ID: 1165866069

View in Genome Browser
Species Human (GRCh38)
Location 19:38939818-38939840
Sequence GGTGAAGGAGTGGCCTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 13, 3: 108, 4: 494}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165866069 Original CRISPR GGTGAAGGAGTGGCCTGAGG CGG Intronic
900085996 1:897377-897399 GGGGAGGGAATGGCCTGAGTTGG + Intergenic
900314293 1:2049523-2049545 TGTGAGGGCGTGGCCTGAGCAGG + Intergenic
901083940 1:6599378-6599400 CGTGAATGAGTGGGCGGAGGTGG - Exonic
902391064 1:16106802-16106824 GATGAGGGAGTGGCCTGAGCTGG + Intergenic
902717300 1:18281631-18281653 CTGGAAGGAGTGGGCTGAGGAGG - Intronic
903029124 1:20450263-20450285 GGTGCAGGAGGGGCAGGAGGGGG + Intergenic
903071309 1:20728142-20728164 AGTGAATGAATGGCCTGTGGGGG - Intronic
904038597 1:27571673-27571695 GGTGAAGTAGGGGGCCGAGGAGG - Intronic
904907628 1:33909940-33909962 GGAGAAGAAGTGGGCTGGGGTGG - Intronic
904947026 1:34206848-34206870 GGTGAAGGAGTGGACAAAAGTGG + Intronic
906023554 1:42653606-42653628 GTTGAAGGAGTGGCAAGGGGAGG - Intronic
906702044 1:47866666-47866688 GGTGAAGGATAAGCCAGAGGAGG + Intronic
906774634 1:48518253-48518275 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
907022353 1:51080692-51080714 GGTGAAGGAGAGGCCAGGCGTGG + Intergenic
907244653 1:53100915-53100937 GGTGTGTGAGTGGACTGAGGTGG - Intronic
907460912 1:54605021-54605043 GGTGGTGGAGTGGACTGATGGGG - Intronic
910010983 1:82461802-82461824 GGTAAAGGAGAGGCCAGAGAGGG - Intergenic
910846568 1:91610134-91610156 GGGCAAGGAATGGCCTGAGAGGG + Intergenic
911096943 1:94062510-94062532 GGTGCTGGAGTGGGCTGGGGTGG - Intronic
911136500 1:94446218-94446240 GGTGAGGGAATGGCCTGAGCCGG - Intronic
911664104 1:100534890-100534912 GGAGAATGAGTGGGATGAGGAGG + Intergenic
912631005 1:111246783-111246805 GGGGAAGGAGTGGAAGGAGGTGG + Intergenic
913084199 1:115420374-115420396 GGTGAAGGAGTGGGTGGGGGTGG - Intergenic
914249340 1:145908680-145908702 GGTGAGGGGGTAGCCTGAGAGGG - Intronic
914919908 1:151839607-151839629 GGGGAAGGAGGAGCCAGAGGAGG - Intronic
917799621 1:178559007-178559029 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
919493750 1:198238196-198238218 GGGGAAGCAGTGTCCTGGGGGGG - Intronic
919914777 1:202132633-202132655 GGTGAAGGAGAGGCCGAGGGAGG + Exonic
920036227 1:203067548-203067570 GGGGAAGGAGGAGCATGAGGAGG + Intronic
920512251 1:206559865-206559887 AGTGCAGGGGTGGACTGAGGAGG + Intronic
921227009 1:213030459-213030481 GGTGAGAGAATGGCCTGAGCTGG + Intergenic
922755715 1:228095778-228095800 GTTGCAGGAGTGGACTGAGAGGG + Intronic
922756365 1:228099313-228099335 GGGGAGGGTGTGGACTGAGGTGG - Intergenic
922858166 1:228792900-228792922 GGTGAGGGGGTGGCCTTTGGAGG + Intergenic
923966125 1:239140955-239140977 GTTGAGGGTGTGGCCTCAGGTGG - Intergenic
924255517 1:242179115-242179137 GGTGATAGAGTGGCATGAGTGGG + Intronic
924701590 1:246459037-246459059 GTTGAAGGAGGGGCCTGATGGGG + Intronic
924765249 1:247026085-247026107 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1063631513 10:7738662-7738684 GGTGAAGGATTGGCCCAAGACGG - Exonic
1064146760 10:12832129-12832151 GTTGAAGTAGTGGCCTGGAGTGG + Exonic
1066236905 10:33493860-33493882 GGGGAAGCAGGTGCCTGAGGAGG + Intergenic
1066988407 10:42488738-42488760 GGTGAGGGAGTGGCCTGAGCTGG - Intergenic
1066989267 10:42496893-42496915 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1066990570 10:42509430-42509452 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1067133438 10:43586950-43586972 GGTGAGGGAGTGGCCTCAGCCGG - Intergenic
1067209149 10:44244033-44244055 GTGGGAGGAGAGGCCTGAGGAGG - Intergenic
1067577122 10:47415929-47415951 GGTGGATGAGTGGCCTGTGGTGG - Intergenic
1067577152 10:47416091-47416113 GGTGAATGGGTGGCCTGTGGTGG - Intergenic
1067577163 10:47416145-47416167 GGCGAATGGGTGGCCTGTGGTGG - Intergenic
1067577225 10:47416433-47416455 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577248 10:47416541-47416563 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577272 10:47416649-47416671 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577308 10:47416811-47416833 GGTGAACGACTGGCCTGTGATGG - Intergenic
1067577474 10:47417585-47417607 GGTGAACGAGTGGCCTGTGATGG - Intergenic
1067577480 10:47417621-47417643 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577493 10:47417675-47417697 GGTGAACGATTGGCCTGTGATGG - Intergenic
1067577503 10:47417729-47417751 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577527 10:47417837-47417859 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577550 10:47417927-47417949 GGTGAATGGGTGGCCTGTGATGG - Intergenic
1067577577 10:47418035-47418057 GGTGAATGGGTGGACTGTGGTGG - Intergenic
1067577611 10:47418215-47418237 GGTGAATGGGTGGTCTGTGGTGG - Intergenic
1067850238 10:49749928-49749950 GGTGATTGGGTGGCCTGAGGAGG - Intronic
1068166606 10:53339689-53339711 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1068737703 10:60432918-60432940 GATGATGGAGTGGGCTGATGCGG - Intronic
1069048120 10:63764431-63764453 GGTGAAGGAGTGGCCTTAGAAGG + Intergenic
1069223013 10:65907111-65907133 GAGGAAGGAGAGGCCTGGGGTGG + Intergenic
1069239131 10:66116939-66116961 GTTGGAGGAGGGGCCTGGGGGGG - Intronic
1069491706 10:68866809-68866831 GGTGAGGGAGTGGCCTGAACTGG + Intronic
1069920613 10:71813320-71813342 GATGGAGGAGTGGCAGGAGGAGG - Exonic
1070965908 10:80530280-80530302 GCTGAGGGAGTGGGCTGTGGTGG - Exonic
1071121865 10:82287737-82287759 GGTGAAGGAGTGGCCACAGCTGG + Intronic
