ID: 1165874378

View in Genome Browser
Species Human (GRCh38)
Location 19:38995518-38995540
Sequence TGTCAGAATAGACCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165874375_1165874378 17 Left 1165874375 19:38995478-38995500 CCTGTTTTTGGCTTCTGGCCAGA 0: 1
1: 8
2: 10
3: 25
4: 195
Right 1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1165874377_1165874378 -1 Left 1165874377 19:38995496-38995518 CCAGAGGCTACACTTCTGAGCTT 0: 1
1: 0
2: 6
3: 45
4: 219
Right 1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1165874373_1165874378 28 Left 1165874373 19:38995467-38995489 CCTTCAAAGTGCCTGTTTTTGGC 0: 1
1: 3
2: 27
3: 92
4: 324
Right 1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165874378 Original CRISPR TGTCAGAATAGACCACCTGC AGG Intronic
901296811 1:8167202-8167224 CGTCAGGATGGACCGCCTGCTGG - Intergenic
902298814 1:15486870-15486892 TGCCCACATAGACCACCTGCGGG + Intronic
906876072 1:49541158-49541180 TGTGAGAAAAGACCGCGTGCTGG + Intronic
908391852 1:63690491-63690513 TCTCACAATAGACCATCTGCAGG + Intergenic
908866015 1:68549093-68549115 TGTCAGAATAGACCAAATAGAGG + Intergenic
909277651 1:73708769-73708791 TGTCAGAATGGCCATCCTGCAGG + Intergenic
910515416 1:88054638-88054660 TGACAGAATTCATCACCTGCTGG - Intergenic
911980743 1:104562120-104562142 TCTCACAATAGACCGTCTGCAGG - Intergenic
913147106 1:116003056-116003078 TGCCAGAATTTACCACCTGCTGG - Intronic
916441797 1:164833774-164833796 AGTCAGAATAGACCGGTTGCTGG - Intronic
916985800 1:170190584-170190606 TAGCAGAATAGACCAAGTGCAGG - Intergenic
918804311 1:189019357-189019379 TCTCACAATAGGCCATCTGCAGG - Intergenic
919823727 1:201489277-201489299 TCTGATAATAGACCAGCTGCAGG - Intronic
920493806 1:206439782-206439804 TGTTAGAAGAGGGCACCTGCTGG - Intronic
920970603 1:210740526-210740548 TGCCAGAAGAGACCAGCTTCTGG - Intronic
922074917 1:222234007-222234029 TGTCAGAATGGCCACCCTGCAGG + Intergenic
923536978 1:234860233-234860255 TGTCAGAATGGCCACCCTGCAGG + Intergenic
924510763 1:244727646-244727668 TGGCAGAAGGAACCACCTGCAGG + Intergenic
924693783 1:246378577-246378599 TCTCACAATAGGCCATCTGCAGG - Intronic
1063876775 10:10487087-10487109 TTTCAGAATAGACATCTTGCTGG + Intergenic
1064092565 10:12397262-12397284 TGAAAGAACAGAACACCTGCAGG - Intronic
1064402390 10:15032312-15032334 TCTCACAATAGGCCATCTGCAGG - Intronic
1064932216 10:20640550-20640572 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1065703067 10:28444273-28444295 TGTCAGGATAGGCCACCCACTGG - Intergenic
1066957964 10:42190720-42190742 TCTCACAATAGGCCATCTGCTGG - Intergenic
1069588802 10:69629717-69629739 TGGCAGAAGGAACCACCTGCAGG - Intergenic
1070576803 10:77685612-77685634 TGTCAGAATACAGCAACAGCTGG - Intergenic
1071188545 10:83073875-83073897 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1071999806 10:91184330-91184352 TATCAGAATAGACCACGTAGAGG - Intronic
