ID: 1165886734

View in Genome Browser
Species Human (GRCh38)
Location 19:39084218-39084240
Sequence CCGGGTCCCACAGGTCCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 260}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165886734_1165886743 -5 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886743 19:39084236-39084258 CCCGGGGCCCTGGCTGTCTAGGG 0: 1
1: 0
2: 2
3: 16
4: 188
1165886734_1165886754 29 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886754 19:39084270-39084292 CCGAGGCGACCGGCTCTTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 68
1165886734_1165886745 -2 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886745 19:39084239-39084261 GGGGCCCTGGCTGTCTAGGGAGG 0: 1
1: 0
2: 1
3: 44
4: 301
1165886734_1165886752 28 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886752 19:39084269-39084291 CCCGAGGCGACCGGCTCTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 43
1165886734_1165886748 12 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886748 19:39084253-39084275 CTAGGGAGGCTGTCACCCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 102
1165886734_1165886741 -6 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886741 19:39084235-39084257 ACCCGGGGCCCTGGCTGTCTAGG 0: 1
1: 0
2: 2
3: 46
4: 639
1165886734_1165886749 19 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886749 19:39084260-39084282 GGCTGTCACCCCGAGGCGACCGG 0: 1
1: 0
2: 0
3: 4
4: 49
1165886734_1165886755 30 Left 1165886734 19:39084218-39084240 CCGGCCGGACCTGTGGGACCCGG 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1165886755 19:39084271-39084293 CGAGGCGACCGGCTCTTCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165886734 Original CRISPR CCGGGTCCCACAGGTCCGGC CGG (reversed) Intronic
900168964 1:1257084-1257106 CCGGGTTCCACGTGTCCGGGTGG + Exonic
901063613 1:6485041-6485063 CCGGGACCCACAGGTGTGTCCGG + Intronic
903772290 1:25771563-25771585 CCGGGCCCCTGAGGTCAGGCGGG + Intronic
905734345 1:40315615-40315637 CCGGGTCCCCCGGGACCGCCGGG - Exonic
907328112 1:53653938-53653960 CAGGGTGCCACAGGACCGGCAGG + Intronic
908655146 1:66380591-66380613 CCAGGTCCCACAGGACCTGCTGG + Intergenic
908682873 1:66682117-66682139 CCAGGTCCCACAGGCCCCCCAGG + Exonic
910034778 1:82777044-82777066 CCGGGGCCGGCAGGGCCGGCTGG + Intergenic
912315917 1:108667573-108667595 CCGGGGCCGGCAGGTCCCGCCGG - Intergenic
912819388 1:112854776-112854798 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
914754799 1:150556678-150556700 CTGGGTCCTACAGGGCCGGCGGG + Exonic
916219854 1:162433251-162433273 CCCGGGCCCGCAGGGCCGGCCGG - Intergenic
918853226 1:189718561-189718583 CCGGGGCCGGCAGGACCGGCCGG + Intergenic
919091888 1:192987008-192987030 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
919174458 1:194001939-194001961 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
921396399 1:214673409-214673431 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
921903853 1:220475932-220475954 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
922193464 1:223339820-223339842 CCGGCTCCCCCAGGACTGGCTGG + Intronic
924219250 1:241855841-241855863 CTGGGGCCGACAGGGCCGGCCGG + Intronic
1065021991 10:21508959-21508981 CGGGGTCCCCCAGGCCCGCCCGG + Intergenic
1068374009 10:56155220-56155242 CCGGGTCCGGCAGGGCCGGCCGG - Intergenic
1069766128 10:70861741-70861763 CCGGGGCCGGCAGGGCCGGCCGG - Intronic
1071387991 10:85141497-85141519 CCGGGGCCAGCAGGGCCGGCCGG - Intergenic
1072811889 10:98468307-98468329 CCTGGTACCCCATGTCCGGCTGG + Intronic
1075255607 10:120923922-120923944 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1077119423 11:899941-899963 CCGGGTCCCACCTGGCCGTCTGG - Intronic
1078418378 11:11184830-11184852 CTGTGTCCCACAGGACTGGCCGG + Intergenic
1083546099 11:63550303-63550325 TCGGGGCCGACAGGGCCGGCTGG - Intergenic
1084182524 11:67454060-67454082 CCGCTTCCCACAGCTCAGGCAGG + Intronic
1084208416 11:67609426-67609448 CAGGGGCCCACAGGTCAGACAGG - Intronic
1084210446 11:67619134-67619156 CCGGGGCCGGCAGGGCCGGCTGG - Intergenic
1085405072 11:76256842-76256864 CAGGGTCCCACAGGCCCCACAGG + Intergenic
