ID: 1165867097

View in Genome Browser
Species Human (GRCh38)
Location 19:38945724-38945746
Sequence CAGAACCTGGAGGAGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 1, 2: 10, 3: 79, 4: 626}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165867087_1165867097 13 Left 1165867087 19:38945688-38945710 CCTGGGGGAGGAGCCTGGGTGGT 0: 4
1: 6
2: 7
3: 50
4: 441
Right 1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG 0: 1
1: 1
2: 10
3: 79
4: 626
1165867093_1165867097 -10 Left 1165867093 19:38945711-38945733 CCTGGGGTGGAACCAGAACCTGG 0: 1
1: 1
2: 3
3: 13
4: 203
Right 1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG 0: 1
1: 1
2: 10
3: 79
4: 626
1165867092_1165867097 0 Left 1165867092 19:38945701-38945723 CCTGGGTGGTCCTGGGGTGGAAC 0: 2
1: 1
2: 6
3: 23
4: 199
Right 1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG 0: 1
1: 1
2: 10
3: 79
4: 626
1165867083_1165867097 23 Left 1165867083 19:38945678-38945700 CCTGGGTGGTCCTGGGGGAGGAG No data
Right 1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG 0: 1
1: 1
2: 10
3: 79
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165867097 Original CRISPR CAGAACCTGGAGGAGAAGCC TGG Intronic
900114041 1:1020979-1021001 AAGCACCTGAAGGAGAAACCAGG - Intronic
900311657 1:2036274-2036296 AAGCACCGGGAGGAGAAGGCTGG - Intergenic
900575637 1:3381008-3381030 GAGCTCCTGGAGGAGAACCCTGG - Intronic
900647269 1:3714605-3714627 CAGAGGCCGGAGGAGAGGCCAGG + Intronic
900879163 1:5368184-5368206 CAGAGCCGGGATTAGAAGCCTGG + Intergenic
901013443 1:6213741-6213763 CAGGACATGGAGGAGAGGGCAGG + Intronic
901048426 1:6413241-6413263 CTGAGCATGGAGGGGAAGCCAGG + Intronic
901230162 1:7637304-7637326 CTGGCCCTGGAGCAGAAGCCCGG - Intronic
901557224 1:10041237-10041259 CAGAACCTGGATTAGAGTCCAGG - Intronic
902110773 1:14076410-14076432 CAGAAGCTGGGGGAGAGGCAAGG + Intergenic
902350091 1:15847885-15847907 CAGAACCTGGGGGAGAGGGATGG + Exonic
902511707 1:16970236-16970258 CAGCACCTGCAACAGAAGCCAGG - Exonic
902803652 1:18847240-18847262 CAGGAGCTTGGGGAGAAGCCTGG + Intronic
902923551 1:19681055-19681077 CAGAATCTGGACCAGAACCCAGG - Intergenic
903259546 1:22123989-22124011 CAGAACCAGGTAGAGAAGGCTGG - Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903620794 1:24696533-24696555 CAGAACCAGGAGCAGAAACTGGG - Intergenic
903748091 1:25602177-25602199 AAGAACCTGGAGCAGAGGTCTGG + Intergenic
904844142 1:33396167-33396189 CAAACCCTGGAGGAGAAGCAGGG - Intronic
905649018 1:39644301-39644323 CACACCCAGGAGGAGAACCCAGG + Intergenic
905808601 1:40895208-40895230 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
905969921 1:42133951-42133973 CTGACTCTGAAGGAGAAGCCAGG + Intergenic
906131977 1:43465716-43465738 CAGAACCTAGAGGAGATACAGGG + Intergenic
906196734 1:43934489-43934511 CAGGACCTGGAGGACAACCCCGG + Intronic
907046374 1:51302568-51302590 CAGTACCTGGAGGAGATGGTGGG + Exonic
907241809 1:53085145-53085167 CAGCACCTGGAGGAGCAGGGTGG - Exonic
907789161 1:57645007-57645029 GAGAAGCTGAAGGAGAATCCAGG + Intronic
907830673 1:58061402-58061424 AAGAAGCTAGAGGAGAAGCCTGG - Intronic
907896950 1:58701041-58701063 CAGAGCCAGGAGTAGAATCCAGG + Intergenic
908932149 1:69330628-69330650 CAGAAGGTGAAGGGGAAGCCAGG + Intergenic
909024166 1:70463711-70463733 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
909969588 1:81965367-81965389 TAGAACCTGCAGGCCAAGCCTGG - Intronic
910275601 1:85446246-85446268 CAGAAGCTGAAAGGGAAGCCAGG + Intronic
910412038 1:86956320-86956342 GAGAACCTGCAGGCAAAGCCAGG + Intronic
910558339 1:88562321-88562343 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
911664127 1:100535063-100535085 GAGAACCAAGAAGAGAAGCCAGG + Intergenic
912474441 1:109926654-109926676 CAGAAGGTTGTGGAGAAGCCAGG - Intronic
912488095 1:110045178-110045200 AAGAACCTGGGGTAGAGGCCGGG + Intronic
912599717 1:110917103-110917125 GAGAACCTGAAGGAGGATCCAGG - Intergenic
912692734 1:111816444-111816466 CAGAACCTGAAGAATAAACCTGG + Intronic
912795170 1:112688951-112688973 TACAGCATGGAGGAGAAGCCAGG - Exonic
915248200 1:154570706-154570728 TAGAACCTGGAGGAGAAACTGGG - Intronic
915318392 1:155042680-155042702 CTGCACCTGGAGGACAGGCCCGG + Intronic
915731846 1:158059461-158059483 CTCAACCTGGAGGCCAAGCCAGG - Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915969073 1:160339977-160339999 CTGGACCTGGTGGAGAAGGCAGG + Exonic
916302639 1:163293334-163293356 CAGAAGATGAAGGAGAAGCAAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916520878 1:165562640-165562662 CAGAATCTGGATTAGAAGCCTGG + Intronic
916716780 1:167453340-167453362 CAGAGCCTGGACGAGAAGCCAGG + Intronic
917563269 1:176182328-176182350 CAGAACCAGAAGTAGAATCCTGG + Intronic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919658613 1:200221687-200221709 CGGAAGCTGGGGGAGAAGGCAGG - Intergenic
920037367 1:203075083-203075105 CAGAGCCAGGATTAGAAGCCAGG + Intronic
920055051 1:203185380-203185402 CAGAGCCTGAAGGAGAAGTCTGG + Exonic
920662454 1:207927474-207927496 AAGAACCTGGATGAGAAGGGAGG + Intergenic
920670245 1:207998602-207998624 CAGAGGCTGGAAGAGCAGCCAGG - Intergenic
921260203 1:213379466-213379488 CAGAAGCTTGGGGAGAGGCCTGG + Intergenic
921261994 1:213392802-213392824 CAGAGCCTGGAGGAAAATTCAGG + Intergenic
921266686 1:213426338-213426360 CATAACCTGGGAGAGAAGGCTGG + Intergenic
921314040 1:213874058-213874080 CATCACCTGAAGGAAAAGCCAGG + Intergenic
921650668 1:217674439-217674461 CAGCAGCTGGAGCACAAGCCAGG - Intronic
922549243 1:226482026-226482048 CAGGAGATGGGGGAGAAGCCTGG - Intergenic
923506025 1:234607797-234607819 CAGAACCAGAAGGTGAAGTCGGG - Exonic
923604889 1:235434187-235434209 CAGCACCTGGAAGAGAAACTCGG - Exonic
924004029 1:239587172-239587194 CAGCACGTGGAGGTGAGGCCAGG - Intronic
924061752 1:240182235-240182257 GAGAACCTGGAGCAGGAGCAAGG + Intronic
1063158704 10:3403422-3403444 CAGTAGCTGGATGAAAAGCCTGG - Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063656137 10:7990948-7990970 CAGAACCTGGAGGAGACAGAGGG + Intronic
1064350079 10:14568383-14568405 AAGATACTGGAGGAGAAGGCTGG + Intronic
1064458426 10:15509907-15509929 CAGAAGCTGGGAGAGATGCCTGG + Intergenic
1064611763 10:17110913-17110935 CAGCACCTGGTGGACAGGCCTGG + Exonic
1064720509 10:18224607-18224629 TAGAACCTGGATGAGAACCTGGG + Intronic
1066046289 10:31598352-31598374 CAGAATGTGGGAGAGAAGCCAGG + Intergenic
1066491302 10:35897832-35897854 CAGGACCTGGAGGAGCCGACAGG - Intergenic