1071187139 10:83058783-83058805 TGGCAAGGAGTGGCCTGGGGAGG - Intergenic
1073152884 10:101323702-101323724 GGAGAAAGAGGGGCCAGAGGGGG - Intergenic
1073249973 10:102115183-102115205 GATGGAGGAGAGGCCTGTGGGGG + Intronic
1073422244 10:103433956-103433978 GGTGAAGAAATGGCTTGAGGTGG + Exonic
1074448532 10:113540146-113540168 GGAGAAGGAGGGGCGTGGGGAGG - Intergenic
1074980240 10:118613730-118613752 GGGGAGGGAATGGCCTGAGCTGG + Intergenic
1075719306 10:124575688-124575710 GGTGCAGGAGTGGACAAAGGGGG - Intronic
1075927453 10:126264332-126264354 GCTGAAGAAGTGGCCTTAGAAGG + Intronic
1076136565 10:128049242-128049264 GGTGGATGAGTGGCCTCGGGAGG + Intronic
1076209338 10:128627849-128627871 GGGGAAGGAGTGGCAGGTGGAGG + Intergenic
1076273740 10:129178667-129178689 GGTGAAGGCGTTGGCAGAGGTGG + Intergenic
1076294723 10:129375528-129375550 AGTGAGGGAGTGGCCTGGAGAGG - Intergenic
1076571655 10:131437281-131437303 GGGGAAGGGGTGGGCTGGGGTGG - Intergenic
1076635600 10:131880218-131880240 GGTGAGGGAGTGGCCTGGGCAGG + Intergenic
1077008625 11:370331-370353 GGTGGAGGCGAGGCCTGAGAAGG - Intronic
1077045783 11:544651-544673 GGTGAAGGAGGGTGCAGAGGTGG + Intronic
1077174730 11:1183723-1183745 GTTGAAGGAGTGGTCTGGGCTGG - Intronic
1077222095 11:1422311-1422333 GGTGGAGGAGCGGCTGGAGGAGG - Intronic
1078369844 11:10735651-10735673 GGTGACGGAGGGCCCTGAGGTGG - Intergenic
1078771692 11:14358346-14358368 GGTGAAGGCGCGGCCGCAGGCGG + Intronic
1078823858 11:14907691-14907713 GGTGAAGCAGTGCCCACAGGTGG + Intronic
1079328551 11:19514856-19514878 GCTGAAGCAGGGGCATGAGGAGG + Intronic
1080642826 11:34167693-34167715 TGAAAAGGAGTGGACTGAGGCGG - Intronic
1080779799 11:35419565-35419587 GTTAAAGGAGTTGCCCGAGGCGG - Intronic
1083066119 11:59925517-59925539 GGTGAGGGAATGGCCTGAGATGG - Intergenic
1083198693 11:61106391-61106413 GGGGAAGGACAGGCCTGAGAGGG + Intronic
1083746791 11:64741501-64741523 GGTGAAGGAGAGGGTTAAGGAGG + Exonic
1083868277 11:65470625-65470647 CGGGCAGGAGTGGCCTGAGTTGG - Intergenic
1083974488 11:66106641-66106663 GGTGAAGAGGTAGGCTGAGGTGG + Intronic
1084393989 11:68896952-68896974 GGCGAGGGAGTTGCATGAGGCGG - Intronic
1085055870 11:73403436-73403458 GGAGAGGCAGTGGCATGAGGAGG + Intronic
1085193555 11:74650699-74650721 ATTGAATGAGTGGACTGAGGAGG - Intronic
1085234711 11:75005625-75005647 GGTGAGGGACTTGACTGAGGAGG + Exonic
1085349231 11:75787939-75787961 GGAGAAGAAGAGGCCTGATGGGG - Intronic
1086420433 11:86632682-86632704 TGTGAAGGAGGGGACAGAGGAGG + Intronic
1087430141 11:98043355-98043377 GGTAAAGAAGAGGCCTGAAGAGG - Intergenic
1087800266 11:102496136-102496158 GGTGAAGGAGTGGACTAGGTAGG + Intronic
1087884276 11:103459660-103459682 GCTGAAGGAGTGGCCGGGCGCGG + Intronic
1088492088 11:110398203-110398225 GGTAAGGGAATGGCCTGAGCCGG - Intergenic
1089259973 11:117217610-117217632 GGAGAAGGAATGGCCAGAGAAGG - Intronic
1089461268 11:118655735-118655757 GGGGAAGGGGTGGCCTGGTGGGG + Intronic
1089683574 11:120133000-120133022 GGTGAAGGAGGAGACTGAGGGGG - Intronic
1089969252 11:122679182-122679204 GGTGAAGGGGTGGGGCGAGGAGG + Intronic
1090043020 11:123307219-123307241 GGTGAAGAAAGGGCCTGGGGAGG - Intergenic
1091042213 11:132292398-132292420 GGTGGGGGAGGGGCCGGAGGAGG - Intronic
1091360684 11:134976679-134976701 GGTGCAGGAGTGGCCTGAAGTGG + Intergenic
1091443446 12:529053-529075 GGAGAAGGAGAGGCCTGGGAGGG - Intronic
1092923188 12:13250605-13250627 GGTGAGTCAGTGGACTGAGGAGG - Intergenic
1093236081 12:16609689-16609711 GGTGGAGGAGGGTGCTGAGGGGG + Intronic
1093795393 12:23304148-23304170 GTTGGAGGAGCTGCCTGAGGAGG - Intergenic
1095185799 12:39199200-39199222 GTTGAGGGAATGGCCTGAGCTGG + Intergenic
1095912945 12:47447419-47447441 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1096308114 12:50496847-50496869 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1096450720 12:51738930-51738952 GGTGAGGGAATGGCCTGAGCTGG + Intronic
1097722824 12:63041859-63041881 TGTGAAGCAGTGGCCTGGGCTGG + Intergenic
1098923682 12:76326426-76326448 GGTGAAGGACAGGCCAGATGTGG - Intergenic
1100414509 12:94357554-94357576 GGTGAGGGAATGGCCTGTGCTGG - Intronic
1100813396 12:98362464-98362486 GTTGAAGAAGTGGCCTCATGAGG - Intergenic
1101223635 12:102666174-102666196 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1101501410 12:105307782-105307804 GGTGAGGGAATGGCCTGAGCTGG + Intronic
1103731078 12:123028154-123028176 GCCGAGGGAGTGGCCGGAGGTGG - Intronic
1103991040 12:124799684-124799706 GCTGAAGGAGTGTCCTTGGGAGG + Intronic
1104148024 12:126054295-126054317 GGAGTAGGAGGGGCCTAAGGTGG - Intergenic
1104404046 12:128502748-128502770 GGTGAGGGAGTGTCCTGAAAAGG - Intronic
1105737878 13:23290132-23290154 GGTAACGGAGAGGCCTGAGGAGG + Intronic
1107290919 13:38852122-38852144 GGTGGGGGAGTGGCAGGAGGTGG - Intronic
1110841108 13:80144510-80144532 GGTGAGGGAGTGGACTCTGGAGG + Intergenic
1113767496 13:112890231-112890253 GGGGAAGGAGCGGGCTGTGGCGG + Intergenic
1113778395 13:112961867-112961889 GGTGAATGAGTGGCCTCTCGTGG - Intronic
1116238551 14:42312184-42312206 GATGAGGGAATGGCCTGAGCTGG + Intergenic
1117600319 14:57367281-57367303 GGTGAGGGAATGGCCTGAGCCGG - Intergenic
1118470489 14:66070461-66070483 GGTGGAGGAGTGGGGAGAGGAGG - Intergenic
1118776215 14:68975896-68975918 GGTGAAAGTATGGCCTGATGTGG - Intronic
1118885944 14:69865970-69865992 GGTGAAGGAGTCCTCTAAGGTGG + Intronic
1119483918 14:74976135-74976157 GGACAAGGGGTGGCCTGAGCAGG - Intergenic
1119554143 14:75540431-75540453 GGTGAGGGATTTGCCTGAGGTGG + Intronic