1076684767 10:132193369-132193391 TGTCAGGATAGAGCCCGTGCCGG - Intronic
1077943252 11:6867149-6867171 GGCCAGAAAAGACCACCTGGGGG - Intergenic
1078473241 11:11608926-11608948 TGTCAGAATAGACTTCATGGAGG - Intronic
1078772710 11:14365656-14365678 TCCCACAATAGGCCACCTGCAGG + Intergenic
1080051680 11:27864795-27864817 TGTGAGAACTGACCACCTGGGGG + Intergenic
1080962090 11:37172592-37172614 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1081178999 11:39965033-39965055 TGACTGAATGGACCACCTGTTGG + Intergenic
1081965035 11:47164328-47164350 TGTCAAAATAAAGCCCCTGCAGG - Exonic
1083733681 11:64667673-64667695 TGTTCTTATAGACCACCTGCAGG + Exonic
1086576706 11:88346984-88347006 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1086925535 11:92636256-92636278 TTTAAGAATAGAAGACCTGCAGG - Intronic
1087345697 11:96968391-96968413 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1089112646 11:116068930-116068952 TGTCAGAAAAGGCCAACTGCTGG + Intergenic
1089782052 11:120880368-120880390 TGACAGAATAGCTCTCCTGCAGG - Intronic
1091052085 11:132381409-132381431 TCCCACAATAGACCATCTGCAGG - Intergenic
1092726067 12:11486737-11486759 TGTCAGACAGCACCACCTGCTGG + Intronic
1092934718 12:13350078-13350100 TTTCAGAATCCACCACCTGGTGG - Intergenic
1093991631 12:25594916-25594938 TATAAGAATAGTACACCTGCTGG - Intronic
1097753815 12:63387134-63387156 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1103029879 12:117604301-117604323 TGTCAGAATGGCCACCCTGCCGG + Intronic
1103636113 12:122306902-122306924 TCTCAGAATAGAACAGCAGCTGG + Intronic
1106555981 13:30808949-30808971 AGTCAGAATAGGCCAATTGCTGG - Intergenic
1109292730 13:60496237-60496259 TCCCACAATAGACCATCTGCAGG - Intronic
1110943535 13:81383914-81383936 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1112249605 13:97767659-97767681 TCCCACAATAGGCCACCTGCAGG + Intergenic
1112616061 13:101006785-101006807 TCCCACAATAGGCCACCTGCAGG + Intergenic
1114129645 14:19775395-19775417 TGTCATAATAGCCACCCTGCAGG + Intronic
1114957368 14:27840362-27840384 TATCAGAACACAACACCTGCAGG + Intergenic
1116959502 14:50955534-50955556 TGTCAGATCACACCCCCTGCTGG + Intergenic
1117008963 14:51450996-51451018 TGTCACAGAAGACCTCCTGCAGG + Intergenic
1117874436 14:60237539-60237561 TCTCACAATAGGCCATCTGCAGG - Intergenic
1119575763 14:75720371-75720393 TGTCATAAGAGGCCACCTGAGGG + Intronic
1202935149 14_KI270725v1_random:81057-81079 TCTCACAATAGGCCATCTGCTGG + Intergenic
1123987087 15:25655493-25655515 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1124459284 15:29874248-29874270 TGACAGAAGAGAACGCCTGCAGG + Intronic
1125347862 15:38737456-38737478 TGACAAAATAGACAACCTTCCGG + Intergenic
1128128857 15:65212139-65212161 TCTCAGAAGAGTCCACATGCTGG - Intergenic
1129578799 15:76783345-76783367 TCTCTGAATAGACCAACAGCAGG + Intronic
