAAGGGAGGGAGGAAGAAGGG - Intronic
969716533 4:8870834-8870856 ATGGGAGGATGGAGGAAGAAAGG - Intronic
969900029 4:10340550-10340572 CTGTCGGGAAGTGGGAGGAAAGG + Intergenic
970050124 4:11904999-11905021 CTGTGGGAAGGGAGGATGAAGGG + Intergenic
970981420 4:22103016-22103038 TTTTGGGGGATGAGGAAGAAGGG + Intergenic
971419796 4:26464903-26464925 CTTTGGGGACTGAGTAAGAAAGG + Intergenic
971793078 4:31194282-31194304 TTGTGGGGAGGGAAGAAAAACGG + Intergenic
971968499 4:33592961-33592983 GTGTTGGGAAGTAGGAACAAAGG + Intergenic
972186294 4:36532453-36532475 AGGGAGGGAAGGAGGAAGAAAGG - Intergenic
972263636 4:37437622-37437644 GGATGGTGAAGGAGGAAGAAAGG + Intronic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972469605 4:39391210-39391232 CTGTGGTGATGGAGGCTGAAGGG - Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
972813353 4:42614813-42614835 GAGTGGGAAAGGAGGAAGAGGGG - Intronic
973787843 4:54350330-54350352 CTGTAGGGAAGTAGGAGGCAGGG + Intergenic
973826595 4:54713267-54713289 CTTTGGGGACCTAGGAAGAAGGG - Intronic
973989484 4:56389723-56389745 GTGTGGGGAATGTGGAAGATGGG - Intergenic
974033898 4:56800447-56800469 GTGGGGGAGAGGAGGAAGAAAGG - Intergenic
974543494 4:63269822-63269844 CAGTGGGGAAGTAGGTAGAGAGG - Intergenic
974800269 4:66808396-66808418 CTCTGTGGAAGGAGGGAGCATGG - Intergenic
974805157 4:66869745-66869767 CTGTCGGGAATGAGGTGGAAGGG + Intergenic
975054189 4:69907645-69907667 CTGTTGGGAAGAAAGAAGAGAGG - Intergenic
975370583 4:73581705-73581727 CTGTGGAGAAAGGGGAGGAATGG - Intronic
975510639 4:75190944-75190966 CTGTGGTGAAGGAAGAAGAGAGG - Intergenic
975654049 4:76623194-76623216 TTATAGGGAAGAAGGAAGAAAGG - Intronic
975685172 4:76913558-76913580 TTGGGGGGTTGGAGGAAGAAAGG - Intergenic
975865675 4:78721354-78721376 CTGAGGGGAAGGAAACAGAAAGG - Intergenic
975923582 4:79422193-79422215 TTGTGGGGTAGGAGGGAGAATGG - Intergenic
976291806 4:83426347-83426369 CTGAGGGGAAGGAGAAGGAAAGG + Intronic
976362116 4:84192578-84192600 CAGAGGTGAAGGAGAAAGAAGGG - Intergenic
976512512 4:85928236-85928258 AGGTTGGGAGGGAGGAAGAAGGG - Intronic
976721513 4:88173265-88173287 CTGTGGGAAAGAGGGAAAAAAGG - Intronic
976759601 4:88533982-88534004 CAGTGGAGAAGAAGGAGGAATGG - Intronic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
978758167 4:112326521-112326543 CTGTGGAGAGAGAGAAAGAAAGG + Intronic
979496868 4:121393375-121393397 GTGTGTGGTAGGAGGAAGAGAGG - Intergenic
979610810 4:122687057-122687079 CTGGGGGGAGGGAGAAGGAATGG + Intergenic
979730607 4:124018603-124018625 AGGAAGGGAAGGAGGAAGAAAGG - Intergenic
979865066 4:125744137-125744159 AAGTGGGGAGGGAGGAAGGAAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980318783 4:131240648-131240670 ATGTGGGGAGGGAAAAAGAAGGG - Intergenic
980880630 4:138706795-138706817 CTGTGGGGCAGTGTGAAGAAGGG + Intergenic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
981183242 4:141770092-141770114 AGGGAGGGAAGGAGGAAGAAAGG - Intergenic
981288974 4:143051947-143051969 AAGCGGGGAAGGAGGGAGAAAGG + Intergenic
981558794 4:146024501-146024523 CTCTGGGGAATGAGGGGGAAAGG - Intergenic
981558822 4:146024773-146024795 CTGGGGGGAGAGAGAAAGAATGG - Intergenic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
982117759 4:152112288-152112310 CAGTGGGGAAGTAGGAGGAGAGG - Intergenic
982117930 4:152113394-152113416 GAGTGGGGAAGGAGGAGGAGAGG + Intergenic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
982521223 4:156418589-156418611 CAGAGGAGAAGGAGGAAGACAGG - Intergenic
982625583 4:157761699-157761721 ATGTAGAGAAGGAGAAAGAATGG + Intergenic
983155903 4:164348277-164348299 CTTTTGGGAGGAAGGAAGAAAGG + Intronic
983604082 4:169565793-169565815 CTGCGGGGTTGGGGGAAGAATGG + Intronic
983627674 4:169818765-169818787 CTCTCGGGAAGGAAGAAGTAAGG - Intergenic
984521724 4:180810138-180810160 CTGTTTGGAAGGATGAAAAAGGG + Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
984878286 4:184388850-184388872 CTGGGGTCATGGAGGAAGAAAGG + Exonic