1120089651 14:80316619-80316641 GGCAAAAGAGTGGCCTGAAGTGG + Intronic
1122031284 14:98914452-98914474 GGTGAAGCAGACGCCTGAGTGGG - Intergenic
1122416903 14:101554378-101554400 GGGAAAGGAGTGGCCAAAGGTGG + Intergenic
1122457420 14:101865131-101865153 GGTGTAGGAAAGGCCTGAGGTGG + Intronic
1122652937 14:103235998-103236020 GTTGAGGGAATGGCCTGAGCTGG - Intergenic
1202843681 14_GL000009v2_random:147420-147442 GGTGAGGGAATGGCCTGAGATGG + Intergenic
1202913084 14_GL000194v1_random:137662-137684 GGTGAGGGAATGGCCTGAGATGG + Intergenic
1202879565 14_KI270722v1_random:45020-45042 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1123875274 15:24617727-24617749 TGTGAAGCAGTGGCCTGAACTGG + Intergenic
1124467003 15:29949071-29949093 GGTGAAGGAGTAGGTTGTGGTGG - Intronic
1125780295 15:42259740-42259762 GGTCCAGGAGAGACCTGAGGAGG + Intronic
1128456566 15:67834753-67834775 GGAGAGGGAGTGCCCTGTGGGGG - Intergenic
1128497319 15:68205970-68205992 GGTGGTGGAGGGGCCTGAGCCGG + Intronic
1128521881 15:68380736-68380758 GATGAAGGCTGGGCCTGAGGTGG + Intronic
1128717627 15:69920176-69920198 GGTGTTGGAGTGGACTGGGGAGG + Intergenic
1129396083 15:75247700-75247722 GGTCAAGGAATAGGCTGAGGCGG + Intergenic
1129661938 15:77557672-77557694 CGTGAAGGACTGGTCTCAGGAGG - Intergenic
1129669368 15:77598621-77598643 GGTGCAGGTGTGGCCAGAGAAGG + Intergenic
1129772455 15:78211392-78211414 GGTGGAAGAACGGCCTGAGGAGG + Intronic
1130348111 15:83067271-83067293 GGTCAGGGAGGGGCCTGCGGAGG - Exonic
1131148862 15:90034615-90034637 GGTGAGGCAGAGGCCGGAGGAGG - Intronic
1132656727 16:1044576-1044598 GGAGAGGGAGAGGCCTCAGGAGG + Intergenic
1132811330 16:1799374-1799396 GGTTTAGGAGGGGCCAGAGGTGG + Intronic
1134901756 16:17944480-17944502 GGTGAAGGAGTGAGGTGAGCTGG - Intergenic
1135659103 16:24279062-24279084 GGAGCAGGAGTGGGCTGAGTGGG + Intronic
1136037428 16:27550449-27550471 GGAGAAGTAGAGGTCTGAGGAGG + Intronic
1136188365 16:28601124-28601146 GCTGGAGGCGCGGCCTGAGGTGG - Intergenic
1136190837 16:28614118-28614140 GCTGGAGGCGCGGCCTGAGGTGG - Intronic
1136638435 16:31540850-31540872 GGTTAGGGAATGGCCTGAGCTGG - Intergenic
1136982801 16:35073517-35073539 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1137490167 16:48925822-48925844 AGAGGAGGAGTGGCCTGAGCTGG + Intergenic
1137725639 16:50654895-50654917 GGTGGAGGAGGGTCCTCAGGAGG + Intergenic
1138081822 16:54097890-54097912 GATTAAGGAGTGACCTGAAGGGG + Intronic
1138220928 16:55249835-55249857 GGTGCAGAAGTGGCCTTCGGGGG + Intergenic
1138452750 16:57103567-57103589 GGTGAAGGGCAGGCCTGAGGTGG - Intronic
1139966682 16:70749687-70749709 GGGCAAGGAATGGCTTGAGGTGG + Intronic
1140821652 16:78668620-78668642 GGTGAAGGAGTGACAGCAGGGGG + Intronic
1141204136 16:81920234-81920256 GGTGCAGGAGAGACCTGATGTGG + Intronic
1141247009 16:82317200-82317222 GATGAATGAGTGGCTTGAGCTGG - Intergenic
1141594251 16:85087803-85087825 TGTGGTGGAGTGGCCTCAGGAGG + Intronic
1142008979 16:87704270-87704292 GGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142008992 16:87704307-87704329 GGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142009032 16:87704430-87704452 GGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142009055 16:87704504-87704526 GGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142009075 16:87704554-87704576 GGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142009085 16:87704591-87704613 GGAGAAGGAGGCGCCTGGGGAGG + Intronic
1142027443 16:87822150-87822172 GGTGGGGGAGTGGCGTGAGGGGG - Intergenic
1142051269 16:87959760-87959782 GGTGAGGGGGTGGGCTGAGGGGG + Intronic
1142266782 16:89067621-89067643 GGAGAAAGAGTGGCCCGGGGAGG + Intergenic
1142429929 16:90020390-90020412 GTTGATGCCGTGGCCTGAGGCGG + Intronic
1142688969 17:1593358-1593380 GGTGAAGAAGGGGCCTCATGGGG - Intronic
1142713821 17:1737393-1737415 GGTCAAGGAATGGTCAGAGGAGG - Exonic
1142893522 17:2960229-2960251 GGGGAGGGAGTGGCGTGGGGAGG + Intronic
1143139574 17:4733736-4733758 GATGCAGGAGAGGGCTGAGGTGG + Exonic
1143179277 17:4974127-4974149 GGTGAAGGAGAGGGCGGGGGAGG - Intronic
1143573510 17:7776128-7776150 GGTGAAGGAGTGGGCTGGCCAGG + Exonic
1143579768 17:7818675-7818697 GCGGAAGGAGCGGCCTGAGCTGG + Exonic
1144774592 17:17778896-17778918 GCTGGAGGTGAGGCCTGAGGGGG + Intronic
1145219733 17:21078334-21078356 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1145714788 17:27009317-27009339 GGTGGAGGAGAACCCTGAGGCGG + Intergenic
1146268353 17:31467985-31468007 AGTGAAGGAGGGGCCTGGGAAGG + Intronic
1146621077 17:34398404-34398426 GGTGATGGTGTGGCCTGGGCAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147191046 17:38738481-38738503 TGGGAGGGAGTGGCCTGGGGTGG - Intronic
1147844158 17:43393233-43393255 GTTGGAGGAGTGGCCTTGGGTGG - Intergenic
1149461617 17:56833999-56834021 GGAGACGGACCGGCCTGAGGGGG - Intronic
1149532438 17:57406363-57406385 CTTGAAGGAGGGGCCTGAAGGGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150461650 17:65358757-65358779 GTTGAAGGTGGGGCCTGATGGGG - Intergenic
1150602854 17:66665484-66665506 AGTGTAGGAGTGGCAAGAGGGGG + Intronic
1151025385 17:70670956-70670978 GGTCAAGGAATAGGCTGAGGTGG + Intergenic
1151033232 17:70766640-70766662 AGTAAAGAAGTGGCCAGAGGTGG - Intergenic
1151703885 17:75756875-75756897 GGGGCAGGAGTGGCCAGGGGAGG + Intronic
1152200611 17:78943722-78943744 GGTGAGGGAGGGACCAGAGGAGG + Intergenic
1152258710 17:79255071-79255093 GGTCAAGGAGTTGGCTAAGGAGG - Intronic
1152656415 17:81521474-81521496 GGGGATGGAGAGGGCTGAGGTGG - Intronic
