ID: 1165864519

View in Genome Browser
Species Human (GRCh38)
Location 19:38928292-38928314
Sequence CACTTGAATCAAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178505
Summary {0: 3, 1: 491, 2: 10053, 3: 50717, 4: 117241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165864514_1165864519 9 Left 1165864514 19:38928260-38928282 CCTAGCTACTTGGGAGACTGAGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126
Right 1165864519 19:38928292-38928314 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241
1165864513_1165864519 10 Left 1165864513 19:38928259-38928281 CCCTAGCTACTTGGGAGACTGAG 0: 6
1: 286
2: 2496
3: 4969
4: 6587
Right 1165864519 19:38928292-38928314 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165864519 Original CRISPR CACTTGAATCAAGGAGGCGG AGG Intronic
Too many off-targets to display for this crispr