985026480 4:185744044-185744066 AGGGGGAGAAGGAGGAAGAAGGG - Intronic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985179294 4:187239138-187239160 CTATGGGGAAGCGTGAAGAAGGG - Intergenic
985223389 4:187732041-187732063 CTGAGGGGGAGGAGGAGGACGGG - Intergenic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
985995155 5:3593626-3593648 CTGTGGGGAGGCAGGAATAGGGG - Intergenic
986060764 5:4187999-4188021 CTTTGGGAGAGGAGGAGGAAGGG + Intergenic
986313607 5:6571819-6571841 AAGACGGGAAGGAGGAAGAAAGG + Intergenic
986333668 5:6736806-6736828 CTGTGGGACAGGAGTAAGTAGGG - Intronic
986749811 5:10776821-10776843 CTGGTGGGAATGAGGAAGGAGGG - Intergenic
986808036 5:11327191-11327213 CAGTGGGAAAGGACAAAGAAGGG + Intronic
987061384 5:14247065-14247087 CTGTGGGGAAGGGGGAGGTGGGG - Intronic
987162420 5:15157829-15157851 AAGTGGGGAAGGAGGAAGATTGG + Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987454733 5:18129556-18129578 TAGTGGTGAGGGAGGAAGAAGGG - Intergenic
987468353 5:18299320-18299342 TAGTGGAGCAGGAGGAAGAAAGG + Intergenic
987831220 5:23098019-23098041 ATTTGGGGAAGAAGGAAGAATGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988246439 5:28688713-28688735 AGGGAGGGAAGGAGGAAGAAGGG - Intergenic
988784949 5:34557997-34558019 TTGAGGGAAAGGAGGAAGAAAGG + Intergenic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989144805 5:38238205-38238227 CTCTGAGGAAGAAGGAAAAAGGG + Intergenic
989147401 5:38262233-38262255 CTGTGGTGGGGCAGGAAGAAGGG + Intronic
989766310 5:45088525-45088547 ATGTGAGGAAGAAGGGAGAAAGG - Intergenic
989983872 5:50673168-50673190 CTGTGGGGAGGGAGTGTGAAGGG + Intronic
990249447 5:53898107-53898129 CTGAGGAGGAGGAGGAAGAGAGG + Intronic
990531665 5:56679989-56680011 CTGTGGAGGAGGAAGAAGAGTGG - Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991533415 5:67639585-67639607 ATGTGTGGGAGGAGGAAGAAAGG - Intergenic
991925047 5:71697585-71697607 TTGTAGAGAAGGAGAAAGAAAGG + Intergenic
991952792 5:71963011-71963033 GTGAGGGGGAGGAGGAACAAAGG - Intergenic
992267847 5:75035432-75035454 CACTGGGGAGAGAGGAAGAAAGG + Intergenic
992480890 5:77151712-77151734 CTGTCTGGAAGGAGTGAGAAGGG - Intergenic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
992906271 5:81349028-81349050 TTGTTGGGAAGGAGGGGGAAAGG + Intronic
992958570 5:81936048-81936070 GGCTGGGGAAGGAGGAAGAGGGG + Intergenic
993029813 5:82693152-82693174 CTGTGAGGAGGGAGGACGAGAGG + Intergenic
993042727 5:82834057-82834079 CAGTGGGGAAGGAGGCAGGGTGG + Intergenic
993536969 5:89098570-89098592 ATGAAGGGAAGGAGGAAGAGAGG - Intergenic
993549358 5:89254779-89254801 AGGAGGGAAAGGAGGAAGAAAGG + Intergenic
993605425 5:89985013-89985035 CTATGAGGAAGGAGGAATATGGG - Intergenic
993926407 5:93871907-93871929 CTATGGGAAAGGAGGAAGGGAGG + Intronic
993939025 5:94036312-94036334 CTATGGGGAATGTGGAGGAATGG - Intronic
993974101 5:94455838-94455860 AAGTGGGGAAGGATGAAAAAAGG + Intronic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994881967 5:105509581-105509603 CAGTGGGGTAGGAGGAAGTTAGG + Intergenic
994979975 5:106861756-106861778 GTGTGGGAAAGAAGGAAGATGGG - Intergenic
995058030 5:107783311-107783333 ATTTGGGTAAGGAGGAACAAGGG + Intergenic
995248360 5:109961160-109961182 GAGAGAGGAAGGAGGAAGAATGG - Intergenic
995643566 5:114285444-114285466 CTGTGATAAATGAGGAAGAATGG + Intergenic
995792897 5:115911776-115911798 CTTTGGGGGAGCAGGAAGGAAGG + Intronic
995845017 5:116484323-116484345 ATGTAAGGAAGGAGGAAGAAAGG - Intronic
996243690 5:121233427-121233449 CTGAAGGGGATGAGGAAGAAAGG + Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
996781312 5:127189697-127189719 AGGGAGGGAAGGAGGAAGAAAGG - Intergenic
997517503 5:134501463-134501485 CTGTGGGGACAGAGGAAAAGAGG + Intergenic
998919808 5:147055668-147055690 CTGTGTGGCAGCTGGAAGAAAGG + Exonic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
999232580 5:150070294-150070316 CTGGGGGGTCTGAGGAAGAAAGG + Exonic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999305174 5:150514930-150514952 CACTGGGGGAGGAGGAAGAAAGG + Intronic
999315700 5:150582554-150582576 CTGAGGAGAAGGAGGTAGAGAGG - Intergenic