1152753461 17:82077295-82077317 GGGGTGGGAGTGGCCGGAGGAGG + Intergenic
1154492849 18:14934438-14934460 GGAGGAGCAGTGGACTGAGGTGG - Intergenic
1155249635 18:23942353-23942375 GGTGCAGGGGTGCCCTGAGAGGG - Intronic
1155386628 18:25285040-25285062 GCTGAAGGAGTGGCCAGAAAAGG + Intronic
1156291824 18:35754534-35754556 GATGAAGGAGCTGGCTGAGGTGG + Intergenic
1156304624 18:35865855-35865877 GGTGAGGGAGTGGACTGAGGTGG - Intergenic
1156460637 18:37319576-37319598 GATGAAGGAGTGTTCTGAGCAGG + Intronic
1157504985 18:48219777-48219799 GTTGGAGGAGTGGACTGAGTTGG + Intronic
1157845444 18:51000029-51000051 TGTGAAGGTGTTGCCAGAGGAGG + Intronic
1158233645 18:55287598-55287620 GGAGCAGGAGAGGCCTGAGCAGG + Intronic
1158611467 18:58944495-58944517 GGTGTGGGAGTGGCCAGAGAGGG - Intronic
1159769497 18:72532045-72532067 GGTGAGGGGGTGGGCTGGGGTGG - Intergenic
1160203783 18:76816448-76816470 GGTGAAGGTGTGACATGGGGTGG + Intronic
1160353976 18:78210702-78210724 GGTGAAGGCGCGGGCCGAGGGGG + Intergenic
1160617418 18:80142206-80142228 GGTAAATGACTTGCCTGAGGTGG + Intronic
1160971401 19:1769333-1769355 GGTGGAGGAGAGGACGGAGGTGG + Intronic
1160975453 19:1790350-1790372 GGTGAGGGAGTGGGCAGTGGAGG - Intronic
1161224548 19:3136980-3137002 GGTGAAGGAGAGGCTGGAGCCGG - Intronic
1161582920 19:5090639-5090661 GGGGAAGGGGGGGCCGGAGGGGG - Intronic
1161840582 19:6677971-6677993 GGTGGAGCACTGGCCCGAGGAGG - Exonic
1161943916 19:7422566-7422588 GGAGCTGGGGTGGCCTGAGGAGG - Intronic
1162021860 19:7871736-7871758 GGGGAAGGACTGGCCTGCGGAGG + Exonic
1162130919 19:8525776-8525798 GATGAAGGAGTGACCTAAAGTGG - Intronic
1162283136 19:9716528-9716550 GGTGAGGGAACGGCCTGAGTTGG + Intergenic
1162697075 19:12484723-12484745 GGTGGAGGAAGGGCCTCAGGTGG - Exonic
1162861158 19:13506476-13506498 GGAGAAGGAGGGGCGGGAGGAGG + Intronic
1163209502 19:15830102-15830124 TGCCAAGGAGTGGCCTGGGGAGG - Intergenic
1163284077 19:16335417-16335439 GGAGATGGACGGGCCTGAGGTGG + Intergenic
1163524553 19:17812712-17812734 GGTGGAGGTGTGGGCAGAGGAGG + Exonic
1163827068 19:19529739-19529761 GGTGAAGGGGTGAGGTGAGGGGG + Intronic
1164024936 19:21343279-21343301 GGTGACGGAATGGCCTGAGCTGG + Intergenic
1164032111 19:21417024-21417046 GGTGAGGGAATGGCCTGAGCTGG + Intronic
1164060731 19:21671400-21671422 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1164532427 19:29058571-29058593 GGTTAAGGAGAGCCATGAGGAGG + Intergenic
1165400442 19:35596225-35596247 GGTGTTGGAGGGGCTTGAGGGGG + Intergenic
1165770874 19:38379448-38379470 GGTGCAGGGGTGGTCTTAGGAGG + Intronic
1165866069 19:38939818-38939840 GGTGAAGGAGTGGCCTGAGGCGG + Intronic
1166071839 19:40392633-40392655 GGTGAGACAGTGACCTGAGGAGG + Intergenic
1166073348 19:40399020-40399042 GGTGCGGGCGTGGCCTGAGTGGG - Intronic
1166254451 19:41592360-41592382 GCAGAGGGAGTGGCCTCAGGTGG - Intronic
1166503048 19:43355029-43355051 GGTGGAGGAGGGGCCTGCTGAGG - Intronic
1166507404 19:43379703-43379725 GGTGGAGGAGGGGCCTGCTGAGG + Intergenic
1166659112 19:44634163-44634185 TGTGAGGGAATGGCCTGAGCTGG + Intronic
1167507354 19:49877931-49877953 GCTCAAGGAGTCGCCTGAGCCGG - Exonic
1167714215 19:51130793-51130815 GATGGAGGAGTGGACTGAAGTGG - Intronic
1167777038 19:51565146-51565168 GGTGAAGAATTGGCTTCAGGGGG - Intergenic
1167863575 19:52305759-52305781 GGTGAGGGAGTGGCCTGAGCTGG + Intronic
1167917451 19:52753538-52753560 GGTGAGGGAATGGTCTGAGCTGG + Intergenic
1168125899 19:54282704-54282726 GGTGAAGGAAGGGCAGGAGGAGG - Intergenic
1168171376 19:54592082-54592104 GGTGAAGGAAGGGCAGGAGGAGG + Intronic
1168176073 19:54628847-54628869 GGTGAAGGAAGGGCAGGAGGAGG + Intronic
1202655184 1_KI270708v1_random:14026-14048 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
925202662 2:1981535-1981557 GGTCAAGGAGGTGCCTGAAGTGG + Intronic
925351401 2:3203581-3203603 GGTGAAGCTGTGACATGAGGAGG + Intronic
925872949 2:8286388-8286410 TGGGAAGGAGAGGCCTGTGGAGG - Intergenic
927118127 2:19925034-19925056 GGTGAGGGAATGGCCTGAGCTGG - Intronic
927436105 2:23067966-23067988 GGTGCGGTAGTGGCCTGAAGAGG - Intergenic
927485647 2:23486791-23486813 GGAGGAGGTGTGGCCTGAGCAGG - Intronic
927561367 2:24076569-24076591 GGAGAGGGCGGGGCCTGAGGAGG + Intronic
927561487 2:24076925-24076947 GGCGAAGGCGGGGCCTGAGGAGG + Intronic
927869499 2:26614606-26614628 GATGGAGGGGTTGCCTGAGGTGG - Intronic
928702928 2:33917501-33917523 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
929125017 2:38515460-38515482 GGTCAAGGAATAGTCTGAGGCGG + Intergenic
929905002 2:46037700-46037722 GGTTGAAGAGTGGCCTGAGAAGG - Intronic
929965273 2:46529925-46529947 GGTGATGCAGTGGCCTGATCAGG + Intronic
930033238 2:47070711-47070733 AGAGAAGGAGGGTCCTGAGGTGG + Intronic
930183352 2:48386407-48386429 GGTGAGGAAATGGCCTGAGCCGG - Intergenic
930918313 2:56720991-56721013 GGTGAGGGAATGACCTGAGCTGG - Intergenic
932867817 2:75364885-75364907 GTTGAAGGAGTGGTGAGAGGGGG + Intergenic
936073119 2:109384431-109384453 GGTCCAGGGGTGGCCTGAGCTGG + Intronic
936246552 2:110833407-110833429 GGCTAAGGAGTGGGCTGGGGAGG + Intronic
936524138 2:113231545-113231567 AGTGAAGGAGTTGCAGGAGGCGG + Intronic
937229635 2:120390119-120390141 GTAAAAGGAGTGGCATGAGGAGG - Intergenic
937320344 2:120957003-120957025 AGTGAAGGAGCAGCCAGAGGAGG - Intronic
937403882 2:121610233-121610255 GGAGGAAGAGTAGCCTGAGGAGG + Intronic
937851734 2:126642253-126642275 GGTGTGGGAGTGTGCTGAGGGGG - Intergenic
938092793 2:128444311-128444333 GGTGAGGGAAGGGCCAGAGGAGG - Intergenic
