ID: 1165871392

View in Genome Browser
Species Human (GRCh38)
Location 19:38975752-38975774
Sequence GATCTCAGAGTCGCCGCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165871392_1165871413 29 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871413 19:38975804-38975826 CTCCGGCTGCGGGGCCCAGCGGG 0: 1
1: 1
2: 5
3: 22
4: 242
1165871392_1165871398 -10 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871398 19:38975765-38975787 CTCTGAGATCCAGCGGGCGGGGG 0: 1
1: 0
2: 1
3: 8
4: 125
1165871392_1165871403 12 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871403 19:38975787-38975809 GCGGGAGGCCGCCCCTCCTCCGG 0: 1
1: 0
2: 0
3: 21
4: 180
1165871392_1165871401 -3 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871401 19:38975772-38975794 ATCCAGCGGGCGGGGGCGGGAGG 0: 1
1: 0
2: 1
3: 45
4: 375
1165871392_1165871405 19 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871405 19:38975794-38975816 GCCGCCCCTCCTCCGGCTGCGGG 0: 1
1: 0
2: 7
3: 48
4: 370
1165871392_1165871407 20 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871407 19:38975795-38975817 CCGCCCCTCCTCCGGCTGCGGGG 0: 1
1: 0
2: 3
3: 22
4: 250
1165871392_1165871399 -7 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871399 19:38975768-38975790 TGAGATCCAGCGGGCGGGGGCGG 0: 1
1: 0
2: 3
3: 14
4: 199
1165871392_1165871400 -6 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871400 19:38975769-38975791 GAGATCCAGCGGGCGGGGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 261
1165871392_1165871412 28 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871412 19:38975803-38975825 CCTCCGGCTGCGGGGCCCAGCGG 0: 1
1: 0
2: 1
3: 35
4: 247
1165871392_1165871404 18 Left 1165871392 19:38975752-38975774 CCGGGGGCGGCGACTCTGAGATC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1165871404 19:38975793-38975815 GGCCGCCCCTCCTCCGGCTGCGG 0: 1
1: 0
2: 7
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165871392 Original CRISPR GATCTCAGAGTCGCCGCCCC CGG (reversed) Exonic
902640217 1:17762244-17762266 GACCTCAGAGTCTCAGGCCCCGG - Intronic
911498917 1:98662006-98662028 CAGCTCAGAGCCACCGCCCCGGG - Intronic
916773637 1:167937021-167937043 GACCTCAGCGCCTCCGCCCCGGG - Intronic
919735530 1:200947996-200948018 GAGCCTAGAGTCGCCTCCCCTGG + Intergenic
919815423 1:201435118-201435140 GGTCTCAGTGTAGCAGCCCCGGG - Intergenic
920722430 1:208400135-208400157 GAGCTCAGAGTCTACCCCCCTGG + Intergenic
920959419 1:210651479-210651501 GATCTCAGAGAAGAGGCCCCTGG + Intronic
1062840083 10:663425-663447 GATCTCAGAATCTCCTTCCCTGG + Intronic
1063028373 10:2206083-2206105 AATCTCAGAGACGTCGCCCAAGG - Intergenic
1075644431 10:124088219-124088241 AATCTCAAAGTCGCTACCCCGGG + Intronic
1077976331 11:7252102-7252124 CAGCTCAGAGCCGCCGCCTCCGG - Exonic
1081838241 11:46175479-46175501 GATCTCAGATTTCCAGCCCCCGG + Intergenic