999806103 5:155082767-155082789 CTATGGTGAGGAAGGAAGAAAGG - Intergenic
999910432 5:156192064-156192086 CTCTGGGAAAAGAGGAAAAATGG - Intronic
1000121238 5:158199585-158199607 CTGAGGAGAAGGAGGAGGAGTGG - Intergenic
1000129046 5:158277002-158277024 CTGTGGGGAGGGAGAAAGAGTGG + Intergenic
1000179299 5:158792361-158792383 CTGAGGGGTGGGAAGAAGAAAGG - Intronic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1000411745 5:160940778-160940800 CAGTGGTGAAGGCGGAGGAAAGG + Intergenic
1001054902 5:168441258-168441280 CTGTGGGGAAGGGGAAAAAGAGG + Intronic
1001477553 5:172061269-172061291 CTGTGGGGAGAGAGGAGGACAGG + Intronic
1001983193 5:176050840-176050862 CTGGGGGGGAGGAGGAAGTAAGG - Intronic
1002044821 5:176536111-176536133 GTGTGGGGAAGTAGGAAGGGGGG - Intronic
1002234272 5:177793212-177793234 CTGGGGGGGAGGAGGAAGTAAGG + Intronic
1002297872 5:178241406-178241428 CTTCTGGGAAGGAGGAAGGAAGG + Intronic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1002635263 5:180604311-180604333 GTGAGGGGAAGGAGGAAGCAAGG - Intronic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1002848190 6:967511-967533 CTGGGGGGAAGGATGAAGGGAGG + Intergenic
1003246518 6:4386665-4386687 CGGTGAGGAAAGAGGAAGAAGGG + Intergenic
1003521676 6:6863439-6863461 CTGACTGGAAGGAGGAGGAAGGG - Intergenic
1003698748 6:8439079-8439101 CTGTGTCAAAGAAGGAAGAAAGG - Intergenic
1003870548 6:10399368-10399390 ATGTGGGGAAAGAGGAGGAATGG - Intronic
1004201806 6:13555464-13555486 CTGTGGGGAGGGAAGAAAATGGG - Intergenic
1004559080 6:16729918-16729940 ATTTGGGGAAAAAGGAAGAAAGG - Intronic
1004630824 6:17419647-17419669 CTGTTTGGAAGCAGGAAGCATGG + Intronic
1004732307 6:18369832-18369854 ATGGAGAGAAGGAGGAAGAAGGG - Intergenic
1004751317 6:18565547-18565569 AAGAAGGGAAGGAGGAAGAAAGG - Intergenic
1004751397 6:18565873-18565895 AAGAAGGGAAGGAGGAAGAAAGG - Intergenic
1005060703 6:21774514-21774536 AAGTGGGGAATGAGGGAGAAAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1006318272 6:33303990-33304012 CTGTGGGGAAAGATTGAGAAGGG + Intronic
1006634398 6:35452066-35452088 CTTTGGGGAGTGATGAAGAAAGG + Intergenic
1006639982 6:35484866-35484888 CTGCAGGGTAGGAGGAAGGAGGG + Intronic
1006804428 6:36778958-36778980 CTGGTGGGAGGGAGGGAGAACGG + Intronic
1006816702 6:36856034-36856056 CTGGTGGGAAAAAGGAAGAAAGG + Intronic
1006876629 6:37303197-37303219 CTGTCACCAAGGAGGAAGAAGGG + Intronic
1006970864 6:38043547-38043569 AAGAGGGGAAGGAGGAAGAGGGG - Intronic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1007395634 6:41576062-41576084 CTCTGCGGAAAGAGGAGGAAGGG - Intronic
1007476131 6:42121354-42121376 GAGTTGAGAAGGAGGAAGAAAGG + Intronic
1007626070 6:43247065-43247087 GTGTGGCGGAGGAGGAAGAGGGG + Intronic
1007667916 6:43526841-43526863 AGGTGAGGAAGGAGGAAGATGGG + Intronic
1007879419 6:45146414-45146436 CTTTGGGGACTCAGGAAGAAGGG + Intronic
1007921760 6:45616717-45616739 CTGTGAGCAAGGGGTAAGAAGGG - Intronic
1007951166 6:45873680-45873702 CTGTGAGGAGGGAGGAGGCATGG - Intergenic
1008050772 6:46898479-46898501 CTTCAGGGAAGGAGGGAGAAAGG + Intronic
1008300551 6:49833508-49833530 GGTTGGGGAAGGAGGAGGAAGGG - Intergenic
1008588260 6:52968615-52968637 CTGTGGGAAATGAAGAAGCAGGG + Intergenic
1008863188 6:56176634-56176656 AGGGGGGGAAGGAGGAAGAAAGG + Intronic
1008892549 6:56511853-56511875 ACGGGGGGAAGGAGGGAGAAGGG + Intronic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009039747 6:58162094-58162116 CTGGGAGGGATGAGGAAGAATGG - Intergenic
1009215642 6:60916940-60916962 CTGGGAGGGATGAGGAAGAATGG - Intergenic
1009858774 6:69297558-69297580 CGGTGGGGGAGGAGGAATATTGG + Intronic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1011011842 6:82711921-82711943 CTGTTAGGAAGGAAGAAGGAGGG - Intergenic
1011304770 6:85914086-85914108 CCATGGGGAAGGAGGGTGAAGGG - Intergenic
1011568422 6:88705959-88705981 ATTTGGGGCAGTAGGAAGAATGG + Intronic
1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG + Intergenic
1012617556 6:101295291-101295313 CTGTGGTGAAGCAAGAAGAAAGG + Intergenic