938288442 2:130137043-130137065 GGGGAGGGAGGGGCCTGAGCTGG - Intergenic
940932962 2:159457742-159457764 GGTAAAGGAGTGGCCCTGGGAGG - Intronic
942218743 2:173748290-173748312 TCTCAGGGAGTGGCCTGAGGGGG + Intergenic
943062406 2:183052606-183052628 GGTGAGGGAATGGCCTGAGCCGG + Intergenic
944649923 2:201819571-201819593 TGTGAAGAAGTGGCCATAGGAGG + Intronic
945148626 2:206764849-206764871 TGTGAAGGTGTGAGCTGAGGAGG - Intronic
945985528 2:216350492-216350514 GGTGATGGTGTGGCATGATGAGG - Intronic
946145145 2:217725027-217725049 GGGGAAAGTCTGGCCTGAGGGGG + Intronic
946206639 2:218113712-218113734 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
946290273 2:218739107-218739129 TGAGAAGGAGAGACCTGAGGAGG + Exonic
946415776 2:219539026-219539048 GGGGAAGGAGGGAGCTGAGGAGG - Exonic
947742608 2:232491479-232491501 GGTGGAGTAGGGGCCTGTGGAGG - Intergenic
947932101 2:233972834-233972856 GTGGAAGGAGTGGCGTGAGCGGG - Intronic
948678363 2:239612254-239612276 GGACAAGGAGTGGACTGTGGTGG + Intergenic
948688120 2:239684163-239684185 GGGAAAGGAGAGGCCTGAAGTGG - Intergenic
948765723 2:240217712-240217734 GCTGAAGGGGTGGGCTGAGCTGG - Intergenic
948868633 2:240787417-240787439 GGTGCAAGAGGGGCCTGAGAGGG - Intronic
1169403679 20:5305229-5305251 GGTCAGGGAATGGCCTGAGCTGG - Intronic
1169765616 20:9144757-9144779 GGGGAAGGAGGGGAATGAGGGGG + Intronic
1170441930 20:16387831-16387853 AGTGAAGGCTTCGCCTGAGGAGG - Intronic
1172295937 20:33811342-33811364 GGCGGAGGAGAGGCCTGCGGCGG + Exonic
1172871544 20:38138614-38138636 GGGGAAGGAGTGGTCAGAGAGGG - Intronic
1173006158 20:39141297-39141319 GGTGAAGGAGGGAGCAGAGGAGG - Intergenic
1173067046 20:39723058-39723080 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1173643875 20:44621792-44621814 GGAGAAGCAGTGGCCCCAGGAGG - Intronic
1174340293 20:49891097-49891119 GGTGTGGGTGTGGCCTGGGGTGG + Exonic
1174650383 20:52119858-52119880 GGTGAAGGAGTTGGGTGGGGAGG + Intronic
1175422003 20:58840564-58840586 GGTGAGGGACTGGCCGAAGGTGG - Intronic
1176171297 20:63697522-63697544 GGTGAGCCAGAGGCCTGAGGGGG + Exonic
1176632437 21:9152334-9152356 GGTGAGGGAATGGCCTGAGATGG + Intergenic
1177758330 21:25373746-25373768 GGAGAAGGAGTGGGAAGAGGAGG - Intergenic
1177969197 21:27767292-27767314 TGTGAGGGAGTGGACTGAGTGGG - Intergenic
1178702696 21:34846652-34846674 GGCGAGGGAGTGGCCTGACCTGG - Intronic
1179906568 21:44426030-44426052 GGTGGTGGAGGGGCCTGAGGGGG + Intronic
1179937372 21:44613969-44613991 GGAGGAGGAGAGGCCTGAGCTGG - Intronic
1179984826 21:44914370-44914392 GGGGAAGCAGGGGGCTGAGGGGG + Intronic
1180349896 22:11791863-11791885 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1180374178 22:12075313-12075335 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1180388313 22:12200389-12200411 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1180832316 22:18912475-18912497 GTGGCAGGAATGGCCTGAGGAGG + Intronic
1181041506 22:20194751-20194773 GGTGAGGGAGGGGCCTGGGCAGG - Intergenic
1181067526 22:20313867-20313889 GTGGCAGGAATGGCCTGAGGAGG - Intergenic
1181107987 22:20585936-20585958 GGGGAGGGAGGGGCCTGAGCTGG - Intronic
1181619343 22:24077822-24077844 AGTGAAGGGGTGGGCTGAAGGGG + Intronic
1182419022 22:30239733-30239755 GGTGAAGGAGTGGCCCTAACTGG + Intergenic
1183238657 22:36639570-36639592 GGAGGAGGAGTGGACAGAGGAGG - Intronic
1183253623 22:36746765-36746787 GGTGCAGGACTGGCCTGGGGCGG - Intergenic
1183350334 22:37331243-37331265 GGGGAAGGAGGGGCCTGGGCGGG - Intergenic
1183408463 22:37641494-37641516 CGGGAAGGAGGGGCCTGAGCAGG + Intronic
1183964301 22:41432044-41432066 GGGGAATGAGGGGCCTGAGGAGG + Intergenic
1184149899 22:42631784-42631806 GCTCAAGCAGTGGCCTGAAGGGG + Intronic
1184332064 22:43833525-43833547 GGAGGAGGAGGGGTCTGAGGAGG - Intronic
1184664495 22:45980653-45980675 GGTGATTGAGTGGGCGGAGGTGG + Intergenic
1184725721 22:46344535-46344557 GGAGAAAGAGTTCCCTGAGGTGG + Intronic
1184802853 22:46773144-46773166 GGTGAAGGGCTGAGCTGAGGAGG - Intronic
1184949904 22:47833888-47833910 GATGAAGGAGGGGCTTGAAGTGG + Intergenic
1185248410 22:49785949-49785971 TGTGAGGGAGTGGCCTGGGCAGG + Intronic
1203282402 22_KI270734v1_random:137780-137802 GTGGCAGGAATGGCCTGAGGAGG + Intergenic
1203299662 22_KI270736v1_random:68176-68198 TGTGAAGGAGTGGAGTGGGGTGG + Intergenic
949425947 3:3916110-3916132 GCTGAATGAGTTGCCTGAGAAGG + Intronic
950287899 3:11759459-11759481 GTTGAAGGAGTTCCCTCAGGAGG - Intergenic
950575948 3:13832136-13832158 GGAGCAGGAGGAGCCTGAGGAGG - Intronic
950710349 3:14809603-14809625 GCTGGAGGAGTGTCCAGAGGTGG - Intergenic
951270529 3:20618473-20618495 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
952114425 3:30161946-30161968 TGTGAAGGAGGGGCATGTGGTGG - Intergenic
952183848 3:30946938-30946960 GGTGAAGGATAGGCCTTATGAGG - Intergenic
953483700 3:43274537-43274559 GGTGAAGGCCTGGCCTGGTGGGG + Intergenic
953786810 3:45917233-45917255 GGTGAAGGGGTGGTGTGGGGAGG + Intergenic
953822592 3:46221492-46221514 TGTGAAGGATTGGGCTGCGGGGG - Intronic
953930409 3:47003081-47003103 GGTGAGGGAGTGTGCTGAGATGG + Exonic
954451046 3:50571917-50571939 GGTGCAGGAGTGGCAAGAGTGGG + Intronic
956583262 3:70837249-70837271 GGAGAAGGAGGGTCTTGAGGAGG + Intergenic
957099280 3:75808073-75808095 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
960266526 3:115626501-115626523 GGTAAAGGAGTGGGCAAAGGAGG + Intronic
960788260 3:121398402-121398424 GGTGAGGGAATGGCCTGAGCTGG + Intronic
960823929 3:121762526-121762548 TGTGAAGGAGAGGACTGAGAAGG - Intergenic