1131618564 15:94042678-94042700 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1134109339 16:11504987-11505009 TGTCAGCTTAGACCAGTTGCTGG - Intronic
1136186891 16:28593553-28593575 GGGCAACATAGACCACCTGCAGG + Exonic
1136189475 16:28607062-28607084 GGGCAACATAGACCACCTGCAGG + Exonic
1136317555 16:29463338-29463360 GGGCAACATAGACCACCTGCAGG - Exonic
1136432130 16:30202683-30202705 GGGCAACATAGACCACCTGCAGG - Exonic
1141702508 16:85648967-85648989 TGTCAGAAGAAACCACCCGCTGG + Intronic
1146410805 17:32582564-32582586 TGCCAGAATAGACCATATTCTGG - Intronic
1152824675 17:82457263-82457285 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1155696246 18:28690505-28690527 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1155980268 18:32172284-32172306 TGTAAGAATCTACCACATGCTGG - Intronic
1156027679 18:32674276-32674298 TGTCAACATAGATCACATGCAGG + Exonic
1157584609 18:48793116-48793138 TGTCACAACAGGCCAACTGCAGG + Intronic
1157800497 18:50616546-50616568 TCCCAGAATAGACCATCTGCAGG + Intronic
1157874798 18:51262263-51262285 TATTAGAATAGCCCAACTGCAGG + Intergenic
1159302862 18:66598135-66598157 TGTCAGAATATAACAGATGCTGG + Intronic
1161623885 19:5314433-5314455 TGTTAGAATGGACCACCTTCAGG - Intronic
1163080986 19:14942040-14942062 TGTCAGAACAGGCCAGCTTCAGG - Exonic
1164655143 19:29915587-29915609 TGGCTGAATGGACCACCTCCTGG - Intergenic
1165175640 19:33927802-33927824 GGTGAGAATAAACCACCAGCAGG - Intergenic
1165874378 19:38995518-38995540 TGTCAGAATAGACCACCTGCAGG + Intronic
1167592836 19:50413735-50413757 TGTCACCATACACCACCTGCGGG - Exonic
926987192 2:18638027-18638049 TAGCAGAATAGACCAACTGGAGG - Intergenic
927070771 2:19527028-19527050 TGTCGGCAGAGACCATCTGCTGG + Intergenic
927224901 2:20754629-20754651 TCTCAGAGTAGGTCACCTGCAGG - Intronic
927515655 2:23670304-23670326 TGTCAGTACAGCCCACCTGTTGG + Intronic
931463324 2:62466675-62466697 AGGCAGAATAGACCAACTGGAGG + Intergenic
933221496 2:79695355-79695377 TGTCAGGATAGCCAGCCTGCAGG - Intronic
934465555 2:94260085-94260107 TCTCACAATAGGCCATCTGCTGG + Intergenic
934479917 2:94627493-94627515 TATCAGAACACAACACCTGCAGG - Intergenic
936496444 2:113026055-113026077 TCTCAGAATTGTCCACCTGTGGG + Intronic
938687035 2:133748660-133748682 TGCCAGAAGAGAACACCTGCAGG + Intergenic
941279138 2:163528343-163528365 TACCACAATAGACCACATGCTGG + Intergenic
941404415 2:165070918-165070940 TGTCAGAATAGCCACCCTGCAGG - Intergenic
941728638 2:168891000-168891022 TGCCAGAGTAGACAAGCTGCAGG + Intronic
942643182 2:178082466-178082488 TGTCAGAATGGCCACCCTGCAGG - Intronic
945715004 2:213347064-213347086 TCTCTGAATAGACCAATTGCAGG - Intronic
946977443 2:225168982-225169004 TCTCATAATAGGCCATCTGCAGG - Intergenic
947079491 2:226380362-226380384 TGTCAGAATAGTAGTCCTGCTGG - Intergenic
947186128 2:227457068-227457090 AGTGAGCATAGAGCACCTGCTGG - Intergenic
947359544 2:229333569-229333591 TGTCAGAATAAAGAACCAGCAGG - Intergenic