1013004567 6:106060224-106060246 CAGTGAGGAAGGAGGAAAACAGG + Intergenic
1013591659 6:111623833-111623855 CTTTGGGCAAATAGGAAGAATGG - Intergenic
1013596358 6:111664260-111664282 CTGAGGGGAAACAGGCAGAAGGG + Intronic
1013740283 6:113275693-113275715 AGGAGGGGAAGGAGGAAGAGGGG + Intergenic
1013901151 6:115157126-115157148 AGGAGGGGAAGGAGGAAGATTGG - Intergenic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1015021988 6:128487531-128487553 CTTTAGGGAAGGATGGAGAAGGG - Intronic
1015235141 6:130962277-130962299 CAGAGGGGAAGGAGGAAGTGGGG + Intronic
1015838399 6:137448022-137448044 CTGAGGGGATAGAGGAGGAAAGG + Intergenic
1015941222 6:138454115-138454137 CTCTGGGGAAGTAGGGAGATGGG - Intronic
1016050811 6:139528097-139528119 GTGGGGGGAAGGAGGTAGATGGG + Intergenic
1016926216 6:149351027-149351049 CTGTCTTGCAGGAGGAAGAAAGG - Intronic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1017834488 6:158164900-158164922 GAGGAGGGAAGGAGGAAGAAAGG - Intronic
1018042455 6:159936924-159936946 TTGAGGAGAAGGAGGAACAAAGG + Intergenic
1018186774 6:161272233-161272255 CCATGTGGAAGCAGGAAGAATGG - Intronic
1018244634 6:161810953-161810975 CTGATGGGGAAGAGGAAGAAAGG + Intronic
1018306883 6:162467181-162467203 CTGTGGAGAAAAAGGAAGAAGGG - Intronic
1018395417 6:163374612-163374634 CTGCTGGGAAGGAGGAACACAGG - Intergenic
1018713650 6:166515108-166515130 TTCTGGGGAAGGAGGGAGAGAGG + Intronic
1018746214 6:166764317-166764339 CTGTGAGGCGGGAGGAAGAGTGG + Intronic
1018921294 6:168177704-168177726 GCGTGGGGAAGGAGGCAGGAGGG - Intergenic
1018984260 6:168623895-168623917 CTGTGGGGATGGCAGAGGAAGGG + Intronic
1019114224 6:169744632-169744654 CTCAGGGTAGGGAGGAAGAAAGG - Intronic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019628071 7:2031343-2031365 CTGTGGGGGAGGGGGAAAAGGGG + Intronic
1019919990 7:4157355-4157377 AAGTGGGAAGGGAGGAAGAAGGG + Intronic
1019935016 7:4249117-4249139 GTGTGGGGATAGGGGAAGAAGGG + Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020136665 7:5591842-5591864 CTTTGGGGGAGGAGGATGGAGGG + Intergenic
1020399526 7:7759737-7759759 TTGTAGGGAAGAAGGAGGAATGG + Intronic
1021226173 7:18029013-18029035 TAGTGAGGAAGGAGGCAGAAAGG + Intergenic
1021763172 7:23921193-23921215 CTGGGGGGAAGGATGTAAAAGGG + Intergenic
1021804089 7:24338016-24338038 CAGTGGGGAAGGATGAAGAGAGG + Intergenic
1021838790 7:24705932-24705954 CCCTGGGGGAGGAGGGAGAAGGG + Intronic
1021973006 7:25983799-25983821 CTGGAAGGAAGGAAGAAGAAAGG - Intergenic
1022188937 7:27998016-27998038 ATGGGGGGAAGAAGGAAGGAAGG + Intronic
1022340524 7:29463421-29463443 CTGTGGGGTGGGTGGAAGCATGG - Intronic
1022353565 7:29588871-29588893 CTGAGGGAAAGAAGGAAGAGAGG - Intergenic
1022611236 7:31875540-31875562 ATTTGGTGAATGAGGAAGAATGG - Intronic
1022812819 7:33886190-33886212 TTGTGGAGAAGGAGCAAGAGAGG - Intergenic
1022886118 7:34645737-34645759 CTGTAGGAAAGGAGAAGGAATGG - Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023355624 7:39364423-39364445 CTGTGGGGACTCAGGAGGAAAGG - Intronic
1023481741 7:40642433-40642455 CTGAGGGTAAGGAGAAGGAAGGG + Intronic
1024139336 7:46446026-46446048 CTGTAGGGAAGGCGTAAGGAAGG - Intergenic
1024353973 7:48395605-48395627 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1025605771 7:63038942-63038964 CAGTGGAGTAGGAGGAGGAAAGG + Intergenic
1025736109 7:64148249-64148271 CTGTGGGGAAAGAGACAGCAGGG + Intronic
1025839597 7:65133266-65133288 CTGAGTGGAAGGAAGAGGAATGG + Intergenic
1025883470 7:65562699-65562721 CTGAGTGGAAGGAAGAGGAATGG - Intergenic
1025889975 7:65639907-65639929 CTGAGTGGAAGGAAGAGGAATGG + Intergenic
1026340536 7:69430432-69430454 GGGGAGGGAAGGAGGAAGAAAGG + Intergenic
1026345873 7:69473708-69473730 CTGTTTGTAAGGAGGAAGAGAGG + Intergenic
1026679014 7:72451261-72451283 AGGAGGAGAAGGAGGAAGAAGGG + Intergenic
1026833287 7:73622988-73623010 ATTTGGGGAGGGAGGGAGAAGGG + Intronic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1027969914 7:85066311-85066333 ATGGTGAGAAGGAGGAAGAAGGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028960055 7:96738524-96738546 GTGTGGGAAAGGAGGAGGAAAGG + Intergenic