960991621 3:123315148-123315170 GGAGGAAGAGTGGCCTGACGAGG + Intronic
961323299 3:126093411-126093433 GGTGAGGGAATGGCCTGAGCTGG - Intronic
961454410 3:127017060-127017082 GGTGAAGGCCTGGACCGAGGTGG - Intronic
962234045 3:133692894-133692916 GGGGAAGCAGTGTCCTGATGGGG - Intergenic
962311808 3:134332172-134332194 GATGAAGGAGGGTCCTGAGAGGG - Intergenic
964867561 3:161277821-161277843 AGTGAAAGAGTGGGCTTAGGGGG - Intergenic
965511735 3:169575337-169575359 GGGGAAGGTGTGCCCTGCGGGGG + Intronic
965956592 3:174377727-174377749 GGTGGTGTAGTGGCCAGAGGTGG + Intergenic
966009296 3:175055536-175055558 GGTGAGGGAATGGCCTCAGTCGG + Intronic
966722852 3:183081612-183081634 GGTCAAGGAATAGGCTGAGGTGG + Intronic
966968268 3:185017782-185017804 GGTGAGGGAATGGCCTGAGCCGG + Intronic
966978391 3:185106644-185106666 GGTGAGGGAATGGCCTGAGCTGG - Intronic
967885565 3:194331371-194331393 GTTGAAAAAGTGGCCTGTGGAGG - Intergenic
968359993 3:198139909-198139931 GGAGATGGAGGGGCCAGAGGAGG + Intergenic
968689989 4:1985432-1985454 GGTGCAGGACAGGCCTGTGGGGG - Intronic
969866813 4:10081671-10081693 GGGGAAGGAGGGGCGGGAGGCGG + Intronic
970634313 4:17990501-17990523 GGTGAGGGAGTGGGGTGGGGTGG + Intronic
971377188 4:26064429-26064451 AGTGCAGCAGTGGGCTGAGGGGG + Intergenic
971491542 4:27217500-27217522 CGTGTAGGAGAGTCCTGAGGTGG + Intergenic
972080348 4:35141735-35141757 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
975352213 4:73359134-73359156 GATGAGGGAATGGCCTGAGCTGG - Intergenic
976557080 4:86462040-86462062 GGTGAGGGAGTGGCCTGAGCTGG - Intronic
976977789 4:91185562-91185584 GATGAGGGAATGGCCTGAGCTGG + Intronic
977016662 4:91699994-91700016 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
977625987 4:99190393-99190415 GGTGAGGGAATGGCCTGAGCCGG + Intergenic
977642054 4:99368187-99368209 GGTGAGGGAAGGGCCTGAGCTGG - Intergenic
977652889 4:99490290-99490312 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
979122261 4:116918941-116918963 GTTGAAGGAGGGGCCTGGTGGGG + Intergenic
979893649 4:126131880-126131902 GGTGAGGGAATGGCCTGAGCCGG - Intergenic
980435244 4:132763969-132763991 GGTCAAGGAATAGGCTGAGGTGG - Intergenic
980930364 4:139177748-139177770 GGTGACGGCGGGGCCTGCGGGGG - Intergenic
982090468 4:151876018-151876040 GGTGGGGGAGTGGAGTGAGGGGG - Intergenic
984060920 4:174988366-174988388 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
984169788 4:176345733-176345755 GGTGAGGGAATGGTCTGAGCCGG - Intergenic
984752349 4:183289879-183289901 GGTGAGGGCGTGGCCAGTGGGGG + Intronic
984956350 4:185049697-185049719 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1202755761 4_GL000008v2_random:60752-60774 GGTGAGAGAATGGCCTGAGCTGG - Intergenic
985500863 5:244136-244158 GGTGAGGGAGTGGCCTGAGCCGG - Intronic
985735998 5:1583388-1583410 GGTGAGGGAATGGCCTGAGCCGG + Intergenic
986742051 5:10712930-10712952 GGGGAGGGAGAAGCCTGAGGTGG + Intronic
988801532 5:34700408-34700430 GGTGAACAAGTGGCTTTAGGTGG + Intronic
988833528 5:35009626-35009648 GGTGAAGGTTTGGGGTGAGGAGG - Intronic
989742568 5:44790036-44790058 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
989758770 5:44987557-44987579 GGTGAGGGAATGGCCTAAGCTGG - Intergenic
990109545 5:52306478-52306500 GGTGAGGGAATGGCTTGAGCTGG - Intergenic
990279762 5:54237694-54237716 GCTGAAGTAGTGCCCTCAGGTGG - Intronic
990306972 5:54503411-54503433 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
991326549 5:65439645-65439667 GGTTAGTTAGTGGCCTGAGGGGG + Intronic
992632102 5:78691462-78691484 GGTGAAGGGGTTGCCTAAAGTGG + Intronic
994598799 5:101874993-101875015 GGTGAATGAGTGGACTGAACTGG - Intergenic
994858602 5:105158665-105158687 GTTGAAGGTGGGGCCTGAAGAGG - Intergenic
995592410 5:113713238-113713260 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
995711541 5:115041054-115041076 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
995717497 5:115094200-115094222 GGTGAATTAGTGGCCAGAGCTGG + Intergenic
996291718 5:121859621-121859643 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
996856677 5:128016065-128016087 GGAGCATCAGTGGCCTGAGGGGG - Intergenic
997360716 5:133293081-133293103 GGAGATGGAGTGGCGGGAGGTGG - Intronic
998173702 5:139887266-139887288 CGAGAAGGAGTGGCCTGAACTGG - Intronic
998400244 5:141844931-141844953 GGAGAAGCAGTGGCAGGAGGAGG + Intergenic
998646563 5:144068464-144068486 GGGAAATGACTGGCCTGAGGAGG + Intergenic
1000794027 5:165642410-165642432 GGTAAAGGAGTGGCTTGAGGAGG - Intergenic
1001507520 5:172291557-172291579 GGGGAAAGAATGGCCGGAGGTGG - Intergenic
1001667374 5:173444572-173444594 GGAGAAGAAGAGACCTGAGGAGG + Intergenic
1001928513 5:175657006-175657028 GGTGACAGAATGGCTTGAGGTGG + Intergenic
1002790252 6:432244-432266 TGTGAAGGTGTGGTTTGAGGTGG - Intergenic
1003976170 6:11346632-11346654 GGGGAAGGAGGGGGCTGGGGAGG + Intronic
1004193787 6:13486953-13486975 GGTGCAGGACTGGCTAGAGGTGG - Exonic
1005370499 6:25127275-25127297 GGGGACGGAGTGGCTAGAGGTGG + Intergenic
1005858224 6:29880492-29880514 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1005962522 6:30704170-30704192 GGTGACGGACTGGTCTGTGGGGG + Exonic
1006062969 6:31439402-31439424 GGGGAAGAAGTTGCTTGAGGAGG + Intergenic
1006185102 6:32177157-32177179 GGTAAAGGTGTGGCTAGAGGGGG - Intronic
1006421769 6:33939006-33939028 GGTGCAGGAGCGGACAGAGGGGG - Intergenic
1006634577 6:35452641-35452663 GCTGCAGGCGGGGCCTGAGGGGG + Exonic
1008093455 6:47315310-47315332 GGTGAAGGAATGGCCTGAGCTGG + Intergenic
