ID: 1165879424

View in Genome Browser
Species Human (GRCh38)
Location 19:39032012-39032034
Sequence GGCCAGGATCAGCAGCCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165879420_1165879424 -3 Left 1165879420 19:39031992-39032014 CCGGTGGCGCCGTGGTCGCGGGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1165879424 19:39032012-39032034 GGCCAGGATCAGCAGCCACAGGG 0: 1
1: 0
2: 2
3: 40
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165879424 Original CRISPR GGCCAGGATCAGCAGCCACA GGG Exonic