1066562771 10:36688809-36688831 GAGTACCTGGAGGTAAAGCCTGG - Intergenic
1067084757 10:43231870-43231892 CAGAAAGTAGAGAAGAAGCCAGG + Intronic
1067163341 10:43845391-43845413 AAGTACCTGGAGGAGAGGTCCGG - Intergenic
1067547613 10:47205753-47205775 CAGAACCTGGAAGGGAAGAGGGG + Intergenic
1067756887 10:49012086-49012108 CAGCACCTCGAGGAGTAGCAAGG - Intergenic
1068244027 10:54341401-54341423 CAGAAGGTGAAGGAGAAGCATGG - Intronic
1068465202 10:57381125-57381147 CAGATCCTGGAAGACAACCCAGG + Intergenic
1069403778 10:68076626-68076648 CAGAAGCTAGCAGAGAAGCCTGG - Intergenic
1069685740 10:70317296-70317318 CAGAAGCAGAAGCAGAAGCCAGG - Intronic
1069706550 10:70462287-70462309 CAGAGCCGGGAGTAGAACCCAGG - Intergenic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1071098285 10:82004749-82004771 CAGAGCCTGTATGAGAAGTCTGG + Intronic
1071411500 10:85401448-85401470 GAGAAGCTGAAGGAGGAGCCAGG + Intergenic
1071412259 10:85408268-85408290 CCAAAGCTGGAGGAGAAGGCTGG + Intergenic
1071476914 10:86033082-86033104 GAGAAGCTGGAATAGAAGCCTGG + Intronic
1071907627 10:90191613-90191635 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1072540192 10:96392611-96392633 CAGAACCTGGGGTGGAAGTCAGG + Intronic
1072789670 10:98309139-98309161 CTGAGCCTAGAGGAGATGCCGGG - Intergenic
1073328965 10:102658548-102658570 CAGAACCTCAAAGAGATGCCGGG - Intergenic
1074046861 10:109847274-109847296 CAGGACCTTGAGGAGAATGCAGG + Intergenic
1074249972 10:111735268-111735290 CAGAACCTCCAGAAGAAGCATGG - Intergenic
1074345387 10:112680425-112680447 CAGAACTTGGACCAGAACCCTGG + Intronic
1074708935 10:116161037-116161059 TTCAACCTGGAGGAGGAGCCTGG + Intronic
1074754447 10:116614023-116614045 CAGAAGCTGTGGAAGAAGCCTGG - Intergenic
1075192682 10:120325323-120325345 CAGAACCTAGAAGAGAAGCATGG - Intergenic
1075203404 10:120425376-120425398 CAGAGCCTGGAGTTGAACCCAGG - Intergenic
1075427174 10:122350869-122350891 CAGGGCCAGAAGGAGAAGCCTGG - Intergenic
1076181331 10:128411217-128411239 CAGAACCTGCAGGTGACACCAGG - Intergenic
1076316942 10:129548854-129548876 CTGGACCTGGAGGACCAGCCTGG - Intronic
1076746910 10:132519148-132519170 CACCACCTGGAGGAGTAGCTGGG - Intergenic
1077289305 11:1781579-1781601 CAGAACCTGCAACAGAGGCCAGG - Intergenic
1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG + Exonic
1077309687 11:1882828-1882850 CTGAACCTGGAGGAGAAGATGGG - Intronic
1077563057 11:3277414-3277436 CAGAGGCTGGATGAGAAGCCAGG + Intergenic
1077568948 11:3323230-3323252 CAGAGGCTGGATGAGAAGCCAGG + Intergenic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1078025315 11:7689547-7689569 CAGAAGCTAGAGGAGAGGCTTGG - Exonic
1078147262 11:8730400-8730422 CAGGTCCTGAAGGAGCAGCCGGG - Exonic
1078876955 11:15408758-15408780 CAGAAGCTGCAAGAGAGGCCTGG + Intergenic
1079061329 11:17251522-17251544 CAGGAGGTGGAGGAGAAGACAGG + Intronic
1079293363 11:19209230-19209252 CAAAGCCTTTAGGAGAAGCCTGG + Intronic
1079308963 11:19347571-19347593 ATGAACTTTGAGGAGAAGCCAGG + Intergenic
1079607545 11:22389104-22389126 CAGAAGCTAGGAGAGAAGCCTGG - Intergenic
1080646645 11:34192714-34192736 CAGACCCTTGAGGAGTGGCCAGG - Intronic
1080748654 11:35132076-35132098 CAGAACATGGATGTGAGGCCAGG - Intergenic
1081470815 11:43368833-43368855 CTGAGGCTGGAGGAGAAGACAGG - Intronic
1081664015 11:44905957-44905979 CAGAGCCTGGACCAGAAGCCAGG - Intronic
1082816324 11:57512267-57512289 CAGCACCAGGTGGAGAAGGCAGG + Intronic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1083514350 11:63242907-63242929 CAGAAGGTGGAGGAGAAGAGAGG - Intronic
1083680915 11:64351521-64351543 CAGCACCTGGAGGGGCAGCTGGG + Exonic
1084802204 11:71552360-71552382 CACACCCTGGGGGAGAAGCAGGG - Intronic
1085024791 11:73230127-73230149 CAGAAGCTGCAGGAGGAGCAAGG - Intronic
1085901457 11:80704615-80704637 CAGAACCTGGATCAGAATGCAGG - Intergenic
1085905470 11:80755947-80755969 CAGAACCTGGAGTTGAACTCAGG - Intergenic
1086902517 11:92383705-92383727 GAGATCCTGGAGGATAAGACAGG - Intronic
1087296788 11:96386922-96386944 TAAAACCTGGAGGAGAAACTGGG - Intronic
1088217508 11:107529108-107529130 CAGAGCCAGGATCAGAAGCCAGG - Intronic
1088784846 11:113172003-113172025 CAGAAACTAGAAGAGAAGCCTGG + Intronic
1088998332 11:115024957-115024979 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1089582392 11:119489528-119489550 CAGAGCCTGCAGGAGAAGCAGGG + Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091078224 11:132641107-132641129 CAGGATCTGGTGGAGAAGCTGGG + Intronic
1091147057 11:133289253-133289275 CAAAACATGAAGGAGAAGTCAGG - Intronic
1091154578 11:133361403-133361425 CAGGACCTGGAGGGGGTGCCTGG - Intronic
1091273877 11:134337144-134337166 CAGAGCCTGGATGTGAGGCCAGG + Intronic
1091727622 12:2856770-2856792 CAGAACAGAGAGGAGATGCCTGG - Intronic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092507553 12:9119565-9119587 CAGTACCTGACGGAGATGCCAGG + Intergenic
1092769398 12:11883174-11883196 CAGAACCTGGAGAGGCAGCTGGG - Intronic
1093528012 12:20126020-20126042 CAGAACCTGGATTTGAACCCAGG + Intergenic
1093561386 12:20545684-20545706 AAGATCCTGGAGGAAAAGCTGGG + Intronic
1094433647 12:30397793-30397815 CAGAGCCTGGAGGAAGAGCCAGG + Intergenic
1095693922 12:45122402-45122424 CACAACCTGGTGTAGAACCCAGG - Intergenic
1096230011 12:49891558-49891580 CAGAAGCAGGATGAGAACCCAGG + Intronic
1096535379 12:52268970-52268992 CAGAACGTGAAGGGGAAGCAAGG + Intronic
1096542384 12:52314977-52314999 CAGAACCAGGACCAGAACCCCGG - Intronic
1098385546 12:69914960-69914982 CTGATGATGGAGGAGAAGCCCGG + Intronic
1100270855 12:93023176-93023198 CAGAGCCAGGAGTTGAAGCCAGG - Intergenic
1100980059 12:100156694-100156716 CAGAACCTCCAGGAGCACCCAGG - Intergenic
1101055239 12:100905700-100905722 CAGCAGCTGGAGGAGAAGTAAGG + Intronic
1102225192 12:111223652-111223674 CAGCACATGGCGGAGAGGCCAGG + Intronic
1102773654 12:115500147-115500169 CAGAAGCTAGAAGAGAGGCCTGG + Intergenic
1103055395 12:117816194-117816216 CAGAACCTGGAGGAGGTGCATGG - Intronic
1103145204 12:118589644-118589666 CAGACCCTGAAGGAGAAAACAGG - Intergenic
1103241230 12:119414875-119414897 CAGAACCAGGATGAGAACCCTGG - Intronic
1103367642 12:120394780-120394802 CGGAAGCTGGAGGAAAAGCCTGG - Intergenic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1104641665 12:130471132-130471154 CAGGCCCTGGAGGAGGGGCCGGG + Intronic
1105544516 13:21341943-21341965 CAGTCCCGGGAGGAGCAGCCTGG - Intergenic