1086043021 11:82501256-82501278 CCGGGGCCCGCAGGGCCGGCCGG - Intergenic
1089602519 11:119624313-119624335 CCGGGTCCGACAGGACAGGAGGG + Intronic
1089981615 11:122777257-122777279 CCAGGTCCCAAAGGGCCGGCTGG - Intronic
1090333033 11:125945998-125946020 AAGGGGCCCACAGGTCAGGCAGG + Intergenic
1092142119 12:6191133-6191155 CCGGGGCCCGCAGGGCGGGCCGG + Intergenic
1092350534 12:7752336-7752358 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1092366541 12:7881380-7881402 CCGGGGCCACCAGGGCCGGCCGG - Intronic
1092471758 12:8787364-8787386 CCAGGGCCCGCAGGGCCGGCCGG - Intergenic
1092472948 12:8794821-8794843 CCGGGGCCGGCAGGGCCGGCTGG - Intergenic
1093189388 12:16057480-16057502 CCGGGGCCGGCAGGACCGGCCGG - Intergenic
1093652537 12:21661627-21661649 CTGGGGCCGACAGGGCCGGCCGG - Intronic
1094338624 12:29386503-29386525 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1094448705 12:30561731-30561753 CCGGGGCCAGCAGGGCCGGCTGG - Intergenic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096530814 12:52241726-52241748 CTGGGTCCCACTGTTCTGGCAGG + Intronic
1098168234 12:67719495-67719517 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1100211900 12:92406781-92406803 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1103146161 12:118597438-118597460 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1103668530 12:122592122-122592144 CCGGGGCCGGCAGGGCCGGCCGG - Intronic
1104732929 12:131118567-131118589 CTGGCTCCCACAGGCCCAGCCGG + Intronic
1104749224 12:131227909-131227931 CCGGGGCCAGCAGGGCCGGCCGG - Intergenic
1106585344 13:31052269-31052291 CAGGATCCCACAGATCCTGCAGG + Intergenic
1107590479 13:41898842-41898864 CCGGGGCCTGCAGGGCCGGCCGG + Intronic
1109745805 13:66622046-66622068 CCTGGGCCAACAGGGCCGGCCGG - Intronic
1110368851 13:74718489-74718511 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1112509659 13:99997968-99997990 CCGGCCTCCCCAGGTCCGGCTGG + Intergenic
1112518629 13:100077613-100077635 CCGGGGCCGGCAGGGCCGGCTGG - Intergenic
1113421364 13:110173962-110173984 CCTGGCCCCACAGGCCCAGCTGG - Exonic
1117899320 14:60515840-60515862 CCGCGCCCGACAGGTCCGCCGGG + Intergenic
1120330968 14:83092482-83092504 CCGGGGCCCGCAGGGCCGGCCGG - Intergenic
1120429765 14:84399627-84399649 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
1120704783 14:87735015-87735037 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1120844149 14:89111745-89111767 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1122971629 14:105154613-105154635 CCGGCTGCCACAGGTCAGGGCGG - Intronic
1124114872 15:26831442-26831464 CCGGGGCCGGCAGGGCCGGCTGG + Intronic
1125112202 15:36047052-36047074 CCGGGGCCGTCAGGGCCGGCCGG - Intergenic
1125725931 15:41868176-41868198 CCTGGTCCCGCTGGTCCTGCAGG + Exonic
1125999319 15:44194761-44194783 CCGGGTGCCAGGGCTCCGGCAGG + Intronic
1126088977 15:45034932-45034954 CCGGGAACCGCAGGGCCGGCCGG - Intronic
1126128061 15:45314190-45314212 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1129516361 15:76159999-76160021 CGGGGTCCCAGAGGTCTGGACGG + Intronic
1129777514 15:78246400-78246422 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1129821525 15:78605372-78605394 GTGGGTCCCACAGGTCCTGCTGG - Intronic
1130132848 15:81158720-81158742 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1132252220 15:100342221-100342243 CAGGGTCCCACGGCTCCGGTCGG - Intergenic
1132852513 16:2031203-2031225 ACGGGTCCCACAGGTCCCACGGG - Intronic
1134053629 16:11155492-11155514 CCATGTCCCACAGGTCTGCCAGG + Intronic
1134438841 16:14285645-14285667 GAGGGTCCCGCAGGTCCCGCGGG - Intergenic
1135262137 16:20989903-20989925 CCGGGGCCGGCAGGGCCGGCCGG + Intronic
1135324954 16:21520376-21520398 CCGGGTGTCCCAGGCCCGGCCGG - Intergenic
1135751081 16:25059173-25059195 CCGGGGCCCGCAGGGCCGGCCGG + Intergenic
1136719786 16:32310664-32310686 CCGAGTCCGACGGGCCCGGCAGG - Intergenic
1136838161 16:33516944-33516966 CCGAGTCCGACGGGCCCGGCAGG - Intergenic
1137683119 16:50368524-50368546 CCGGGTCCCCCTGGTCCGGTGGG - Intronic
1138423024 16:56912208-56912230 CAGTGTCTCACAGGTCCAGCTGG - Intronic