1168857041 20:1015825-1015847 TGTGACATTTGACCACCTGCTGG + Intergenic
1169406953 20:5329697-5329719 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1170445167 20:16418914-16418936 TGTCAGAATGGCCACCCTGCAGG + Intronic
1170982949 20:21231893-21231915 TGTCTGAAAAGACCTCCTCCTGG + Intronic
1171014814 20:21530691-21530713 TGATAGGAAAGACCACCTGCAGG + Intergenic
1171196596 20:23204782-23204804 TGTCCTTCTAGACCACCTGCGGG + Intergenic
1172166444 20:32902666-32902688 TGGCACAATTGACCACTTGCTGG + Intronic
1175611633 20:60356531-60356553 TCTCACAATAGGCCATCTGCAGG + Intergenic
1176045730 20:63091751-63091773 TGCCAGAATTGACAACCTGCAGG - Intergenic
1176231045 20:64033093-64033115 TGTCAGAACAGGCAGCCTGCTGG + Exonic
1176596568 21:8703293-8703315 TCTCACAATAGGCCATCTGCTGG + Intergenic
1177557967 21:22716009-22716031 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1179043720 21:37827392-37827414 TGTCAGAATAAACGTACTGCAGG + Intronic
1179173143 21:38988612-38988634 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1180279485 22:10680735-10680757 TCTCACAATAGGCCATCTGCTGG + Intergenic
1180586698 22:16899264-16899286 TCTCACAATAGGCCATCTGCTGG + Intergenic
1181163129 22:20969171-20969193 TGGCAGAAGATGCCACCTGCAGG + Intronic
1181766934 22:25098905-25098927 TGTGAGAACAGACCTCCAGCTGG + Intronic
951356324 3:21671244-21671266 TGTCAGAATGGCCAGCCTGCAGG + Intronic
951392989 3:22130023-22130045 TGGCAGAATTTACAACCTGCTGG - Intronic
952955672 3:38555847-38555869 TGCCAGGATTGACCACCTCCTGG + Intronic
953010673 3:39022405-39022427 TGTCAGAATGGCCATCCTGCAGG + Intergenic
953308571 3:41854066-41854088 TGTCAAGATAGCCAACCTGCAGG + Intronic
954322406 3:49841097-49841119 TGCCAGAAAAGAACACCTGCAGG + Intronic
956093634 3:65693656-65693678 TGTCAGAATTCAACATCTGCTGG - Intronic
957893458 3:86389046-86389068 TGTCATAATGGTCCCCCTGCTGG + Intergenic
962326795 3:134441052-134441074 TGCCACCACAGACCACCTGCTGG + Intergenic
962536072 3:136329724-136329746 TGTCAGAACAGGCCAGCTCCTGG + Intronic
963762761 3:149300741-149300763 TGTCAGAATGGCCACCCTGCAGG + Intergenic
966099072 3:176243734-176243756 TGTCAGAATGGCCACCCTGCAGG + Intergenic
966755744 3:183369681-183369703 TGTCAGAATGGTCACCCTGCAGG + Intronic
967154560 3:186680776-186680798 TATCAGAATAGGCCAGTTGCTGG + Intergenic
969310550 4:6350783-6350805 TGTCACAGCAGACCACGTGCTGG - Intronic
969353178 4:6609966-6609988 TGTCTGAGTAGATGACCTGCTGG - Exonic
971897334 4:32614653-32614675 TGTCAGAATGGCCACCCTGCAGG + Intergenic
971952435 4:33371347-33371369 TGATAAAATAGACCACCAGCTGG + Intergenic
972579167 4:40379757-40379779 TGGCAGAATTTATCACCTGCTGG + Intergenic
975257397 4:72254365-72254387 TCTCACAATAGGCCATCTGCAGG - Intergenic
975822337 4:78284739-78284761 TGTCAGAAAAAAAGACCTGCAGG - Intronic
975999733 4:80359593-80359615 TAGCAGAATAGACCAAGTGCAGG - Intronic
978069335 4:104447172-104447194 TGTTAGAAAAGACCACCTTCTGG - Intergenic