1105844970 13:24286296-24286318 CAGAACCTGGATGACATCCCCGG - Exonic
1105991726 13:25628675-25628697 CAGAAGCTGGAGGAGAAGCCTGG - Intronic
1106707617 13:32298756-32298778 GAGACCCTGAAGGAGAAGCAGGG + Exonic
1107042345 13:35962427-35962449 CAGAAGCTAGGGGAGAGGCCTGG + Intronic
1107991248 13:45820706-45820728 CAGAAACTGCAGAAGCAGCCAGG - Intronic
1108324512 13:49316970-49316992 CAGAAGCTGGGAGAGAAGCAAGG + Intronic
1108548573 13:51520835-51520857 CAGAACCTGGGAGAGAGGCATGG - Intergenic
1109238568 13:59854203-59854225 TAGAAGCTGGAAGAGAAGCATGG + Intronic
1109249323 13:59999804-59999826 GAGACCCTGGAGGAGGAGCTGGG - Intronic
1110288964 13:73782132-73782154 CAGAACCTGGATTTGAACCCCGG - Intronic
1110332201 13:74285669-74285691 CAGAACCAGGACTAGAAACCAGG - Intergenic
1111420064 13:88000043-88000065 CAGAGCCCTGAGGAGAAGCATGG - Intergenic
1112440238 13:99419795-99419817 AAGCACCTGGAGGAGGAACCAGG - Intergenic
1112567074 13:100560941-100560963 CAGGCCCTGGAGGAGATGCGGGG - Intronic
1113310994 13:109132833-109132855 CAGATCCTCGGGGAGAATCCAGG - Intronic
1113510589 13:110851192-110851214 CTGGAGCTGGAGGAGCAGCCGGG + Intergenic
1113565259 13:111315892-111315914 AAGGAGCTGGAGGAGAGGCCTGG - Intergenic
1113594916 13:111524392-111524414 CAGATGCTGGGAGAGAAGCCAGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113762878 13:112862372-112862394 CAGAGCCTGGGGGAGGTGCCGGG + Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114656162 14:24316767-24316789 CAGTACCTGGAGGAGGAGCAGGG + Exonic
1115464169 14:33696303-33696325 CAGAACCAGGAGTAGAATACGGG - Intronic
1115971789 14:38952903-38952925 CAGAACATGGAGGAGACACAGGG + Intergenic
1116375223 14:44190790-44190812 CAGAAGCTGAAGGGGAAGCAAGG - Intergenic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117411933 14:55457959-55457981 CAGAAGCTGGAGGGGAGACCTGG - Intergenic
1117739556 14:58802863-58802885 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1118048822 14:62004193-62004215 CAGAAGGTGAAGGAGAAGCAAGG + Intronic
1118092357 14:62496869-62496891 CAGAAGTTGAAGGAGAAGCAAGG + Intergenic
1118336543 14:64858102-64858124 TAGAACCTGGATTTGAAGCCAGG + Intronic
1119124420 14:72112368-72112390 TAATCCCTGGAGGAGAAGCCAGG - Intronic
1119149641 14:72346765-72346787 AAGAACATGGGGGAGAACCCAGG - Intronic
1119365271 14:74085729-74085751 CAGAACCAAGAGGAAAAGCATGG - Intronic
1119474234 14:74917992-74918014 CAGAAACTGCAGGAGGAGCGAGG - Intronic
1119535937 14:75402287-75402309 CAGAACCCGGAGGTGCAGGCTGG + Intergenic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1119747223 14:77052948-77052970 CAGGAACTGGAGAAGAACCCGGG + Intergenic
1119898810 14:78243057-78243079 CAGAGCCCGGAGGAGCAGACAGG - Intronic
1120751156 14:88199498-88199520 AAGAACCTGGAAAAGCAGCCAGG + Intronic
1120824866 14:88945860-88945882 CAGAGGGTGGAGGAGAGGCCTGG + Intergenic
1121251586 14:92503763-92503785 GAGCAGGTGGAGGAGAAGCCAGG - Intergenic
1121320782 14:92990573-92990595 CAGAGCCTGGAGGGGAAGCAGGG - Intronic
1121492223 14:94368841-94368863 CAGAGCCTGGAAGAGAAGCCAGG - Intergenic
1121866023 14:97363733-97363755 CAGAAGCTGGGAGAGAGGCCTGG + Intergenic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122442264 14:101740202-101740224 CAGAAGGTGGAGGGGAAGCAAGG + Intergenic
1123187261 14:106531613-106531635 CAGGACCTGCAGGAGAAGAGGGG + Intergenic
1123468657 15:20534227-20534249 CAGGAGCTGGAGGAGAGGCTGGG - Intronic
1123649457 15:22466835-22466857 CAGGAGCTGGAGGAGAGGCTGGG + Intronic
1123728975 15:23129438-23129460 CAGGAGCTGGAGGAGAGGCTGGG - Intronic
1123747139 15:23326903-23326925 CAGGAGCTGGAGGAGAGGCTGGG - Intergenic
1124072974 15:26413042-26413064 GAGATCCTAGAGGAAAAGCCTGG - Intergenic
1124279408 15:28350219-28350241 CAGGAGCTGGAGGAGAGGCTGGG - Intergenic
1124303290 15:28561389-28561411 CAGGAGCTGGAGGAGAGGCTGGG + Intergenic
1124532190 15:30517829-30517851 CAGGAGCTGGAGGAGAGGCTGGG + Intergenic
1124766463 15:32489816-32489838 CAGGAGCTGGAGGAGAGGCTGGG - Intergenic
1125174805 15:36808459-36808481 AAGATCCTGGAAGAGAAGCTGGG + Exonic
1125368367 15:38943162-38943184 CAGAACCCGGATTTGAAGCCAGG + Intergenic
1126559664 15:50029369-50029391 CAGAAGCTAGGAGAGAAGCCTGG - Intronic
1126811170 15:52406046-52406068 CAGAACTTGAAGGATAAGGCAGG + Intronic
1128111854 15:65081531-65081553 CAGAACCTGGCTGTGAACCCAGG + Intergenic
1129413436 15:75362020-75362042 CAATCCCTGCAGGAGAAGCCAGG + Intronic
1129683296 15:77670707-77670729 CAGAACTGGGCAGAGAAGCCAGG + Intronic
1129839576 15:78735437-78735459 AAGGAGCTGAAGGAGAAGCCAGG + Intergenic
1130213242 15:81945476-81945498 CAGAAGCTGGGAGAGAAGCATGG - Intergenic
1130238180 15:82158957-82158979 CAGAACCTGGTTTAGAAGCTGGG + Intronic
1130412489 15:83658632-83658654 CAGATCCCTAAGGAGAAGCCTGG - Intronic
1130429301 15:83830771-83830793 CAGAAGCTGGAAGAGAGGCAAGG - Intronic
1132079295 15:98851266-98851288 CAGATGCTGGAGGAGAGGGCTGG + Intronic
1132703601 16:1231876-1231898 CAGAGAATGGAGGAGAAGCAGGG - Intergenic
1132704908 16:1239485-1239507 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1132707917 16:1254519-1254541 CAGAGAATGGAGGAGAAGCAGGG + Intergenic
1132768317 16:1546384-1546406 CAGAGCCAGGAGCAGAACCCAGG - Intronic
1132784278 16:1646224-1646246 AAAAACCTGGAGGCAAAGCCTGG - Intronic
1133463114 16:6004250-6004272 CAGAGCCTGCAGGCAAAGCCAGG - Intergenic
1133888694 16:9856815-9856837 CAGAACCAGGATGTGAACCCAGG + Intronic
1136128419 16:28202417-28202439 CAGAACCTGGAAGAGAGGACCGG + Intronic
1136636686 16:31528807-31528829 CAGACCATGAAAGAGAAGCCAGG - Intergenic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1137980435 16:53064643-53064665 CAGAGCCTGGTGAGGAAGCCAGG + Intronic
1138184798 16:54968221-54968243 CAGATCCTGGATGAGAACCAAGG - Intergenic
1138385457 16:56633015-56633037 CAGAGCCTGGAGGAGAACACTGG - Intronic
1138386025 16:56636104-56636126 CAGAGCCTGGAGGAGAACACTGG - Intergenic
1139424494 16:66870964-66870986 GAGAACCTGCAGAAGAAGGCCGG + Intronic
1139486832 16:67262513-67262535 CAGAATCTCCAGGTGAAGCCAGG - Intronic
1139949948 16:70663885-70663907 CACAGCCTGGTGGAGAAGCTGGG - Exonic
1140024660 16:71274908-71274930 CAGAAGCTAGGAGAGAAGCCTGG + Intergenic
1140111405 16:72008599-72008621 CAGAACCTGGGGGTGGTGCCGGG + Intronic
1140820493 16:78658566-78658588 CAGAGGCTGGAGGAGAGGCACGG - Intronic
1141231778 16:82174223-82174245 CAGAAACTGGAGGAGAATCTGGG + Intergenic
1141632104 16:85293683-85293705 CAGAAACTGGAAGAAAGGCCCGG - Intergenic