1092104605 12:5912598-5912620 GATCTCAGAGGGGACGCCTCCGG - Intronic
1113594931 13:111524465-111524487 GATCTCAGATTCTCAGCCTCCGG + Intergenic
1115398553 14:32934806-32934828 GAGCCCAGAGCCGCCGCGCCCGG + Intergenic
1115591878 14:34873746-34873768 GAACTCAGCGTCTCCGCCCCCGG - Intronic
1121853600 14:97246382-97246404 GAACACAGAGTTGCCGCCCTTGG + Intergenic
1122453590 14:101832539-101832561 GAACCCAGAGTCGCCCACCCTGG - Intronic
1122806590 14:104263011-104263033 GAGCTCAGAGTCCCAGCCCAGGG - Intergenic
1127732419 15:61812986-61813008 GATCTCAGACTTGCAGCCTCTGG + Intergenic
1127997111 15:64159672-64159694 GATCACAGAGTCACCACGCCTGG + Intronic
1128090137 15:64913599-64913621 GATCTCAGAGTTGCTACCCTGGG - Intronic
1132404045 15:101531474-101531496 GATCTCAGGGTAGCCCCCCAAGG - Intergenic
1132620957 16:868137-868159 CTTGTCAGAGTGGCCGCCCCAGG + Intronic
1132661139 16:1062062-1062084 GATCTCAGGCTTGCGGCCCCAGG + Intergenic
1134249287 16:12563150-12563172 GAGCCCAGAGTTGCCCCCCCTGG - Intronic
1136637879 16:31537425-31537447 GAACTGAGAGGCGCCGGCCCTGG - Intergenic
1138314772 16:56060530-56060552 GATCTCAGACTCCCAGTCCCAGG + Intergenic
1139480318 16:67226977-67226999 GATGGCGGAGTCGCTGCCCCTGG - Intronic
1140122346 16:72094259-72094281 GATCTCAGCGAGGCCGCTCCAGG - Intronic
1142913702 17:3116450-3116472 GATCTCAGAGTTCCTGCTCCTGG + Intergenic
1144145812 17:12396905-12396927 GATCTCAGGGTCCCAACCCCAGG - Intergenic
1149850681 17:60031895-60031917 GAGCTCAGAGTCGCTGGCACAGG + Intergenic
1149859485 17:60114629-60114651 GAGCTCAGAGTCGCTGGCACAGG - Intergenic
1151122004 17:71802945-71802967 AATCTCAGAGTGGCCCTCCCAGG - Intergenic
1153489140 18:5630044-5630066 GTTCGCAGAGGCGCCGCGCCCGG + Intronic
1154450854 18:14474248-14474270 AACCTCTGACTCGCCGCCCCCGG + Intergenic
1156464583 18:37340643-37340665 GATCTCAGGCTGGCCGCCCCTGG - Intronic
1160428840 18:78797395-78797417 GATCTCAGAGTCACTGTGCCCGG - Intergenic
1161282681 19:3454241-3454263 GATCTCACAGTGGCGGCCCGAGG + Intronic
1161384740 19:3985018-3985040 GATCTCAAACTCGCGGCCCGCGG + Intronic
1161484765 19:4529321-4529343 GATCTTTGAGTCCCAGCCCCAGG - Exonic
1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG + Intergenic
1165871392 19:38975752-38975774 GATCTCAGAGTCGCCGCCCCCGG - Exonic
1167613227 19:50517363-50517385 GATCCCAGAGACTCCGCTCCTGG + Exonic
928096251 2:28406897-28406919 CTCCTCAGAGTCGCCGCCACAGG - Intronic
935866935 2:107398371-107398393 GATCACAGAATCCCCTCCCCAGG - Intergenic
936695507 2:114942595-114942617 GATCTTAGAGTAGCTGCACCAGG - Intronic
941164957 2:162074353-162074375 GGTCCCCGAGTCGCCGGCCCAGG - Exonic
943060472 2:183037865-183037887 AATCTCGGCGTCGCCGCCCGAGG - Intronic
943645931 2:190408197-190408219 GGCCTCACAGTCGCCGCCGCCGG - Intergenic
944357720 2:198811849-198811871 GCTCTCAGAGTCCCAGCCCCTGG + Intergenic