978118634 4:105051197-105051219 TAACAGAATAGACCAACTGAAGG + Intergenic
979291327 4:118981949-118981971 TCTCAGACTAGACCACTTGAGGG + Intronic
980049582 4:128025703-128025725 TGTCAGTTTACACCACCAGCAGG + Intronic
980628252 4:135404274-135404296 TGCCACAATAGGCCATCTGCAGG - Intergenic
982907084 4:161088155-161088177 AGTCAGAAAAGAACACATGCTGG + Intergenic
983375615 4:166923713-166923735 TGTCAGTAAAGACCAACTGTAGG + Intronic
983470647 4:168150480-168150502 TGTCAGAATGGCCACCCTGCAGG - Intronic
983930649 4:173449904-173449926 TGTCAGACTATTCCACCTACAGG - Intergenic
986086694 5:4459220-4459242 TCCCACAATAGACCATCTGCAGG - Intergenic
986239060 5:5940611-5940633 TGTCAGAGAAGACCAACTGCTGG + Intergenic
987270614 5:16304683-16304705 TGTCAGAATGGTCACCCTGCTGG - Intergenic
990479903 5:56200138-56200160 TGTCAGAATAAACCAAATTCAGG + Intronic
990694159 5:58396485-58396507 TGTCAGAATAGCCAACCTGCAGG - Intergenic
992115393 5:73534279-73534301 TGTCAGAATGGCCACCCTGCAGG - Intergenic
994731180 5:103492498-103492520 TGCAAGAATAGACAATCTGCAGG - Intergenic
995776719 5:115731189-115731211 TCTCACAATAGGCCATCTGCAGG + Intergenic
997068957 5:130596230-130596252 TCTCACAATAGGCCATCTGCAGG - Intergenic
997477568 5:134153959-134153981 TGTCAGAATACACCAGCTCCTGG - Exonic
997878643 5:137570871-137570893 GGTCAGAAAAGACCACCTGCAGG + Intronic
997895830 5:137716428-137716450 TGTCAGAATAGCCACCCTGCAGG - Intronic
999830285 5:155312564-155312586 TCTCAGAAATGGCCACCTGCAGG - Intergenic
999913232 5:156229165-156229187 TCCCACAATAGGCCACCTGCAGG - Intronic
1003620604 6:7696121-7696143 TCTCTGAATGGAACACCTGCAGG - Intergenic
1008209159 6:48700230-48700252 TGTCAGAATTGAACTGCTGCAGG - Intergenic
1009631044 6:66201596-66201618 TCCCACAATAGACCATCTGCAGG + Intergenic
1010020661 6:71156179-71156201 TATCAGAATTGTCCACCTGAGGG + Intergenic
1011068608 6:83357843-83357865 TCTCACAATAGGCCATCTGCAGG - Intronic
1011487584 6:87858678-87858700 TTTCCTAATATACCACCTGCTGG - Intergenic
1011510065 6:88090316-88090338 TGTCAGAACAGCCACCCTGCAGG + Intergenic
1018545488 6:164932468-164932490 TCCCATAATAGACCATCTGCAGG + Intergenic
1020177676 7:5896239-5896261 TGGCAGAATAGACCACTTTTAGG - Intergenic
1021188247 7:17590766-17590788 TATCAGATTAGACCACTTTCTGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026502295 7:70952942-70952964 TGACAGAATTGGCCACCAGCTGG + Intergenic
1027406717 7:77870356-77870378 TCTCACAATAGGCCATCTGCAGG + Intronic
1027541707 7:79475571-79475593 TGTCAGAATGGCCATCCTGCAGG - Intergenic
1027641069 7:80734511-80734533 TTTCAGAATGGACACCCTGCAGG - Intergenic
1030426693 7:109387508-109387530 TGACAGAATAGACCTCTTGAAGG + Intergenic
1030524206 7:110634133-110634155 TCCCACAATAGGCCACCTGCAGG + Intergenic
1031569518 7:123341780-123341802 TGACAGAATATTCCACTTGCAGG - Intergenic
1031702854 7:124946178-124946200 TGGCAGAATAGACCAAGTGGAGG + Intergenic