1141770537 16:86087168-86087190 CAGAACATGGTGGCCAAGCCGGG - Intergenic
1142288283 16:89180427-89180449 CCGAGCGGGGAGGAGAAGCCTGG - Intronic
1142428613 16:90013874-90013896 CCAAACTTGGAGGAGGAGCCTGG + Intronic
1143020709 17:3916025-3916047 CAGAGTCTGGAGGACAGGCCCGG + Intronic
1143501847 17:7343844-7343866 CAGCACCTGGGGGACAAGGCGGG - Exonic
1143648742 17:8249364-8249386 CTGCACCTGGAGGAGGATCCAGG - Intronic
1143749805 17:9020514-9020536 CAAAAACAGGAAGAGAAGCCTGG - Intergenic
1144114232 17:12070957-12070979 CAGAACCTTCGGGAGAAGCATGG - Intronic
1144946445 17:18971841-18971863 CAGAGCCAGGAGGCGAACCCGGG - Intronic
1145057882 17:19715053-19715075 GGGAACCCGGTGGAGAAGCCTGG + Intronic
1145207807 17:20994073-20994095 GATCACCTGGAGGAGAAGCGAGG - Intergenic
1145832903 17:27931596-27931618 CAGAAACTGGGGGAGAGGCATGG + Intergenic
1146748515 17:35353891-35353913 CTGAACTTGCAGGAGAAGCCAGG - Exonic
1146757054 17:35442118-35442140 CTGAACTTGCAGGAGAAGCCAGG - Exonic
1146766065 17:35522801-35522823 CTGAATTTGCAGGAGAAGCCAGG - Intronic
1146777154 17:35630243-35630265 CAGAACCAGGAATAGAACCCAGG - Intronic
1146781167 17:35673891-35673913 CAGAAGGTAGAGCAGAAGCCAGG + Intronic
1147539573 17:41346090-41346112 CACAACCAGGAGGAGAAGAAAGG - Exonic
1147865186 17:43547100-43547122 CAGACCCTTGAGGAAAAGCCTGG - Intronic
1148191100 17:45679115-45679137 CAGCCCCTGGAGGATAAGGCAGG - Intergenic
1148214931 17:45829356-45829378 CAGGACCTAGAGCAGAAGCAGGG + Intronic
1149324439 17:55515683-55515705 CAGAAACTGGAAGACAGGCCTGG + Intergenic
1151505612 17:74525155-74525177 CAAGGCATGGAGGAGAAGCCAGG + Intronic
1151584648 17:75001755-75001777 CACAGCCTGGAAGAGAAGGCAGG + Intronic
1151957395 17:77387221-77387243 CAGAAGCTGGGAGAGAGGCCTGG - Intronic
1152119975 17:78412624-78412646 CAGAATCTGGTGGGGAAGGCTGG - Intronic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152461599 17:80444904-80444926 CAGAACCTGGAGGGTGGGCCTGG + Intergenic
1152474734 17:80510568-80510590 GTGAACTTTGAGGAGAAGCCTGG - Intergenic
1152514104 17:80812062-80812084 CAGCACCTGGAGGAGGCCCCAGG - Intronic
1152620839 17:81364081-81364103 CAGGAGCTGGGGGAGAGGCCTGG - Intergenic
1152649405 17:81484865-81484887 CAGGAGCTGGGGGAGCAGCCAGG + Intergenic
1152861917 17:82701332-82701354 CAGAAGGTGGAGGTGAGGCCGGG + Intergenic
1154203211 18:12314325-12314347 CTGAACCTCAAGGAGAAGACTGG - Intronic
1154356617 18:13626693-13626715 CATAGCCAGGAGGAGCAGCCAGG + Intronic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155272057 18:24150234-24150256 GAGAACCAAGAGGAGAAGCAAGG + Intronic
1155288220 18:24313567-24313589 CAGAACCTGGACTACAAGCCAGG - Intronic
1155819663 18:30359521-30359543 CACAACCTGGTGGAGCAGCATGG + Intergenic
1156940428 18:42760404-42760426 CAGAATCTGGAAGAGAAAACAGG - Intronic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1157957774 18:52117827-52117849 GAGACCCTGGAGGTGAGGCCAGG - Intergenic
1158212767 18:55069134-55069156 CAGAAACTGGCAGAGAAGCATGG - Intergenic
1159265382 18:66072831-66072853 CAGAAACAGAAGGAGAAGCAAGG + Intergenic
1159898827 18:74022978-74023000 CAGAAGCTGGAAGCGAGGCCTGG + Intergenic
1159977081 18:74727384-74727406 CAGAACCTGGATGAGGGACCTGG - Intronic
1160013243 18:75122590-75122612 CAGAAGCTGGGAGAGAGGCCTGG - Intergenic
1160612509 18:80099499-80099521 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1161089415 19:2352628-2352650 CAGAAGGTTCAGGAGAAGCCGGG + Intronic
1161351180 19:3792833-3792855 CTGAACCTGGAGGACAGGCCGGG + Intronic
1162504868 19:11077510-11077532 TAGAACCTGGAGTAGAATTCTGG - Intergenic
1163006254 19:14398372-14398394 AAGAACCTGGAGTTGAGGCCGGG + Intronic
1163013343 19:14439194-14439216 CTGACCCTGAAGGGGAAGCCGGG + Intronic
1163403672 19:17109668-17109690 CAGAACCCGGGAGAGAGGCCTGG - Intronic
1163486127 19:17587320-17587342 AAGAACTTGGAGGTGATGCCTGG + Intergenic
1164630680 19:29759719-29759741 CAGAACCAGGAGGAGACCTCTGG - Intergenic
1165148707 19:33748877-33748899 CAGGCCTTGGAGGAGAAGGCAGG + Intronic
1165227717 19:34366098-34366120 CAGACCCTGGATGAGGAGCCCGG - Intronic
1165363648 19:35351339-35351361 CGGAGCCTGGATGAGAAGCCAGG - Intergenic
1165426820 19:35750448-35750470 CAGAGCCTGGAGGGGACACCTGG - Intronic
1165637005 19:37349033-37349055 CAGAAGCTAGAGGAGAGGCATGG - Intronic
1165701860 19:37944328-37944350 CAGGACCTGGGGGCAAAGCCAGG - Intronic
1165866923 19:38945283-38945305 CAGAGCCTGGCGGAGGAGCCTGG + Intronic
1165866939 19:38945324-38945346 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165866955 19:38945365-38945387 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165866997 19:38945470-38945492 CAGAGCCTGGGGGAGGGGCCTGG + Intronic
1165867074 19:38945660-38945682 CAGAGCCTGGGGGAGGGGCCTGG + Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1167076651 19:47254236-47254258 CAGCACCTGTGGGAGATGCCTGG - Intergenic
1167104783 19:47423841-47423863 CAGAACGTGGAGGAGATGCCAGG + Intergenic
1167133206 19:47600867-47600889 CAGAACCTGGAGGGGACGCAGGG + Intergenic
1168118531 19:54239670-54239692 CAGGACAGGGAGGTGAAGCCTGG + Intronic
925870715 2:8267534-8267556 CAGATCCAGGATCAGAAGCCAGG - Intergenic
926076367 2:9946332-9946354 AAGAACCTGGACTAGAACCCAGG + Intergenic
926213587 2:10889822-10889844 CAGAAGCTGTAGGAGGAGCCAGG + Intergenic
926225757 2:10965861-10965883 CAGAACACGCAGGAGAATCCAGG + Intergenic
927197843 2:20560295-20560317 CAGAACCTGGGGCAGCACCCAGG + Intergenic
927283418 2:21331790-21331812 GAGAAACTGGAGCAGAAGCCAGG + Intergenic
927515088 2:23667658-23667680 CAGGGCCAGGAGGAGCAGCCGGG - Intronic
927922721 2:26985879-26985901 CAGAAGCTGGAAGAGAGGCAGGG + Intronic
928102756 2:28449090-28449112 CAGAGCCAGAAGCAGAAGCCAGG - Intergenic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
930002515 2:46870657-46870679 CACAGCCTGGAGCAGAAGGCTGG - Intergenic
930243703 2:48961983-48962005 GAGAACCTGAAGGAGGATCCAGG + Intergenic
931693030 2:64851487-64851509 CAGTCTCTGGAGGAGATGCCTGG - Intergenic
931778976 2:65563819-65563841 CAGAACCAGAAGTAGAACCCAGG - Intergenic
932164706 2:69495446-69495468 CAGAGCCTGGAAGGGAACCCAGG + Intronic
932213997 2:69954589-69954611 CAGAGACAGGAGGAGAAGACGGG - Intergenic
933514976 2:83289238-83289260 CAGAAGCTAGGTGAGAAGCCTGG + Intergenic
933766130 2:85710976-85710998 CACATCCTAGAAGAGAAGCCAGG + Intergenic
933950370 2:87323708-87323730 CAGAACCGAGAAGAGAAGCCCGG + Intergenic