1168854946 20:1001999-1002021 GCCCCCAGAGCCGCCGCCCCCGG + Intronic
1171896422 20:30813916-30813938 GATCCCAGCCTCGCGGCCCCGGG - Intergenic
1172813491 20:37668539-37668561 GATCTCGGAGACCCAGCCCCCGG - Intergenic
1174246696 20:49187722-49187744 CCTCTCAGTGTCGCCGGCCCAGG - Intronic
1175198794 20:57264611-57264633 GATCTCAGAGCTGACGCCGCGGG - Intronic
1177894764 21:26845494-26845516 CATCCCAAAGACGCCGCCCCCGG + Intergenic
1184176233 22:42790855-42790877 GAACTCAGAGTCCCTGTCCCTGG + Intergenic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1185051154 22:48554987-48555009 GATCTCAGAGCCCCAGCCTCAGG - Intronic
953033425 3:39192224-39192246 GCTCTCAGAGTGGCTGCCACAGG - Intronic
953094729 3:39764248-39764270 GATCTCAGAGCCACAGCCACAGG + Intergenic
957085439 3:75672454-75672476 GATCCCAGCCTCGCGGCCCCGGG - Intergenic
961825480 3:129596954-129596976 GAGCTCAGAGGCCCAGCCCCAGG + Intronic
969844042 4:9905492-9905514 GAACTCAGAGTCTCAGCCTCTGG - Intronic
970595259 4:17594501-17594523 GAACTTAGAGTCGAAGCCCCTGG + Intronic
985445515 4:190019243-190019265 GATCCCAGCCTCGCGGCCCCGGG + Intergenic
985478547 5:92728-92750 GATTTCAGACTCCCCTCCCCTGG - Intergenic
987132480 5:14872046-14872068 GCCCTCAGCGCCGCCGCCCCCGG - Intergenic
992193235 5:74314755-74314777 TATCTCAGAGCCCCCTCCCCAGG + Intergenic
996833772 5:127768520-127768542 GATCTCAGAATTGCAGCCTCTGG + Intergenic
997994611 5:138575586-138575608 GAGCTCAGAGCCGCCGCAGCCGG - Intergenic
998379956 5:141717305-141717327 GATCACATAGGCTCCGCCCCTGG - Intergenic
999153811 5:149443898-149443920 GATTTCAGAGCCCCTGCCCCAGG + Intergenic
1002626582 5:180533871-180533893 GATTTCAGAGTCCAGGCCCCAGG - Intronic
1019179215 6:170176453-170176475 GCTCCCAGAGTCTCCGTCCCTGG - Intergenic
1025072383 7:55911780-55911802 ATTCTGAGAGTGGCCGCCCCTGG + Intronic
1035546551 8:486266-486288 GATCTCAGAGACCCTGGCCCAGG + Intergenic
1036251287 8:7165086-7165108 GATTTCAGAGTTGTCTCCCCAGG + Intergenic
1036366201 8:8122374-8122396 GATTTCAGAGTTGACTCCCCAGG - Intergenic
1037326065 8:17692343-17692365 GATCTCACAGTAGCTGCTCCAGG - Intronic
1040484296 8:47855567-47855589 AATCTCAGAGTTGCCGTCCAGGG + Intronic
1053019427 9:34684761-34684783 GATCTCAGAATCCCAGTCCCTGG - Intergenic
1053749054 9:41235230-41235252 GATCCCAGCCTCGCGGCCCCCGG - Intergenic
1054254490 9:62800083-62800105 GATCCCAGCCTCGCGGCCCCCGG - Intergenic
1055898988 9:81212950-81212972 GATCTCAGAGTCGCAGGCACAGG - Intergenic
1056467988 9:86877758-86877780 GAGCTCACAGTTGCAGCCCCAGG + Intergenic
1057554363 9:96075836-96075858 GGTCTCAGAGTAGCTGCCCCTGG - Intergenic
1062168264 9:135119763-135119785 GATGTCCGAGTGGCCACCCCAGG - Exonic
1190736299 X:53257460-53257482 GATGTCAGGGCCACCGCCCCAGG - Intronic
1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG + Intergenic
1198087169 X:133292688-133292710 CATCTCAGAGTCCCCGCATCAGG + Intergenic