ID: 1165882705

View in Genome Browser
Species Human (GRCh38)
Location 19:39054792-39054814
Sequence CCTGCCTTCTGGAGGCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165882692_1165882705 30 Left 1165882692 19:39054739-39054761 CCAGAGTCTAAAATCAGTTTCAC No data
Right 1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165882705 Original CRISPR CCTGCCTTCTGGAGGCTCGG GGG Intergenic
No off target data available for this crispr