934844237 2:97651962-97651984 CACAGCCTGGAAGACAAGCCTGG - Intergenic
935034726 2:99358580-99358602 CAGAAACTGAGGGGGAAGCCAGG - Intronic
935668636 2:105536288-105536310 CAGAAGCTGGGGGAGAGGTCTGG + Intergenic
936109066 2:109650351-109650373 CAAAAAGTGGAGGTGAAGCCAGG + Intergenic
936154638 2:110040071-110040093 CAGATGCAGCAGGAGAAGCCTGG - Intergenic
936190045 2:110331343-110331365 CAGATGCAGCAGGAGAAGCCTGG + Intergenic
936329408 2:111534865-111534887 CAGAACCGAGAAGAGAAGCCCGG - Intergenic
936989973 2:118352936-118352958 CAGAGCCTGCAGGAAAATCCAGG - Intergenic
937634151 2:124137084-124137106 CATAGGCTGGAGGAGAAGACAGG - Intronic
938141489 2:128798319-128798341 CAGAAGCTGGAAAAGAACCCAGG - Intergenic
938781409 2:134588185-134588207 CAGATCCTGGAGAATCAGCCAGG + Intronic
938947371 2:136225309-136225331 CAGAACCTTGAGGAGTGCCCAGG + Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939531850 2:143373262-143373284 CAGAACCAGGACTAAAAGCCAGG + Intronic
941198019 2:162474209-162474231 CAGAACCAGGATTAGAAGCCAGG + Intronic
941595826 2:167475850-167475872 CAGAAGCTGGGAGAGAGGCCTGG - Intergenic
941709630 2:168698415-168698437 CAGAAGGTGAAGGAGAAGCAAGG + Intronic
942073393 2:172335431-172335453 CAGAATCTGGGAGAGAGGCCTGG - Intergenic
943275187 2:185857767-185857789 CAGAAGCTTGGAGAGAAGCCTGG - Intergenic
943678519 2:190742557-190742579 CAGAAGCTGAAGGAAAATCCAGG + Intergenic
944445035 2:199780536-199780558 CAGAAGCAGGAAGAGAAGCATGG - Intronic
944975134 2:205041472-205041494 GAGAACCTGGAGGAGGACACAGG - Intronic
945209361 2:207366351-207366373 CAGAAGCTGGGAGAGAGGCCTGG + Intergenic
945892775 2:215447771-215447793 CAGAAGCTGGAGGAGAGGCATGG + Intergenic
946138192 2:217665455-217665477 CATATCCTGGTGGATAAGCCAGG - Intronic
946727015 2:222671369-222671391 CAGATCCTGGTGGAGATCCCAGG + Intergenic
947089404 2:226493409-226493431 CAGAGCCTGGATTAGAAGCCAGG - Intergenic
947990506 2:234484037-234484059 CAGAAGCTGGGGGAGAAGCCTGG + Intergenic
948429572 2:237911251-237911273 CTGCACCAGGAGGACAAGCCAGG - Intronic
948528472 2:238588026-238588048 CAGAAACTGGATGAGAAGCAAGG - Intergenic
1168734460 20:118364-118386 CAGACCCTGAAGAAAAAGCCTGG - Intergenic
1169091532 20:2863997-2864019 CAGAAGCTGGGGGACACGCCTGG + Exonic
1169138054 20:3209603-3209625 AAGAAGCTGGAGGAGGTGCCGGG + Exonic
1169864217 20:10182734-10182756 CTGTACCTGGAGGAAAAACCAGG - Intergenic
1170367143 20:15610382-15610404 CAGAAGCTAGAAGAGAAGCAAGG - Intronic
1170422605 20:16207549-16207571 CAGACCCAGAAGGAGAGGCCTGG + Intergenic
1170524611 20:17226202-17226224 CAGATCTTGGAGGTGCAGCCAGG + Intronic
1170930510 20:20766021-20766043 CAGAAACTAGAGGAGAAGGCGGG + Intergenic
1172310363 20:33913371-33913393 CAGGACCTGGAGCACAAGCAGGG - Intergenic
1172444555 20:34986231-34986253 CAGAACCTGGAGGGGCTGCCTGG + Intronic
1173038867 20:39441124-39441146 CAGAAAGTGAAGGAGAAGCAAGG - Intergenic
1173190237 20:40870388-40870410 CAGAAGCTGGGAGAGAGGCCTGG - Intergenic
1173561738 20:44010969-44010991 CAGGAGCCGGAGGAGAAGCGAGG - Intronic
1173812140 20:45962455-45962477 CAGAGCTTGGAGCTGAAGCCAGG + Intronic
1173845129 20:46183332-46183354 CAAAACCTGGAGCAGGACCCTGG - Intronic
1173924534 20:46771070-46771092 CAGGAACTGGAGGACAAGCCAGG - Intergenic
1174510274 20:51046067-51046089 CTGAACATGGAACAGAAGCCAGG - Intergenic
1174539063 20:51275099-51275121 CAGAACCTGGGGGTGAGGGCGGG + Intergenic
1174979399 20:55376162-55376184 GAGAAGCTGCAGGAGGAGCCAGG - Intergenic
1175084065 20:56444415-56444437 CAGGGCCTGGAGGAGAGGACAGG - Intronic
1175109878 20:56640294-56640316 CACTTCCTGGAGGAGATGCCAGG - Intergenic
1175203008 20:57290873-57290895 GAGAAGCTGTAGGAGGAGCCAGG - Intergenic
1175283514 20:57821081-57821103 CAGACCCTGGTTGAGGAGCCTGG + Intergenic
1175718012 20:61268338-61268360 CAGAACCAGGAGGCAAAGCCAGG + Intronic
1176081160 20:63273692-63273714 CAGAACCATGAGGAGACGGCTGG - Intronic
1176179513 20:63742756-63742778 CCGATCCTGGAGGACAAGGCGGG - Exonic
1176259836 20:64173776-64173798 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176259846 20:64173826-64173848 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176259856 20:64173876-64173898 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176259886 20:64174023-64174045 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176259935 20:64174267-64174289 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176259945 20:64174317-64174339 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176259955 20:64174367-64174389 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260036 20:64174767-64174789 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260046 20:64174817-64174839 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260066 20:64174917-64174939 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260076 20:64174967-64174989 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260096 20:64175067-64175089 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260129 20:64175220-64175242 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260139 20:64175270-64175292 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260158 20:64175367-64175389 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260239 20:64175767-64175789 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260249 20:64175817-64175839 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260269 20:64175917-64175939 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260278 20:64175964-64175986 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260310 20:64176117-64176139 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260365 20:64176376-64176398 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1176260375 20:64176426-64176448 AAGATGCTGCAGGAGAAGCCAGG - Intronic
1177538013 21:22454580-22454602 AAGAAGCTTGAGGATAAGCCAGG + Intergenic
1177936681 21:27356412-27356434 CAGAGCCTGGAGGTGAGGCAGGG + Intergenic
1178777855 21:35569254-35569276 CAGAAGCTGGGGGAGAGGCCTGG + Intronic
1179026655 21:37684220-37684242 CATAACCCGGGGGAGAGGCCTGG - Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179158449 21:38872503-38872525 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
1179184305 21:39072647-39072669 CAGAAGCTGGGAGAGAGGCCTGG + Intergenic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1179548671 21:42129000-42129022 CAGAAGCTGGGAGAGAGGCCTGG - Intronic