1008191014 6:48457251-48457273 GGTGAAGCAGAGGCCAGAGAAGG + Intergenic
1008718399 6:54318039-54318061 TGCGAAGGAGTGGCCTGTGAGGG - Intronic
1009062803 6:58417698-58417720 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1009250475 6:61292245-61292267 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1009344825 6:62600536-62600558 GGAGAAGGAGGAGGCTGAGGTGG - Intergenic
1009955449 6:70447605-70447627 GGTGAGGGAATGGTCTGAGCTGG + Intronic
1013322505 6:109009152-109009174 GGGGAAGGGGTTGCCTGCGGTGG - Intronic
1013324313 6:109029494-109029516 AGGAAAGGAGTGGCTTGAGGAGG - Intronic
1013444251 6:110205660-110205682 GGTGAAGGAGTAGACAGAGAGGG - Intronic
1013475269 6:110501168-110501190 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1013519319 6:110918002-110918024 GGTGGGGGAATGGCCTGAGCTGG - Intergenic
1013545565 6:111153586-111153608 AGTGATGGAGTGGACAGAGGAGG + Intronic
1013627814 6:111955057-111955079 AGTGCAGGAGTGGACTGTGGGGG + Intergenic
1014308432 6:119770132-119770154 GGTGAGGGGGTGGCCTGAAATGG + Intergenic
1015540542 6:134309362-134309384 GGTGAAGGAGGTGCAGGAGGAGG - Intronic
1017040705 6:150306477-150306499 GGGGAAGGAGAGGACTGAGTGGG - Intergenic
1017349113 6:153418960-153418982 GTTGAAGGAGTGGCCAGGTGCGG + Intergenic
1017686640 6:156920155-156920177 GGTGAAGGGGTGCAATGAGGAGG - Intronic
1018213356 6:161503576-161503598 GGTGAGGGACTGGACTGAGGGGG + Intronic
1018594112 6:165460068-165460090 GGTGAGGGAATGGCCTGAGCTGG - Intronic
1018950129 6:168373629-168373651 GGTGAAGAAGGGGCCTCCGGAGG - Intergenic
1019183510 6:170207780-170207802 GGAGAAGGGGTGGTCTGTGGAGG - Intergenic
1019259995 7:76711-76733 GGAGATGGAGGGGCCAGAGGAGG - Intergenic
1019279025 7:191126-191148 GGTGAAGCTGTCTCCTGAGGGGG + Intergenic
1019420516 7:948544-948566 GGTGAATGAGAGGCCAGAGGGGG - Intronic
1019573274 7:1723934-1723956 GGTGAATGAGTGGCCTCAATGGG - Intronic
1019604535 7:1901875-1901897 TGTGGAGGAGGGGCCCGAGGAGG - Intronic
1019934734 7:4246805-4246827 GGCGCAGGGGAGGCCTGAGGCGG - Intronic
1020114662 7:5469758-5469780 GGTGGAGGTGTGGACTCAGGCGG + Intronic
1022516394 7:30977414-30977436 AGTGAAGGTGTGGCCTGAGCTGG - Intronic
1022964941 7:35463990-35464012 GCTGAAGGCGTGGTGTGAGGGGG + Intergenic
1023013574 7:35944026-35944048 GCTGCAGAAGGGGCCTGAGGAGG + Intergenic
1023137339 7:37065502-37065524 CATGAAGGAGTGACTTGAGGGGG - Intronic
1023676617 7:42636531-42636553 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1023804618 7:43863719-43863741 GGTGAAGGGATGGCCTGAGCCGG + Intergenic
1023972104 7:44999624-44999646 GGCGAAGGAGGGGCGCGAGGAGG - Intronic
1024077554 7:45829808-45829830 GCTGCAGAAGGGGCCTGAGGAGG - Intergenic
1024911296 7:54450160-54450182 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1025058648 7:55785515-55785537 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1025102437 7:56146849-56146871 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1025122663 7:56318381-56318403 GGTGAGGGAACGGCCTGAGCCGG - Intergenic
1025126856 7:56351604-56351626 GCTGCAGAAGGGGCCTGAGGAGG + Intergenic
1025220482 7:57103430-57103452 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1029408276 7:100390918-100390940 TATGGAGGAGTGGCCAGAGGTGG + Intronic
1029452002 7:100646657-100646679 GGAGAAGGAGTGAGCTGCGGGGG + Intronic
1029607057 7:101605565-101605587 GGTGAAGTAGAGCCCTGAGAGGG - Intergenic
1030161968 7:106518452-106518474 GGAGAAGGAGTGGAGAGAGGGGG - Intergenic
1030995333 7:116352673-116352695 GGCGCCGGAGTGGTCTGAGGAGG + Intronic
1032740623 7:134734909-134734931 GTTTAAGGAGTGGGATGAGGAGG - Intergenic
1032792422 7:135252390-135252412 GTTGAAGGAGGGGCCTGGTGAGG - Intronic
1032817382 7:135490619-135490641 GGGGAAGGAGTGGTCAGAGATGG - Intronic
1033037252 7:137886313-137886335 ACAGAAGGAGTGGCCAGAGGTGG + Intronic
1033499477 7:141933512-141933534 GGTCAAGGAATAGGCTGAGGTGG + Intronic
1033609080 7:142948185-142948207 GCTGTAGTAGTGGTCTGAGGTGG - Intronic
1034246677 7:149650012-149650034 GGTGAGGAAATGGCCTGAGCCGG + Intergenic
1034333988 7:150308647-150308669 TGTCAAGGAGTGGCCTGGGGAGG - Intronic
1034513286 7:151553504-151553526 GGGGAAGAAGTGGCCGGAGCCGG - Intergenic
1034697821 7:153069624-153069646 GAAGAAGGAATGGCCTTAGGTGG + Intergenic
1034936954 7:155206448-155206470 GGCCACGGAGGGGCCTGAGGAGG - Intergenic
1035589563 8:802350-802372 AGGGAAGCTGTGGCCTGAGGTGG - Intergenic
1036698299 8:10993732-10993754 GGAGCAGGAGTGGCATGAGTGGG - Intronic
1037329082 8:17725985-17726007 GGTAGAGGCATGGCCTGAGGGGG - Intronic
1038256744 8:25957451-25957473 GGTGAAGAGGTGGCCTGCGGGGG - Intronic
1038325233 8:26567790-26567812 GGTGAGGTAGTGGCCTTAGATGG + Intronic
1038483762 8:27919276-27919298 GGTGAAGGAGGAGGATGAGGAGG + Intronic
1039251496 8:35670083-35670105 AGAGAAGGAGTGGCCAGAGTGGG + Intronic
1039691293 8:39867643-39867665 GGTGAAGGAGGGGGAGGAGGAGG - Intergenic
1039691812 8:39872387-39872409 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1040528792 8:48248441-48248463 CGTGAGGGAATGGCCTGAGCTGG + Intergenic
1040609046 8:48964274-48964296 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1040841822 8:51792730-51792752 GGTCAAGGTCTGGCCTGAAGAGG - Intronic
1040943312 8:52854411-52854433 GGTGAAGGACTGAGCTAAGGTGG - Intergenic
1041018986 8:53619065-53619087 GGTGAGGGAGTAGCCTGAGCTGG - Intergenic
1042154318 8:65825847-65825869 GGTGAAGGTGGGGGGTGAGGCGG + Intronic
1042446462 8:68890636-68890658 GGTGAGGGAATGGCCTGATCTGG - Intergenic
1044275026 8:90289328-90289350 GGTGAAGGAATAGACTGAGAGGG - Intergenic