1029200355 7:98835262-98835284 ATGATGGGAAGGAGGAAGAGGGG - Intergenic
1029205957 7:98869588-98869610 CTTTGGGGAACAAGGATGAAAGG + Intronic
1029403528 7:100359516-100359538 CTGTGGTGGAGGAGAAGGAAAGG + Exonic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029927256 7:104329972-104329994 CTTTGGGGAAGTAGGCAGAGAGG + Intronic
1030091241 7:105861062-105861084 CCCTGGGGAAGGAGGATGAGGGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030244397 7:107366024-107366046 GTGGCAGGAAGGAGGAAGAAAGG + Intronic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031077320 7:117225468-117225490 GTGTGGGGAAGGAAGATGGATGG + Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031549786 7:123094717-123094739 CTGAGGGACAGGAGGAAGAGAGG + Intergenic
1031614353 7:123863868-123863890 CTTTGGGGAAGGAGTGAGAAGGG + Intronic
1031712065 7:125060992-125061014 CTGTGGGGAAGAAAGAACCATGG + Intergenic
1031852501 7:126882078-126882100 CTGAGTGGAAGGAAGAGGAATGG - Intronic
1031889647 7:127279178-127279200 CTGAGGAGGAGGAGGAAGACGGG - Intergenic
1032225994 7:130032300-130032322 CAGTGGGGATGGTGGAGGAAGGG - Intronic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032271173 7:130408083-130408105 CCTTGGGGAAGGAGGCAGGAGGG - Intronic
1032355819 7:131209630-131209652 GTGTTAGCAAGGAGGAAGAAAGG - Intronic
1032463227 7:132126980-132127002 TTATGGGGAAGGACAAAGAATGG + Exonic
1032698775 7:134360536-134360558 TTGTGGGGAAGCAGGAATGAGGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033183569 7:139204192-139204214 CTTTGAAGACGGAGGAAGAAAGG + Intergenic
1033329201 7:140404114-140404136 CAGCGAGGCAGGAGGAAGAAGGG + Exonic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033490392 7:141837767-141837789 CTGTGAGGAGAGAGGAGGAAAGG - Intronic
1034024880 7:147690049-147690071 CTGTAGACAATGAGGAAGAAAGG - Intronic
1034117474 7:148596791-148596813 GAGTGGGGAAGGAGGAAGGGAGG - Intronic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1034327940 7:150254642-150254664 GTGTGGGAAAGCAGGAATAAGGG - Intronic
1034607371 7:152329661-152329683 TGGAGGGGAAGGAGGGAGAAAGG + Intronic
1034765270 7:153714796-153714818 GTGTGGGAAAGCAGGAATAAGGG + Intergenic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035368281 7:158362284-158362306 CTGTGTGGCAAGAGGATGAAGGG + Intronic
1035534739 8:382364-382386 CTGTGGGGAGTCAGGAAGAAGGG - Intergenic
1035622369 8:1043612-1043634 CAGTGGGGAAGGGGGATGAAGGG + Intergenic
1035781189 8:2229411-2229433 CTGTGGGGAAGGAGGCTGCAAGG - Intergenic
1035796360 8:2360875-2360897 ATGTGGGGAGGAAGGAAGGATGG + Intergenic
1035909554 8:3550371-3550393 AGATGGGGAAGGAGGAAGATTGG - Intronic
1036046331 8:5145337-5145359 CAGAGGGGAAATAGGAAGAAAGG - Intergenic
1036748553 8:11428247-11428269 CTGTGGGGTAGCAGGAAGGAAGG + Intronic
1036913715 8:12784431-12784453 GTCTGGAGCAGGAGGAAGAAAGG - Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037152424 8:15654184-15654206 ATGTGGGGAGTGAGGAAGATGGG + Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037379387 8:18268353-18268375 TTGTTGGAAAGGAAGAAGAAAGG + Intergenic
1037653198 8:20859619-20859641 CTAAGGGGAAGAAGGAAGAAAGG + Intergenic
1037684925 8:21130582-21130604 ATGTGGAGAAGGAGGAACAGAGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1037995479 8:23349261-23349283 CTGTGGTCAAAGAGGATGAACGG - Intronic
1038109122 8:24475185-24475207 CAGAGGGGAGGGAGGAGGAATGG - Intronic
1038379557 8:27079947-27079969 AGATGGAGAAGGAGGAAGAAAGG - Intergenic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1038528179 8:28295180-28295202 CACAGGGGAAGGAGGAAAAAAGG + Intergenic
1038641966 8:29336130-29336152 TTGGGTGGGAGGAGGAAGAAAGG - Exonic
1038641980 8:29336248-29336270 TTGGGTGGGAGGAGGAAGAAAGG - Exonic
1038770596 8:30475725-30475747 GTGTTGGGGAGGAGGAAGGAGGG + Intronic
1038807174 8:30805110-30805132 CTGTGGGCAGTGAAGAAGAAAGG - Intronic