1179836148 21:44034881-44034903 CAGAAGCTGGGAGAGAAGCAAGG + Intronic
1179873898 21:44257847-44257869 CAGGAGCTGGGGGAGAGGCCTGG - Intronic
1179915628 21:44476313-44476335 CAGAACGTGAAGGGGAAGCAAGG - Intergenic
1179928292 21:44550486-44550508 AAGCACCGTGAGGAGAAGCCAGG + Exonic
1179939392 21:44628234-44628256 AAGCACCGTGAGGAGAAGCCAGG - Exonic
1179983436 21:44908119-44908141 CAGTCCCCGGAGGAGAAGCCGGG - Intronic
1180228993 21:46414934-46414956 CAGAGCCTGGAGGAGTAGTTGGG - Intronic
1180798793 22:18621688-18621710 CAGAAGCTGGGGGAGGAACCAGG - Intergenic
1180900854 22:19371001-19371023 CATACCCTGAATGAGAAGCCAGG - Intronic
1180901482 22:19376519-19376541 CAGATCATGGAGGAGAAGAATGG - Intronic
1180927695 22:19567467-19567489 CAGAACTTGAAGGATAAGACGGG + Intergenic
1181222923 22:21373574-21373596 CAGAAGCTGGGGGAGGAACCAGG + Intergenic
1181255818 22:21562046-21562068 CAGAAGCTGGGGGAGGAACCAGG - Intronic
1182283889 22:29232792-29232814 CAGGGCCTGGAGGAGGGGCCGGG - Intronic
1182297495 22:29318393-29318415 CAGAGCCTGGCTGAGAAGCCTGG + Intronic
1182536876 22:31010418-31010440 CAGAAGGTGGAGGGGAAGCAAGG - Intergenic
1182600519 22:31459831-31459853 CAGAGCCTGGAGTAGAATCCAGG - Intronic
1182670755 22:31993824-31993846 CAGAAGCTGGAGGAGAGGCCAGG - Intergenic
1183248165 22:36709929-36709951 CAGGCCCTGGGGGAGAAGCGAGG - Intergenic
1183455797 22:37922384-37922406 GAGAACCTGGTGGAGCAGGCTGG + Exonic
1184018026 22:41800519-41800541 CAGAGCCTGGAGGGGCAGGCAGG + Intergenic
1184236519 22:43186149-43186171 CAGCACCTGGAGGAGATGTCGGG + Intronic
1184296861 22:43530462-43530484 CAGAGCCTGCAGGAGAGCCCAGG + Intronic
1184421984 22:44387358-44387380 CTCACCCTGGAGGAGAATCCGGG - Intergenic
1185027706 22:48425115-48425137 CCGATCCTGGAGGAGCAGCCGGG - Intergenic
1185304731 22:50108318-50108340 CAACACATGCAGGAGAAGCCTGG - Intronic
949582725 3:5406857-5406879 CTGAAGATGGAGGAGAAGCAAGG - Intergenic
950021343 3:9789839-9789861 CAGAAACTGGAAGGGAAGGCAGG - Exonic
950491173 3:13305908-13305930 CAGAACTAGAAGCAGAAGCCTGG + Intergenic
950728468 3:14935315-14935337 CTGAACCTGTGGGAGAAGCTAGG - Intergenic
952219919 3:31314807-31314829 CAGAAGGTGGAGGAGAGGCAAGG - Intergenic
952955412 3:38554216-38554238 CAGGGGCTGGAGGAGAGGCCTGG + Intronic
953359345 3:42281139-42281161 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
953382993 3:42488210-42488232 CAGAAGCTGGATGAGAGGCATGG + Intergenic
953690871 3:45117955-45117977 CAGAAGGTTGAGGAGAGGCCGGG - Intronic
953820561 3:46204314-46204336 TTTAACCTGTAGGAGAAGCCGGG - Exonic
953883287 3:46702347-46702369 CAGAAGCTGGGGGAGAGCCCTGG + Intronic
953996143 3:47521520-47521542 CAGCACCTGGAAGAGAAGTGGGG - Intergenic
954376349 3:50195946-50195968 CAGATCCTGCTGGAGAAGGCTGG - Exonic
954788607 3:53113965-53113987 GAGAACCTAGAGCAGATGCCAGG + Intronic
955365487 3:58306579-58306601 CAGAACGTGGCCGAGAGGCCCGG + Intronic
955523762 3:59800497-59800519 CTGAACCAGGAGTAAAAGCCCGG - Intronic
956187510 3:66576636-66576658 CACACCCTGGGGGAGAGGCCAGG - Intergenic
956609289 3:71106046-71106068 CAGCACCAGGATGGGAAGCCAGG - Intronic
957266965 3:77979782-77979804 TAGAAAATGGAGGAGAAGCAAGG - Intergenic
957624181 3:82637746-82637768 TAGAACCTGGGGTTGAAGCCAGG - Intergenic
958130126 3:89408050-89408072 CAGAACCTGGAGGTAAATCAAGG - Exonic
960092904 3:113659878-113659900 CAGAACCAGGAGGTGGAGCAGGG + Exonic
961084761 3:124057370-124057392 CAGAACCAGAGGGGGAAGCCTGG + Intergenic
961542053 3:127606743-127606765 CAGAACCAGGAGGTGAAACCAGG + Exonic
961677501 3:128576653-128576675 CAGGAGGTGGAGGAGAACCCAGG + Intergenic
961737324 3:129010430-129010452 CGGAACAGGGAGGAGAGGCCTGG + Intronic
961939362 3:130621828-130621850 CAGGACCCGGAGGAGAGGCAGGG + Exonic
962121889 3:132570106-132570128 CAGAACTTGTAAGAGAAGCAGGG + Intronic
962372184 3:134829916-134829938 CAGAAGCTAGAAGAGAGGCCTGG + Intronic
962853043 3:139322237-139322259 CAGAACCTGGAAGGGGAGCATGG - Intronic
963040338 3:141065494-141065516 CAGAGCCTGGATGAGAACCCAGG - Intronic
963044048 3:141089479-141089501 TAGAGCCTGGAGGAGAAGGAGGG + Intronic
963970341 3:151422399-151422421 CAGAAGCTGGAGGAGAGGCATGG - Intronic
964210464 3:154221021-154221043 CAGAAGCTGGGGGAGAGGCCTGG + Intronic
964368431 3:155973453-155973475 CAGAAACTAGAGGAGCAGCATGG - Intergenic
964669489 3:159209462-159209484 GAGAAGCTGGAGGAGAAGCCAGG + Intronic
965152892 3:165005052-165005074 CAGAATGTGAAGGAGAAGCAAGG - Intronic
965354951 3:167662341-167662363 CAGAAGCTGTAAGTGAAGCCTGG + Intergenic
965986117 3:174755211-174755233 CAGAAGATGAAGGGGAAGCCAGG - Intronic
966333522 3:178841589-178841611 CAGAAAATGAAGGAGAAGCAAGG + Intronic
966420803 3:179732461-179732483 CAGAACCAGAAGGGAAAGCCAGG - Intronic
967040506 3:185687996-185688018 GTGAACTTGGAGGAAAAGCCAGG + Intronic
967539327 3:190647224-190647246 CACAGCCTGGGGGAGAATCCAGG - Intronic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968450846 4:675275-675297 CAGAACGTGGAGGGGGTGCCAGG - Intronic
969849932 4:9948154-9948176 GAGAAGCTGGAGGAGAACCAGGG - Intronic
970583495 4:17494047-17494069 CAGAGCCTGGACACGAAGCCAGG - Intronic
970856551 4:20655665-20655687 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
970926792 4:21461253-21461275 CAGAAGGTGAAGGAGAAGCAAGG - Intronic
971166314 4:24187481-24187503 CAGAACCAGGACCAGAACCCGGG - Intergenic
971511879 4:27436662-27436684 CATATCCTGGATGAGAGGCCAGG - Intergenic
972134199 4:35871812-35871834 CAGAAGCTGGGGGAGAGGCTTGG + Intergenic
973161959 4:47030821-47030843 CACAACCTGGAGGATAAGTGGGG + Intronic
973791845 4:54385173-54385195 CATAGCCTGGAGGAGGAGCTGGG + Intergenic
976249396 4:83034997-83035019 CAGAGCCTGTAGGAGAGACCTGG + Intronic
976422700 4:84864694-84864716 TAGAACTTGGATGAGAATCCAGG + Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
977086476 4:92605054-92605076 CAGAAGGTGGAGGGGAAGCAAGG - Intronic
978666933 4:111195182-111195204 CAGAAGGTGGAGGGGAAGCAAGG - Intergenic
979603349 4:122609743-122609765 CTGAACATGGAGGAGTGGCCAGG + Intergenic
979787364 4:124733024-124733046 CAGAAGGTGAAGGAGAAGCGAGG - Intergenic
979832198 4:125316613-125316635 CTGAGCCTGTAGGTGAAGCCGGG - Exonic
980096746 4:128499613-128499635 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
980909408 4:138980173-138980195 CATATCCTGGAGGTGCAGCCAGG + Intergenic
980998668 4:139807114-139807136 CAGAAACTGGAATAGAAGCCAGG - Intronic