1045330701 8:101153509-101153531 GTTGCAGGGGTGGGCTGAGGGGG - Intergenic
1046184126 8:110690721-110690743 GGTCAAGGAATAGGCTGAGGCGG - Intergenic
1046950889 8:120018771-120018793 TGTGAAGCGGTGGCCTGAGATGG + Intronic
1047080311 8:121452829-121452851 GGTGAGGGGGTGGCCAGTGGAGG + Intergenic
1047362136 8:124178880-124178902 GGTGAAGGAATGGACAGTGGTGG - Intergenic
1047562955 8:126009036-126009058 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1047852835 8:128877559-128877581 GGTGGAGGAGAGGCAGGAGGAGG + Intergenic
1047903899 8:129452613-129452635 GATTAAAGAGTGGCCTGAGGCGG - Intergenic
1048686605 8:136911520-136911542 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1048755392 8:137732691-137732713 GTTGAGGGTGTGGCATGAGGTGG + Intergenic
1048866530 8:138765508-138765530 GGTCAAGGAATAGGCTGAGGCGG + Intronic
1049150872 8:141034739-141034761 GGGGCAGAAGTGGCCTGAGGGGG - Intergenic
1049310435 8:141931253-141931275 GAGGAAGGAGAGGCCTGGGGAGG + Intergenic
1049478969 8:142811009-142811031 GGAGGAGGAGTGGCCCGAGTGGG - Intergenic
1049857612 8:144873036-144873058 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1049973375 9:840561-840583 GGTGAAGGGCTGGCCTTAGGGGG + Intergenic
1051599467 9:18858340-18858362 GGTGCAGTGGTGACCTGAGGAGG - Intronic
1052514489 9:29462634-29462656 GGTCAGGGAGTGGGGTGAGGGGG - Intergenic
1052748539 9:32464911-32464933 GGATAAGGAGTGGGGTGAGGAGG - Intronic
1053126325 9:35583547-35583569 GGTGAGGGAATGGCCTGAGCCGG - Intergenic
1055554162 9:77458953-77458975 GGTGACAGAGTGCCATGAGGAGG - Intronic
1055635138 9:78269708-78269730 GGGGCAGGAATGCCCTGAGGGGG + Intronic
1055867104 9:80827981-80828003 GCTGAAGGACTGGTTTGAGGGGG - Intergenic
1056195576 9:84225297-84225319 GTTGACGGAGTGGGCTAAGGTGG + Intergenic
1057285937 9:93754344-93754366 GGTTAGGGAATGGCCTGAGCTGG + Intergenic
1057901470 9:98952103-98952125 GGTGCAGGACTGGCATGAAGTGG + Intronic
1059414481 9:114154818-114154840 CGTGAACGAGTGGCAAGAGGTGG + Intergenic
1061059877 9:128245016-128245038 TGAGAAGGAGGGGCCTGAGGAGG + Intronic
1061602730 9:131682363-131682385 GGTGATGGAATGGCCTGAGCTGG - Intronic
1061762507 9:132860199-132860221 AGTGAGGGAGGGGCCTGAGCAGG + Intronic
1062206144 9:135338502-135338524 GGAGAAGGGGAGGCCTGAGAGGG + Intergenic
1062216910 9:135394187-135394209 GATGAAGGGGTGGCCTGGTGAGG - Intergenic
1062715995 9:138010340-138010362 GGAGCAGGAGGGGCCTGAGCAGG + Intronic
1062744701 9:138203750-138203772 GGAGATGGAGGGGCCAGAGGAGG + Intergenic
1203687365 Un_GL000214v1:7799-7821 GGTGAGGGAATAGCCTGAGCTGG - Intergenic
1203755267 Un_GL000218v1:119958-119980 GGTGAGGGAATGGCCTGAGATGG + Intergenic
1203536565 Un_KI270743v1:45589-45611 GGTGAGGGAATGGCCTGAGCTGG - Intergenic
1203648910 Un_KI270751v1:96254-96276 GGTGAGGGAATAGCCTGAGCTGG + Intergenic
1185776760 X:2809353-2809375 GGTGAAGAATGGACCTGAGGGGG + Intronic
1186894478 X:13992314-13992336 GGTTAAGGAGTGCCCTGCTGTGG + Intergenic
1187207569 X:17197515-17197537 GGTCAAGGAATAGGCTGAGGTGG + Intergenic
1187272376 X:17791089-17791111 GGGGAAGGAGTGTCAAGAGGAGG + Intergenic
1187468095 X:19543779-19543801 GATGGAGAAGTGTCCTGAGGAGG + Intronic
1188409534 X:29854322-29854344 GGAGAAGGAGTGGCCTGACCTGG + Intronic
1188980215 X:36720667-36720689 GGGGAAGGGGTGGCCTGTGTGGG + Intergenic
1189194926 X:39144849-39144871 GGGGATGGAGTGGGATGAGGTGG + Intergenic
1189395512 X:40619159-40619181 GGTGAAGGAGAGGCCAGGAGAGG + Intergenic
1190259867 X:48790990-48791012 GGTGATGGAGTGGGAGGAGGGGG + Intronic
1191149679 X:57207894-57207916 GGTGAGGGAATGGCCTGAGCCGG + Intergenic
1191253122 X:58268637-58268659 GGGAAAGCACTGGCCTGAGGGGG + Intergenic
1192219013 X:69184428-69184450 GGAGAAGGAGGGGGCAGAGGGGG - Intergenic
1192319288 X:70076626-70076648 GCTGAAGAAGCAGCCTGAGGTGG + Intergenic
1192360688 X:70436862-70436884 GGTAAGGAAGGGGCCTGAGGAGG + Intergenic
1192362498 X:70448571-70448593 GGTGCAGGCCTGGCCTAAGGGGG - Intronic
1192687563 X:73323124-73323146 GGTGAGGGAATGGCCTGAGCTGG + Intergenic
1193048721 X:77079168-77079190 GGTGAGGGAATGGCCTCAGCTGG - Intergenic
1194520674 X:94915652-94915674 TGTGAAGGCGTTGCCAGAGGAGG + Intergenic
1195619591 X:106939644-106939666 GGTGAATGAGGGGACTGAGTAGG - Intronic
1196783153 X:119400272-119400294 GGTGAAGCGGTAGGCTGAGGGGG - Intronic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1198932020 X:141872015-141872037 GGGGAAGGAGAGACCTGGGGAGG + Intronic
1199595009 X:149500043-149500065 GATGAACAAGTGGTCTGAGGCGG - Intronic
1199846319 X:151695049-151695071 GGCGACGGAGTGGGCCGAGGGGG - Intergenic
1201168884 Y:11237567-11237589 GGTGAGGGAATGGCCTGAGATGG + Intergenic
1201291000 Y:12420967-12420989 GGCGCAGGAGTGGGCTGGGGTGG - Intergenic
1201363070 Y:13174686-13174708 AGTGAAGGAATGGCCTGAGCTGG + Intergenic
1201370169 Y:13254528-13254550 GGTAAGGGAATGGCCTGAGCTGG - Intronic
1201926675 Y:19295021-19295043 GGTGAGGGAATGGCCAGAGCTGG - Intergenic
1202164036 Y:21968146-21968168 GGTGAAGGAATGGCCTGAGCTGG + Intergenic
1202227320 Y:22618218-22618240 GGTGAAGGAATGGCCTGAGCTGG - Intergenic
1202272597 Y:23085753-23085775 GGTGATGGCGGGGACTGAGGGGG + Intergenic
1202293429 Y:23334929-23334951 GGTGATGGCGGGGACTGAGGGGG - Intergenic
1202315802 Y:23577436-23577458 GGTGAAGGAATGGCCTGAGCTGG + Intergenic
1202425594 Y:24719497-24719519 GGTGATGGCGGGGACTGAGGGGG + Intergenic
1202445195 Y:24950588-24950610 GGTGATGGCGGGGACTGAGGGGG - Intergenic
1202554963 Y:26092638-26092660 GGTGAAGGAATGGCCTGAGCTGG - Intergenic