1038897244 8:31798027-31798049 GTGAGGGGGAGGGGGAAGAAAGG + Intronic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1039935180 8:42036803-42036825 GTGAGGGTAAGGAGAAAGAAAGG + Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1040621498 8:49097222-49097244 ATGTAGGGAGGGATGAAGAAAGG + Intergenic
1040700394 8:50056467-50056489 CTGTGGAGAAGGATGAAGTCAGG + Intronic
1040839690 8:51772040-51772062 GTGTGGGCATGGAGGAAGAGGGG - Intronic
1040875604 8:52148647-52148669 CTGAAGGAAAGAAGGAAGAAAGG + Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041263871 8:56045292-56045314 CTGTTGGGAAGGAGGCAGTTGGG - Intergenic
1041385386 8:57297006-57297028 CAGTGAGAAAGAAGGAAGAATGG + Intergenic
1041525818 8:58804365-58804387 CTGAGGAGGAGGAGGAAGAAGGG - Intergenic
1041570111 8:59328377-59328399 AGGAGGGGAAGGAGGAGGAAGGG - Intergenic
1041881176 8:62751214-62751236 AGGTGGGGTAGGAGGGAGAAGGG - Intronic
1041933712 8:63314205-63314227 CTGAAGGGAATGAGGATGAAAGG + Intergenic
1041963379 8:63646511-63646533 CACTGGGGAAGCAGGAGGAAGGG + Intergenic
1042126508 8:65542737-65542759 TTAGGGGGAAGTAGGAAGAATGG + Intergenic
1042182699 8:66107824-66107846 CTGGGAGGAAGGAGGTTGAAAGG - Intergenic
1042205603 8:66327073-66327095 GTGTGGAGAAGGAGGAAATAGGG - Intergenic
1042224405 8:66504274-66504296 CTTTGTAGAAGGAGGAAGTAAGG - Intronic
1043128254 8:76427785-76427807 CTGTGAGGAATTAGGAAGCAGGG - Intergenic
1044210623 8:89545799-89545821 CTGAGGAGGAGGAGGAAGAGAGG + Intergenic
1044384069 8:91566738-91566760 CTGTGGGGTGGCAGGAAGACTGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044533774 8:93337178-93337200 CTGTGGAGAAGTAGGAGTAAAGG - Intergenic
1044586029 8:93869807-93869829 CTGAAGGGAAGAAGGGAGAAGGG - Intronic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044820862 8:96154819-96154841 CGGTGGCGGAGAAGGAAGAAGGG - Intronic
1044826416 8:96202487-96202509 GGTAGGGGAAGGAGGAAGAAGGG - Intergenic
1044927334 8:97220794-97220816 GTGTTGGGCAGGAAGAAGAAAGG + Intergenic
1044994971 8:97830121-97830143 CTGTGTAGTAGGAGGAAGAGAGG + Intronic
1045076546 8:98575514-98575536 GTGTGGGAAAGAAGGAAGGATGG - Intronic
1045256297 8:100526041-100526063 CTGAGGGGTAGGAGTAAGATAGG + Intronic
1045282346 8:100759936-100759958 CTGTGGAGAGGCAGAAAGAAAGG + Intergenic
1045379144 8:101605576-101605598 TTGTGGGGAAGGAGAAAGTGTGG - Intronic
1045561162 8:103264469-103264491 CAGCAGGGAAGGATGAAGAATGG + Intergenic
1045900315 8:107271060-107271082 GTGTGGAGGAGGAGGAAAAAAGG - Intronic
1046690985 8:117283964-117283986 CTGGAGGTAAGGAGGAGGAAAGG - Intergenic
1046702278 8:117414856-117414878 TGGTAGGGAAGGATGAAGAAGGG - Intergenic
1046719974 8:117608420-117608442 GAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1047151679 8:122271261-122271283 AAGAGGGGAAGGAGGAGGAAGGG - Intergenic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047744483 8:127834034-127834056 CTATGGGCAGGGAGGAACAATGG - Intergenic
1047866477 8:129029491-129029513 CGGGGAAGAAGGAGGAAGAAGGG - Intergenic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048386963 8:133921105-133921127 GAATGGGAAAGGAGGAAGAATGG + Intergenic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1048955859 8:139535323-139535345 CAATAGGGAAGGAGGAAGACAGG + Intergenic
1049172383 8:141169604-141169626 CTCTGGGGAGGGAGGGAGAGAGG - Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049741165 8:144241682-144241704 CAGTGGGGAGGGCGGCAGAATGG + Intronic
1049943246 9:569157-569179 CAGAGGGGAGGCAGGAAGAAAGG - Intronic
1050024684 9:1321434-1321456 CTGAGTGGAAAGATGAAGAATGG - Intergenic
1050268791 9:3919477-3919499 CTGTTGGGAGGGTGGAAGATGGG + Intronic
1050476519 9:6046414-6046436 CTGTGAGGCAGGATCAAGAATGG + Intergenic
1050741533 9:8826134-8826156 GTGTGGAGGAGGAGGAAGATTGG - Intronic
1050933716 9:11366426-11366448 CTGGGAGAAGGGAGGAAGAAGGG + Intergenic
1051155083 9:14133909-14133931 GTGTCCTGAAGGAGGAAGAAAGG + Intronic
1051370631 9:16356005-16356027 CCATGGTGAAGGAGGAAGCAGGG + Intergenic
1051437690 9:17050579-17050601 CTCTGGAGAAGGAGGAAAATAGG - Intergenic
1051561589 9:18447459-18447481 CTGTGGGGAAGAGGGAGGGAGGG + Intergenic