982034658 4:151333884-151333906 CAGAAGCTGGAAGAGAAGCCTGG - Intergenic
983275584 4:165613457-165613479 CAGAAGCTGGGGGAGAAACCTGG - Intergenic
983651721 4:170042626-170042648 CAGAAGCTGGGAGAGAATCCTGG - Intergenic
984923157 4:184783469-184783491 CAGAACCAGGACCAGAAGCAAGG - Intronic
986038513 5:3963510-3963532 CAGAACCTGGAGGAAGAACATGG - Intergenic
986200116 5:5572024-5572046 GAGAACCAGGAGAAGAAGCATGG - Intergenic
986371879 5:7088143-7088165 CAGCACCTGGAGCAGATGGCTGG + Intergenic
986412585 5:7495190-7495212 CAGAACATGGAGGTGAGGCACGG - Intronic
986712312 5:10496937-10496959 CAGAAGTTAGAGGAGAGGCCTGG + Intergenic
988159515 5:27502078-27502100 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
988580979 5:32468588-32468610 CAGGACCTGGAGGAACAGTCTGG + Intergenic
989169059 5:38457404-38457426 CAGAACCTGGGGGACAGGCATGG - Intronic
989426295 5:41299857-41299879 CAAAAGCTGGAGGAGAAGCATGG + Intergenic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
990989203 5:61668864-61668886 CAGAATCTGGAGGAAGAGCCAGG + Intronic
991042471 5:62190237-62190259 CACAAGTTGGAGGGGAAGCCTGG + Intergenic
991246517 5:64514048-64514070 CAGAAGCTAGAGGAGAAGCATGG - Intronic
991589196 5:68231324-68231346 CAGAGGCTGCAGGAGGAGCCAGG - Intronic
995949459 5:117692462-117692484 CAGAACCAAGAGTAGAACCCAGG + Intergenic
996236207 5:121133488-121133510 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
997454866 5:134008982-134009004 CAGAACCTGGAGGCCCAGCTGGG - Intergenic
997725834 5:136119089-136119111 CTGGACCTGGAGGAAAATCCTGG - Intergenic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998534757 5:142919329-142919351 CAGAAGCTAGAGGAGAGGCATGG + Intronic
998538282 5:142954559-142954581 GAGATGCTGGATGAGAAGCCAGG - Intronic
998557870 5:143143278-143143300 CAGAACCCAGAGGCGAGGCCAGG - Intronic
999273626 5:150313711-150313733 CAGAGGCTGGGGGAGAGGCCCGG + Intronic
999823911 5:155256058-155256080 CAGAAGCTAGAAGAGAAGCATGG - Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1001299439 5:170523394-170523416 CAGAGCCTGCTGGAGAATCCTGG + Intronic
1001742605 5:174066299-174066321 CAGAGCTTGCAGGAGAGGCCTGG + Intronic
1001752476 5:174142240-174142262 CAGAACGTGGAGGAAAGGCTCGG - Intronic
1001772067 5:174304135-174304157 CAGAAGCTGGGAGAGAGGCCCGG - Intergenic
1001999788 5:176191260-176191282 CAGAGCCTGGAGGACATGCCAGG + Intergenic
1002861362 6:1082389-1082411 CAGAACCAGGAGCAGGACCCAGG + Intergenic
1003407114 6:5834610-5834632 CAGTCCCGGGAGGAGCAGCCTGG + Intergenic
1003856207 6:10278965-10278987 CAGAAGCTGGGAGAGAGGCCAGG - Intergenic
1004310083 6:14537711-14537733 TGGAACCTGGAGGAGGAGCCAGG - Intergenic
1004358792 6:14952693-14952715 CAGAGTCTGGAGGAGATGCTGGG - Intergenic
1004365793 6:15011423-15011445 CAGGAACTGGGGGAGGAGCCTGG + Intergenic
1005199355 6:23325693-23325715 CAGGAGCTGGAAGAGATGCCTGG + Intergenic
1005461079 6:26070976-26070998 CAGAAGCTGGGAGAGAAACCTGG - Intergenic
1006531259 6:34656715-34656737 AAGCACCTGGAGGAGCAGGCAGG - Intronic
1006729195 6:36223058-36223080 CAGGACCTGGGGGAGAGGCCTGG + Intronic
1007183095 6:39944905-39944927 CAGAAGATGGAGGGGAGGCCTGG - Intergenic
1007195839 6:40059543-40059565 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
1007682793 6:43645725-43645747 GCGGACCTGGAGAAGAAGCCAGG + Intronic
1007934942 6:45724679-45724701 CAAAACCTGGAGCAGAGCCCAGG - Intergenic
1009431687 6:63572801-63572823 GGCAACCTGGAGGAGACGCCGGG - Intronic
1009965642 6:70574989-70575011 CAGAAAGCGCAGGAGAAGCCAGG - Intronic
1011419006 6:87152414-87152436 CAGAGCCTGGGGGCCAAGCCAGG - Intergenic
1011430112 6:87276569-87276591 AAGATCCTGGAAGAGAAGCTTGG + Intergenic
1011625149 6:89277268-89277290 CAGAAGGTGAAGGAGAAGCAAGG - Intronic
1012543639 6:100392451-100392473 CAGATCCTGTAGGTTAAGCCAGG + Intronic
1012727000 6:102826080-102826102 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
1013215149 6:108020501-108020523 CAGATCCTGGGTGAGAAACCAGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014356719 6:120420775-120420797 CAGAACGTGAAGGTGAAGCAAGG + Intergenic
1014975099 6:127870355-127870377 CAGAGCCTGAAAGAGAAACCTGG + Intronic
1015107873 6:129557969-129557991 CTGAACCTAGAAGAGAAGCTTGG - Intergenic
1016801429 6:148173217-148173239 CAGAAGCTGGAAGAGAGGCAGGG - Intergenic
1016870069 6:148808007-148808029 CAGAAGCCGGTGGGGAAGCCAGG + Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017334888 6:153244599-153244621 CACATGCTGGAGGAGAGGCCTGG + Intergenic
1017654566 6:156615050-156615072 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1017958994 6:159205515-159205537 CTGAACCTGGAGCCGGAGCCAGG - Intronic
1018023740 6:159788643-159788665 CAGAATCTGAAGGAAAAGGCTGG - Intronic
1018372039 6:163177396-163177418 CAGAGCTGGGAGGAGAAACCTGG + Intronic
1018379364 6:163243641-163243663 CAGAACCTGGAGGAGACCACTGG - Intronic
1018435343 6:163753945-163753967 CAGAAGCCAGAGGAGAGGCCTGG - Intergenic
1018987266 6:168647348-168647370 GAGAACCTGTATGAGGAGCCTGG - Intronic
1019083996 6:169457053-169457075 CAGAACCTAGGGAAGAGGCCAGG + Intergenic
1019155978 6:170039285-170039307 TGGACCCTGGAGCAGAAGCCGGG - Intergenic
1019730805 7:2628375-2628397 CAGAAGCTGGCAGAGAAGCCTGG - Intergenic
1020988151 7:15162148-15162170 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
1021802586 7:24322234-24322256 CAGAACCTAGAGGAGAAACAGGG - Intergenic
1022469954 7:30676023-30676045 TAGAAGCTAGAGCAGAAGCCAGG + Intronic
1022482484 7:30753011-30753033 CTGAGCCTGGAGGAGCAGGCCGG + Intronic
1022667970 7:32428883-32428905 CAGAAGCAGGAAGGGAAGCCTGG + Intergenic
1022828009 7:34036488-34036510 CTGAAACTGGAGGAGAGGCGGGG - Intronic
1023088554 7:36596655-36596677 CAGAAGCTGGAAGAGAGGCATGG + Intronic
1023495917 7:40796920-40796942 CAGGTCCCTGAGGAGAAGCCAGG + Intronic
1023839384 7:44087937-44087959 CAGAGCCAGGAGGGGAGGCCGGG - Intergenic
1026115476 7:67492105-67492127 GGGCACCTAGAGGAGAAGCCGGG - Intergenic
1026736082 7:72949570-72949592 CAGAACATGCAGGTTAAGCCAGG + Exonic
1026786429 7:73304471-73304493 CAGAACATGCAGGTTAAGCCAGG + Intronic
1027107647 7:75415491-75415513 CAGAACATGCAGGTTAAGCCAGG - Intergenic
1027729265 7:81849279-81849301 CAGAAGATGAAGGAGAAGCAAGG + Intergenic
1030571893 7:111236753-111236775 CAGCACAGGGAGGAGAACCCAGG - Intronic
1030914489 7:115295764-115295786 CAGAAGGTGAAGGGGAAGCCAGG - Intergenic