1032915772 7:136488182-136488204 TGTCATAGTAGACTATCTGCTGG + Intergenic
1034082370 7:148291359-148291381 TCCCACAATAGACCATCTGCAGG + Intronic
1034658902 7:152752278-152752300 TGTCAGAATGGGCCCCCTCCAGG - Intergenic
1038516249 8:28189996-28190018 AGTCAAAATAGGCCACCTGCAGG - Exonic
1039289489 8:36078402-36078424 TAGCAGAATAGACCAGCTGGAGG + Intergenic
1039439960 8:37588282-37588304 TGTGACAAGAGACCACATGCTGG + Intergenic
1039814071 8:41076617-41076639 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1041805157 8:61841602-61841624 TGCCAGAATGGCCAACCTGCAGG + Intergenic
1042207490 8:66343881-66343903 TGTCAGAATGGCCCCCCTGCAGG + Intergenic
1044547548 8:93476420-93476442 TCCCACAATAGACCAGCTGCAGG - Intergenic
1047359405 8:124153704-124153726 TGGCAGATCAGACCCCCTGCAGG - Intergenic
1049317265 8:141975931-141975953 TTTCAGAAGACACCACCAGCGGG - Intergenic
1052151850 9:25126886-25126908 TCCCACAATAGACCATCTGCAGG + Intergenic
1053677925 9:40456307-40456329 TATCAGAACACAACACCTGCAGG + Intergenic
1053695619 9:40636869-40636891 TCTCACAATAGGCCATCTGCTGG + Intergenic
1053927840 9:43084138-43084160 TATCAGAACACAACACCTGCAGG + Intergenic
1053942610 9:43267908-43267930 TCTCACAATAGGCCATCTGCTGG + Intergenic
1054285804 9:63168648-63168670 TATCAGAACACAACACCTGCAGG - Intergenic
1054290998 9:63291833-63291855 TATCAGAACACAACACCTGCAGG + Intergenic
1054306866 9:63436087-63436109 TCTCACAATAGGCCATCTGCTGG + Intergenic
1054389019 9:64596380-64596402 TATCAGAACACAACACCTGCAGG + Intergenic
1054405597 9:64760075-64760097 TCTCACAATAGGCCATCTGCTGG + Intergenic
1054439224 9:65245562-65245584 TCTCACAATAGGCCATCTGCTGG + Intergenic
1054491182 9:65776377-65776399 TCTCACAATAGGCCATCTGCTGG - Intergenic
1054506699 9:65919991-65920013 TATCAGAACACAACACCTGCAGG - Intergenic
1054771182 9:69085756-69085778 TGTCAGAATGGCCACCCTGCAGG - Intronic
1055256372 9:74376567-74376589 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1055709010 9:79038140-79038162 AGTCAGAGTAGACCACCAGATGG + Intergenic
1058931253 9:109721418-109721440 TGTCAGAATATTCCAACTCCAGG + Intronic
1061698066 9:132392968-132392990 TGTCAGAGTAAAACACATGCTGG - Intronic
1062251318 9:135596673-135596695 TGTCAGAATGGCCACCCTGCAGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1202778064 9_KI270717v1_random:10481-10503 TCTCACAATAGGCCATCTGCTGG + Intergenic
1186904339 X:14095320-14095342 TGTCAGGAAAGACCACTTACAGG + Intergenic
1188812868 X:34673414-34673436 TCTCAGAATTGTCCACCTGGGGG + Intergenic
1189092776 X:38104769-38104791 TGTCACAAAAGACCACCTGGAGG - Intronic
1189529599 X:41866003-41866025 CTACAGAAGAGACCACCTGCTGG + Intronic
1196410218 X:115410825-115410847 TGTCAGAATGGCCACCCTGCAGG - Intergenic
1201193389 Y:11468781-11468803 TCTCACAATAGGCCATCTGCTGG + Intergenic
1201530020 Y:14981595-14981617 TCCCACAATAGGCCACCTGCAGG + Intergenic