1052325424 9:27212550-27212572 CTGGGGGACAGGAGGAAGACGGG - Intronic
1052815894 9:33102378-33102400 GCGTGGGGAAGAGGGAAGAAGGG - Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1052925894 9:34016116-34016138 CAGCAGGGAAGGAGGAGGAAGGG + Intronic
1052947409 9:34179256-34179278 CTCTGGGGGAGGGGGAAGAGGGG + Intronic
1052989413 9:34510377-34510399 TTCTGGGGAAGGAGGCAGGAAGG + Intronic
1053141492 9:35685340-35685362 CTGTGGGGAGTGAGAAAGAGAGG + Intronic
1053302068 9:36959401-36959423 TTGTGGGCAAGGAAGAAGACAGG - Intronic
1053540111 9:38964956-38964978 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053804461 9:41787113-41787135 AGGAGGGGAAGGAGGAAGGAAGG + Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054140823 9:61528349-61528371 AGGAGGGGAAGGAGGAAGGAAGG - Intergenic
1054207545 9:62144370-62144392 CGGTGGGGAAACAGGAAGGAAGG + Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1054626029 9:67398965-67398987 AGGAGGGGAAGGAGGAAGGAAGG - Intergenic
1054730779 9:68700974-68700996 CTGAGAGGAAAGAGGAACAAGGG + Intergenic
1055031376 9:71773907-71773929 CTGTAGGGAAGTAGGCAGGATGG - Intronic
1055277371 9:74634295-74634317 CAGTGGGGAAGGAGTAGCAAAGG - Intronic
1055486510 9:76761225-76761247 CAATGGTGGAGGAGGAAGAAAGG - Intronic
1055535569 9:77239814-77239836 TTGTAGGGAAGGGGGAAGAAAGG - Intronic
1056048911 9:82747415-82747437 AAGAAGGGAAGGAGGAAGAATGG + Intergenic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056201981 9:84285759-84285781 TTGTGGGGAAGGAGGGGGATAGG + Intronic
1056227128 9:84506514-84506536 CTGTGTGGAAGGGAGAATAATGG + Intergenic
1056380461 9:86052880-86052902 GTGTCGGGCAGGAGGAAGGAGGG - Intronic
1056937801 9:90930795-90930817 AGGAGGGAAAGGAGGAAGAAAGG + Intergenic
1057082952 9:92186675-92186697 CAGAGGGGAAGAAGGAAGGATGG - Intergenic
1057185169 9:93053324-93053346 CTGTGGGGAGGGAGGAGGCGAGG + Intergenic
1057208198 9:93185378-93185400 CCGTGAGGAAGGAGGATGAGGGG + Exonic
1057221755 9:93261293-93261315 AAGTGGGGAAGGAGGAACCATGG - Intronic
1057480341 9:95440479-95440501 GGGAGGGGAAGGAGGGAGAAGGG + Intergenic
1057644073 9:96856460-96856482 CTCTGGGGAGGGCGGGAGAAAGG - Intronic
1057784191 9:98074306-98074328 CTATGGGGCAGGAGGGAGAGAGG + Intronic
1057826643 9:98377129-98377151 TTGTGGGGGAACAGGAAGAAAGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058375000 9:104312587-104312609 CAGAAGGGAGGGAGGAAGAAAGG + Intergenic
1058695600 9:107556619-107556641 CTGAGGAGGAGGAGGAAGCAGGG - Intergenic
1058712350 9:107691166-107691188 ATTTGGGGCAGGAGGAAGAAGGG + Intergenic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1059032726 9:110716999-110717021 TTGTGGGGAGGTTGGAAGAAAGG - Intronic
1059268613 9:113059147-113059169 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059269665 9:113063930-113063952 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059270799 9:113069378-113069400 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059271933 9:113074825-113074847 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059273067 9:113080272-113080294 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059274203 9:113085714-113085736 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059353804 9:113684584-113684606 CCGGGGGGAAGGAGGATGGAAGG + Intergenic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1060138709 9:121184501-121184523 CTGTTTGGAAGGGGGAAAAAGGG - Intronic
1060328391 9:122641490-122641512 TGGTGGGGAAAGAGTAAGAATGG + Intergenic
1060356087 9:122908612-122908634 GTGGGGGGAAGGGGGAAGGATGG - Exonic
1060371841 9:123081017-123081039 CTGAGGAGGAGGAGGAAGAGGGG - Intronic
1060434646 9:123583085-123583107 CTTTGGGGAATGGGGAAGGAGGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060883673 9:127135811-127135833 CTGTGGGGAAGGGGCATGCAAGG + Intronic
1061246036 9:129401707-129401729 CAGGGAGGAGGGAGGAAGAAGGG - Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061423280 9:130483799-130483821 AAGAGGGGAAGGAGGAGGAAAGG - Intronic