1032541690 7:132708211-132708233 CAGAAACTAGAGGAGAAATCTGG + Intronic
1035034689 7:155887103-155887125 CAGTCCCTGGAGGAGACACCAGG - Intergenic
1035304726 7:157924372-157924394 CAGCCCCTGGAGGAGAACCGAGG + Intronic
1035388599 7:158490371-158490393 CAGGCCCTGGAGGAGACGCGGGG + Intronic
1036021022 8:4846423-4846445 CAAAACCTCAAGGACAAGCCTGG - Intronic
1036066719 8:5389120-5389142 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1036161131 8:6389421-6389443 GAGGAGCTGGAGGAGAGGCCTGG + Intergenic
1036205458 8:6802406-6802428 AAGAACCTGGAAGAGAACCCAGG + Intergenic
1036619013 8:10410634-10410656 CAGAACCAGGAGAAGAGCCCAGG + Intronic
1036685285 8:10905302-10905324 CAGAGCCAGGAGGAGAAGCACGG - Intronic
1039018567 8:33180574-33180596 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
1039411650 8:37360024-37360046 CAGAACCGGAATGAGAACCCGGG - Intergenic
1039850372 8:41359481-41359503 CAGACCTAGGACGAGAAGCCAGG - Intergenic
1040091142 8:43400268-43400290 CAGAAGCTGAAGGGGAAGCGAGG + Intergenic
1041516780 8:58708663-58708685 CAGAAAGTGAAGGAGAAGCAAGG + Intergenic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1041780359 8:61572361-61572383 TGGAACTTGGAGGAAAAGCCAGG - Intronic
1042377490 8:68070840-68070862 CAGGTCCTGGAGGAGAAAGCAGG + Intronic
1042551259 8:69995879-69995901 CAAAACCTTGAGTAGAAGTCAGG - Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1043610026 8:82051292-82051314 CGGAAGCTGAAGGAGAAGCAAGG + Intergenic
1043704562 8:83331917-83331939 CAGGACCAGAAGGAGAAGGCAGG - Intergenic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1046846354 8:118920872-118920894 CAGAACCCAAAGGAGCAGCCAGG + Intergenic
1047345773 8:124026979-124027001 CAGAAGCTAGAAGAGAGGCCTGG - Intronic
1047941049 8:129827515-129827537 CAGAAGGTGAAGGAGAAGCAAGG + Intergenic
1048341393 8:133541639-133541661 CAGAAACTAGAGCAGAAGACTGG - Intronic
1048582252 8:135739294-135739316 CAGAAGCTGGGAGAGACGCCTGG + Intergenic
1049019757 8:139947995-139948017 CAGAACGTGGACAAGAATCCAGG - Intronic
1049320911 8:141995786-141995808 CAGAGGCTGGAAGAGAGGCCTGG - Intergenic
1049403484 8:142441299-142441321 GAGAGCCTGGAGGGGAAGCTGGG + Intergenic
1049758549 8:144321526-144321548 TACAACCAGGAGGAGAAGCCAGG + Intronic
1049786985 8:144455767-144455789 CAGAGCCAGGAAGAGAGGCCAGG - Intronic
1051964942 9:22816375-22816397 CAGAACCTTGAGGCGATGCTAGG - Intergenic
1052843265 9:33311888-33311910 CAGAACCAGGAGTTGAACCCAGG + Intronic
1053432577 9:38052800-38052822 TAGATGATGGAGGAGAAGCCAGG - Intronic
1054760691 9:69001562-69001584 CAGAAGGTGAAGGGGAAGCCAGG + Intronic
1054865857 9:70000267-70000289 CTGATTCAGGAGGAGAAGCCAGG + Intergenic
1054870823 9:70045681-70045703 CAGAACCCTGAGTAGAAGCCTGG - Intronic
1056130814 9:83584757-83584779 CAGAATCTGGACTAGAACCCAGG - Intergenic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1057799578 9:98182075-98182097 CAGAATCTGGAGGAGGAGAGAGG - Intronic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1057922009 9:99105234-99105256 CAGCACGAGGAGGAGCAGCCGGG - Exonic
1058082767 9:100716942-100716964 CAGAAGCTAGCGGAGAGGCCTGG - Intergenic
1058644552 9:107118730-107118752 TAGTACCTGGAGGAGAAAGCAGG + Intergenic
1058745821 9:107989623-107989645 CAGAGGCTGGAGAAGAAACCAGG - Intergenic
1059755014 9:117284511-117284533 CAGAACCTAGAAGGAAAGCCTGG + Intronic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060107001 9:120878753-120878775 CTGAACCTGGAAGGAAAGCCTGG + Intronic
1060470106 9:123941457-123941479 CATAACCAGCAGGAGAAGTCAGG - Intergenic
1060759218 9:126234279-126234301 CAGAGCATGGAGGGGCAGCCAGG + Intergenic
1060966848 9:127716401-127716423 GAGAACCTGGGGCAGAAGTCAGG + Exonic
1061087262 9:128406281-128406303 GAGAAGCTGGAGGAGAGGGCTGG + Intergenic
1061543573 9:131290936-131290958 CAGACCCTGGGGAAGAAGCCTGG - Intronic
1062029842 9:134357253-134357275 CAGAGCCCGGAGCAGAAACCTGG + Intronic
1062453453 9:136625078-136625100 CAGAACCTGGGGGAAGCGCCCGG + Intergenic
1062457661 9:136647038-136647060 CAGATGCCGGAGGAGCAGCCAGG - Intergenic
1062539677 9:137036004-137036026 CAGACCCTGGCGGAGACGCTGGG - Exonic
1186865631 X:13718026-13718048 CAGAAGCTGGGAGAGAGGCCTGG + Intronic
1187245441 X:17549475-17549497 CAGAAACAGGAGGAGAGCCCTGG - Intronic
1188063311 X:25627491-25627513 CAGGAACTAGGGGAGAAGCCTGG + Intergenic
1190102097 X:47529649-47529671 CAGCAGCTGGAGGAGAGGCCTGG - Intergenic
1190289547 X:48983223-48983245 CAGATCCGGGAGGAGAAGGTGGG - Exonic
1190335663 X:49260240-49260262 CAGAAGCTGGGGGAGAGGCCTGG + Intronic
1192182119 X:68922620-68922642 CAGAACCGGGACTAGAATCCAGG - Intergenic
1192421784 X:71038958-71038980 CACACCCTGGGAGAGAAGCCGGG + Intergenic
1192634026 X:72801620-72801642 TAGAACTTGGGGGAGAAGCAAGG - Intronic
1192647684 X:72919181-72919203 TAGAACTTGGGGGAGAAGCAAGG + Intronic
1192805029 X:74501220-74501242 CAAAACCTGAATCAGAAGCCTGG - Intronic
1193076235 X:77359157-77359179 CAGAATTTGGAACAGAAGCCAGG - Intergenic
1193150207 X:78116999-78117021 CAGAACCTTGAGCTGAAGGCTGG + Intronic
1193534657 X:82699001-82699023 CAGAAGATGAAGGAGAAGCAAGG - Intergenic
1193850625 X:86532537-86532559 CAGAAGATGAAGGAGAAGCAAGG - Intronic
1194430969 X:93804486-93804508 CAGAACCTGGATTAAAACCCAGG - Intergenic
1195565318 X:106333277-106333299 CAGAAGGTGAAGGAGAAGCAAGG - Intergenic
1195964622 X:110418778-110418800 CAGCAGCTGGAGGAGCTGCCAGG - Intronic
1196177056 X:112650324-112650346 CAGCAGCTGGAGGAGAATGCGGG - Intronic
1196693175 X:118582309-118582331 CAGAACATGGATCAGAACCCAGG + Intronic
1198481284 X:137043647-137043669 CAGAACCAGGATTAGAACCCAGG - Intergenic
1198662298 X:138982739-138982761 CAGAGCCTGGATGAGAACCTTGG - Intronic
1198685685 X:139225736-139225758 CAGGAACTGCAGCAGAAGCCAGG + Intergenic
1199137548 X:144270898-144270920 CAGAAGGTGGAGGGGAAGCAAGG + Intergenic
1199226113 X:145376726-145376748 TGGAGCCTGGAGGAGAGGCCTGG + Intergenic
1199257994 X:145739052-145739074 CAGAAGGTGAAGGAGAAGGCAGG - Intergenic
1199740690 X:150733605-150733627 CAGAACCTGGAGGAAAACCCAGG - Intronic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1200149141 X:153942934-153942956 CTGAACCTGGTGGAGCAGCTCGG - Exonic
1200814610 Y:7518463-7518485 CAGAATGTGCAGGAGAAGCATGG + Intergenic
1200957913 Y:8970261-8970283 CAGTAGGTGGAGGAGAAACCTGG - Intergenic
1201147581 Y:11073254-11073276 CAGAACCTGGCGGGGAGGTCTGG + Intergenic
1201304791 Y:12541382-12541404 CAGGGCTTGGAGGAGAGGCCTGG + Intergenic