ID: 1165871479

View in Genome Browser
Species Human (GRCh38)
Location 19:38975991-38976013
Sequence AGACGCCCCCGCGGGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165871469_1165871479 6 Left 1165871469 19:38975962-38975984 CCTCTGGGTGTGCGAGTTCCACA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871463_1165871479 23 Left 1165871463 19:38975945-38975967 CCCTGGGAGAGCCACCTCCTCTG 0: 1
1: 0
2: 3
3: 40
4: 346
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871464_1165871479 22 Left 1165871464 19:38975946-38975968 CCTGGGAGAGCCACCTCCTCTGG 0: 1
1: 0
2: 4
3: 37
4: 303
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871468_1165871479 9 Left 1165871468 19:38975959-38975981 CCTCCTCTGGGTGTGCGAGTTCC 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871467_1165871479 12 Left 1165871467 19:38975956-38975978 CCACCTCCTCTGGGTGTGCGAGT 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871462_1165871479 24 Left 1165871462 19:38975944-38975966 CCCCTGGGAGAGCCACCTCCTCT 0: 1
1: 0
2: 0
3: 37
4: 287
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871461_1165871479 27 Left 1165871461 19:38975941-38975963 CCACCCCTGGGAGAGCCACCTCC 0: 1
1: 0
2: 3
3: 44
4: 486
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1165871460_1165871479 28 Left 1165871460 19:38975940-38975962 CCCACCCCTGGGAGAGCCACCTC 0: 1
1: 0
2: 4
3: 20
4: 317
Right 1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165871479 Original CRISPR AGACGCCCCCGCGGGGGGAC TGG Intergenic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
904461831 1:30685298-30685320 AGATGCCACCGCGCGGCGACCGG + Intergenic
915458346 1:156054714-156054736 AGAGCCCCCCGCGGTGGGGCGGG + Intergenic
924199052 1:241640500-241640522 GGACGCGCCCGCGGGGGGGCGGG - Intronic
1073301473 10:102473616-102473638 AGACGCCCCAGCGCCGGCACAGG - Exonic
1077109359 11:855272-855294 GGAGGCCCACGCAGGGGGACGGG + Intronic
1080801928 11:35618114-35618136 AGACACCCCCGCGAGGGCCCAGG + Intergenic
1082792818 11:57359125-57359147 TGCCGCCCCCGCGGGAGGAATGG + Intronic
1084000133 11:66291722-66291744 AGAAGCCCCCGCTGGGCGGCTGG - Intergenic
1094779413 12:33773408-33773430 AGACGCCACCTCGGGGGGCAGGG + Intergenic
1098425943 12:70366171-70366193 AGACGCCCCCGGGCGGGGCGGGG + Intergenic
1103705106 12:122867226-122867248 GGAGGCCCACGCGGGGGGGCAGG + Exonic
1104761209 12:131298610-131298632 AGAGGCCCCCGCGGCTGGAGAGG - Intergenic
1104796257 12:131521513-131521535 AGACACCACCCAGGGGGGACGGG + Intergenic
1104818566 12:131662182-131662204 AGAGGCCCCCGCGGCTGGAGAGG + Intergenic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1107549014 13:41457881-41457903 AGCCGCCCGCGCGGGAAGACCGG - Intronic
1108844484 13:54660544-54660566 AGACGCCCCTGCAGTGGGAGAGG - Intergenic
1113770105 13:112902816-112902838 AGACGCCCAGGCAGGGGCACTGG - Intronic
1115592108 14:34874607-34874629 AGGCGAGCCCGCGGGCGGACGGG - Exonic
1121121694 14:91379762-91379784 AGACACCCCCGCAGGAGGCCCGG - Intronic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122768733 14:104087603-104087625 AGCTGCCCCCGAGTGGGGACAGG + Intronic
1122957090 14:105075937-105075959 CGACGCCCCCACGGGAGGGCTGG + Intergenic
1127867210 15:63042585-63042607 AGCGGCCCCCGCGGGAGGAGCGG + Intergenic
1130352875 15:83107347-83107369 CGACACCCCCGCGCAGGGACAGG - Intergenic
1130979447 15:88803023-88803045 TGAGGCCGCCGCGGCGGGACAGG - Intergenic
1132995572 16:2820756-2820778 AGAAGGCCCCGGGGAGGGACAGG - Intronic
1136299679 16:29325452-29325474 AGACTCCATCTCGGGGGGACTGG - Intergenic
1138026205 16:53524178-53524200 AGAAGCCCCCGAGGAGGGGCCGG - Intergenic
1138614962 16:58157985-58158007 AGACTCCACAGTGGGGGGACGGG - Exonic
1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG + Intronic
1147211446 17:38874694-38874716 AGAGCCCCCTGCAGGGGGACAGG + Intronic
1157867479 18:51198262-51198284 AACCGCCCCCGCGAGGGGATAGG - Intronic
1160768799 19:821405-821427 AGACCCCCGCGCTGGGGGACCGG - Intronic
1160780113 19:873766-873788 AGCGGCCCCCGGGGGGGGGCAGG - Intronic
1161397928 19:4054531-4054553 AGCGGCCCCCGACGGGGGACGGG - Exonic
1162395558 19:10416602-10416624 GGAAGCCCCCGCGGGAGGAAGGG + Intronic
1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG + Intergenic
1166258195 19:41620490-41620512 AGAGGCCCCCAGGGGGTGACTGG + Intronic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167371564 19:49085685-49085707 AGAAGCCCCAGCGGTGGGCCCGG + Intronic
1167422088 19:49409854-49409876 TGAAGCCCCAGCTGGGGGACAGG + Exonic
1167503987 19:49861928-49861950 AGAAGACCCCGAGCGGGGACGGG + Intronic
1168468987 19:56625704-56625726 AGAGGCCCCTGCGGTGGGAGTGG - Exonic
926784738 2:16508333-16508355 AGACGCCGCAGCGGCGGGGCAGG - Intergenic
932760520 2:74436462-74436484 AGACTCCATCGCGGCGGGACCGG + Intronic
939958499 2:148546304-148546326 AGACACCCCAGCAAGGGGACTGG - Intergenic
948208928 2:236178300-236178322 AGACCCCCACCCGGGAGGACTGG - Intergenic
1168847136 20:953048-953070 AAGCCCCCACGCGGGGGGACGGG - Intergenic
1173813735 20:45971847-45971869 AGCCGCCTCCGCAGGGGAACCGG - Intronic
1174487668 20:50871371-50871393 AGACGCCCTGGCGGGTGGACAGG - Intronic
1176016769 20:62937990-62938012 AAGCGCCCCCGCGAGGGGGCGGG - Intergenic
1185291455 22:50029820-50029842 AGACCCCCACGCGGGAGGAACGG + Intronic
950940443 3:16885285-16885307 AGACGACCGCGCTGGGGGTCGGG - Intronic
952764771 3:36944697-36944719 AGGCGGCCGCGCGCGGGGACTGG - Intronic
953930045 3:47001321-47001343 AGAGGCCCCCGTGGGGGTCCTGG + Exonic
969724257 4:8910129-8910151 AGATGCCCACGCGAGGGGAGCGG + Intergenic
978063290 4:104364842-104364864 AGAGGCCTCCACGGGGAGACAGG - Intergenic
978782911 4:112575834-112575856 AGACTCCCCCTCTGGGGGGCAGG + Intronic
981067227 4:140498080-140498102 CGAAGCCCCCGCGGCGGGAAAGG + Intronic
985660932 5:1156142-1156164 AGACGCCCCAGCCGGGCGACCGG + Intergenic
986200301 5:5573206-5573228 ACAGGCCCCCGCGGGGGCACTGG - Intergenic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
991086928 5:62656161-62656183 AGACTCCACCTCTGGGGGACAGG + Intergenic
995342260 5:111073039-111073061 GGACGCCGCCGCCGGGGGAAAGG + Intronic
1001845241 5:174916389-174916411 AGCCGCCCCTGCTGGGGGATGGG - Intergenic
1006642921 6:35497679-35497701 AGACGCCCCCCGTGGGGGCCCGG - Intergenic
1011751872 6:90461943-90461965 AGAGGCCACGGCTGGGGGACGGG - Intergenic
1017324584 6:153130973-153130995 AGCCGCCCCCGCCGGGGCATGGG + Intronic
1017672491 6:156779559-156779581 CGCCGCCCCCGCGGGAAGACGGG - Intronic
1017721522 6:157246436-157246458 AGAGGCCCCCATTGGGGGACAGG - Intergenic
1020273019 7:6608040-6608062 ACACGCCCCCGCTGGGCTACGGG + Exonic
1021963487 7:25895083-25895105 AGATGCCCCGGCAGGAGGACGGG + Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044794016 8:95878084-95878106 AGAGGCCCCCGAGGAGGGAGAGG + Intergenic
1045313354 8:101022763-101022785 AGAGGCCCCCGTGATGGGACTGG + Intergenic
1049409187 8:142464879-142464901 AGACATCCCCGCGGGGGGCCAGG - Exonic
1052999780 9:34571590-34571612 TCAGGCCCCCGCGGGGGGAGGGG + Intronic
1057498894 9:95581456-95581478 AGACGCCCCATGGAGGGGACTGG - Intergenic
1061972690 9:134053438-134053460 AGTCGCCCCCGCGGGGATCCCGG - Exonic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1192141106 X:68647735-68647757 AGCCGGCCCCGCGAGGGGAGAGG - Intronic