1061539524 9:131270566-131270588 CTTTGGGGTGGGAGGAAGTAGGG - Intronic
1062080804 9:134622469-134622491 CAGGGGGGAAGGGGCAAGAAAGG - Intergenic
1062303628 9:135889712-135889734 CTCAGGGGAAGGAGGAGGAGGGG - Intronic
1062523752 9:136970074-136970096 GGATGGGGAAGGAGGAAGGAGGG + Intronic
1062705944 9:137942802-137942824 CTTTGGGGACTCAGGAAGAAAGG + Intronic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185766950 X:2733093-2733115 CAGGAGGGAAGCAGGAAGAAGGG - Intronic
1186552248 X:10518473-10518495 ATGTGGGGAAGGGGGTAGTAGGG - Intronic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187065341 X:15830246-15830268 TTGTGGGGCAGGAGGAGGAAAGG + Intronic
1187464827 X:19517741-19517763 ATGTTGGGAAGGAGGGAGAGTGG - Intergenic
1187546621 X:20260424-20260446 ATATGTGGAAGAAGGAAGAAAGG - Intronic
1188110195 X:26188403-26188425 CTGGGGGGATGGGGGAATAAGGG + Intergenic
1188539330 X:31232172-31232194 CAGAGAGGAAGGAGGAAGAGTGG + Intronic
1188811742 X:34659730-34659752 CTCTGGGGAAGGTGGCAGTAAGG + Intergenic
1189183020 X:39020847-39020869 CTGGGGGGTTGGAGGAGGAAAGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189249039 X:39585832-39585854 CTCTGGGGCAGGAGGAGGAGTGG + Intergenic
1189431089 X:40948066-40948088 CTGTTGAGAATGAGGAACAACGG + Intergenic
1190110021 X:47583385-47583407 CTGTGGGGAAGGGGGATGTCAGG - Intronic
1190250274 X:48718197-48718219 AGATGGGGGAGGAGGAAGAAAGG - Intergenic
1190541706 X:51484180-51484202 GAGTGGGGAATGAGAAAGAAAGG + Intergenic
1190904177 X:54709851-54709873 CGATGGGGAAGGAGCCAGAAAGG - Intergenic
1191006082 X:55712812-55712834 CTATGGAAAAAGAGGAAGAAGGG + Intergenic
1191131839 X:57022253-57022275 CTGTAGGCAAGGAGGAGGGAAGG - Intergenic
1191880824 X:65842443-65842465 CTGATAGGAAGGAGGAAGGAGGG - Intergenic
1192590693 X:72357125-72357147 ATGTGGGGAATAAGGAAGAGGGG + Intronic
1192590700 X:72357166-72357188 CTGTGTGGGAGGAGCATGAACGG + Intronic
1192808765 X:74531836-74531858 CTCTGGGGGAGGAGGAGGATGGG + Exonic
1193137071 X:77984096-77984118 ATGTGGGGAATGAGGAAGGTGGG + Intronic
1193298329 X:79858337-79858359 CTTAGGTGAAGGAGGATGAATGG + Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1193454001 X:81706987-81707009 TTGTGGGGAATGAAGAAGGAAGG - Intergenic
1193665967 X:84317344-84317366 TAGTGGGGAAGGAATAAGAAAGG - Intergenic
1194265279 X:91745414-91745436 AGGTGGGGAAAAAGGAAGAAAGG + Intergenic
1194451522 X:94049751-94049773 GTGTGGTGAAGGAAGAAAAACGG - Intergenic
1194882104 X:99266490-99266512 CTCTGGGGACTCAGGAAGAAAGG - Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195096574 X:101506847-101506869 GGGTGGGGAAGGATGAAGGAAGG - Intronic
1195379346 X:104256049-104256071 GGGAGGGGGAGGAGGAAGAAGGG - Intergenic
1195411195 X:104568688-104568710 CTTTGGGGAAGCCGGAAGCATGG - Intronic
1196117997 X:112017659-112017681 GGATGGGGAAGGAAGAAGAAAGG - Intronic
1196264281 X:113623652-113623674 CTGTGGGGAATGTGGAGAAAGGG - Intergenic
1196656059 X:118218108-118218130 ATAAGGAGAAGGAGGAAGAAAGG + Intergenic
1196834243 X:119800077-119800099 GTGTGAGAATGGAGGAAGAAGGG - Intergenic
1197629098 X:128837380-128837402 AGGTGGGGAAGAAGAAAGAATGG - Intergenic
1198243442 X:134807036-134807058 CATTGGGGAAAGAGGAAGGAGGG + Intronic
1198459207 X:136847295-136847317 CAGGGGTGAGGGAGGAAGAAGGG - Intergenic
1198682064 X:139193576-139193598 CTGCTGGGAGGGCGGAAGAAAGG + Intronic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199110462 X:143927689-143927711 CTGTGGGGAAAGAGGTATATGGG + Intergenic
1199461027 X:148085159-148085181 CTGTTGGGAGGTAGGAAGACGGG + Intergenic
1199465542 X:148131952-148131974 CTTTGGGGACTCAGGAAGAAAGG + Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199847633 X:151702491-151702513 CTGTGAGGTAGGGGGAAGGATGG - Exonic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1200315755 X:155131887-155131909 GTGTGGGGAGGGAGGATGAATGG - Intronic
1200465579 Y:3512463-3512485 CAGTGGAGAATCAGGAAGAAGGG + Intergenic
1200582431 Y:4965862-4965884 AGGTGGGGAAAAAGGAAGAAAGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic