ID: 1165882536

View in Genome Browser
Species Human (GRCh38)
Location 19:39053864-39053886
Sequence CACCCCGGGAGGGTTCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165882536_1165882544 -1 Left 1165882536 19:39053864-39053886 CCGCCCAGAACCCTCCCGGGGTG No data
Right 1165882544 19:39053886-39053908 GCCATCCTGCCCTGAGTAAAGGG No data
1165882536_1165882549 17 Left 1165882536 19:39053864-39053886 CCGCCCAGAACCCTCCCGGGGTG No data
Right 1165882549 19:39053904-39053926 AAGGGCAAAGTCCTCCCCTACGG No data
1165882536_1165882543 -2 Left 1165882536 19:39053864-39053886 CCGCCCAGAACCCTCCCGGGGTG No data
Right 1165882543 19:39053885-39053907 TGCCATCCTGCCCTGAGTAAAGG No data
1165882536_1165882550 26 Left 1165882536 19:39053864-39053886 CCGCCCAGAACCCTCCCGGGGTG No data
Right 1165882550 19:39053913-39053935 GTCCTCCCCTACGGCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165882536 Original CRISPR CACCCCGGGAGGGTTCTGGG CGG (reversed) Intergenic
No off target data available for this crispr