1139952796 16:70680187-70680209 CCGAATCCCCCAGGGCCGGCGGG - Intronic
1140478711 16:75251368-75251390 CCAGGCCCCGCAGGTCCGGCAGG + Intronic
1140722536 16:77784641-77784663 CGGGGGCCGACAGGGCCGGCCGG + Intergenic
1141635513 16:85312014-85312036 CCTGGTCCCAGAGGTCGAGCTGG - Intergenic
1142037157 16:87869433-87869455 CCGGGTGTCCCAGGCCCGGCCGG - Exonic
1142225719 16:88876843-88876865 TCGGCTCCCCCAGGTCAGGCGGG + Exonic
1203006645 16_KI270728v1_random:207105-207127 CCGAGTCCGACGGGCCCGGCAGG + Intergenic
1203148331 16_KI270728v1_random:1817224-1817246 CCGAGTCCGACGGGCCCGGCCGG - Intergenic
1142806472 17:2373587-2373609 CCAGTTCCCAGAGGTCAGGCTGG - Intronic
1143552730 17:7640978-7641000 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1144726239 17:17504070-17504092 CCGGGCCCCACAGCCCAGGCAGG - Intergenic
1146682196 17:34816319-34816341 CCGGTTCCCATAGGTGGGGCAGG - Intergenic
1147431804 17:40375932-40375954 CCGGGGCCAGCAGGGCCGGCAGG - Intergenic
1147997518 17:44368921-44368943 CCGGGGCCGGCAGGGCCGGCTGG - Intergenic
1147998533 17:44374821-44374843 CCAGGTCCCACACCCCCGGCGGG + Intronic
1148795767 17:50195957-50195979 CAGGGTCCCACCGGCCCCGCTGG - Exonic
1150778265 17:68099380-68099402 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1150804621 17:68309172-68309194 CCGGGGCCCGCAGGGCCAGCTGG + Intronic
1151608207 17:75153819-75153841 CCGGATCGATCAGGTCCGGCGGG - Intronic
1152531883 17:80923581-80923603 CCGGGCACCACAGGCCCCGCTGG + Exonic
1152986419 18:325526-325548 CCGGCTCCCGCAGGTCTAGCAGG + Intronic
1153644071 18:7178928-7178950 CCGGGGCCAGCAGGGCCGGCTGG + Intergenic
1153681085 18:7501593-7501615 CCAGGTCCCACAGGTGAGGCAGG + Intergenic
1153820133 18:8825433-8825455 CCGGGACCCATTGGTCTGGCAGG - Exonic
1154173086 18:12064400-12064422 CAGGGTCCCACAGGGTCAGCAGG - Intergenic
1155261662 18:24049613-24049635 CCTGGTCCCTCGGGTCGGGCTGG - Intronic
1155295046 18:24376842-24376864 CAGGGGCCGACAGGGCCGGCCGG + Intronic
1156863644 18:41865855-41865877 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1158697277 18:59714355-59714377 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1159167968 18:64725892-64725914 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
1159230782 18:65605352-65605374 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1160895873 19:1401554-1401576 GCGGGTCCAACAGGCCCGGGGGG + Exonic
1161483717 19:4523734-4523756 CCAGGTCCGCCAGGTCGGGCAGG + Exonic
1161590731 19:5128060-5128082 CCTGGCCCCACAGCCCCGGCTGG + Intronic
1162399097 19:10433868-10433890 CCGGGGCGCACAGGGCAGGCAGG - Intronic
1162930645 19:13955899-13955921 ACGTGCCTCACAGGTCCGGCAGG + Exonic
1163181736 19:15608907-15608929 CCGGGGCCAGCAGGGCCGGCTGG + Intergenic
1165733185 19:38159340-38159362 CGGGGTCCCACAGGCCTGGTGGG + Intronic
1165886734 19:39084218-39084240 CCGGGTCCCACAGGTCCGGCCGG - Intronic
1168189758 19:54729525-54729547 CCGGGCCCCACGGTTCAGGCAGG + Exonic
1168191762 19:54743827-54743849 CCGGGCCCCACGGTTCTGGCAGG + Exonic
1168194037 19:54760464-54760486 CCGGGCCCCACGGTTCTGGCAGG + Intronic
1168204458 19:54839460-54839482 CCGGGCCCCACGGTTCAGGCAGG + Intronic
1168206689 19:54855651-54855673 CCGGGCCCCACGGTTCAGGCAGG + Exonic
925045845 2:772547-772569 CCCGGTCCCACAGCACCAGCTGG - Intergenic
925337433 2:3108406-3108428 AGGGGTCCCACAGTTCCTGCAGG + Intergenic
926101704 2:10122417-10122439 CAGGCCCCCACAGGTCCCGCGGG - Exonic
930338773 2:50084470-50084492 CCGGGGCCCACAGGGCCGGCCGG + Intronic
932316012 2:70783519-70783541 CCAGGTCCAACAGGACTGGCAGG + Intronic
932471389 2:71961827-71961849 CCAGGTCACACAGGGCCTGCTGG - Intergenic
934761962 2:96861349-96861371 CCGGCCCCCAAAGGTCCAGCGGG + Exonic
934988287 2:98902742-98902764 CCGGGTCCCAGAGGCCAGGGAGG - Intronic
935896870 2:107747601-107747623 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
937067265 2:119026802-119026824 CCAAGTCCCAGAGGTCCAGCTGG - Intergenic
937181125 2:119997081-119997103 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
937596833 2:123683871-123683893 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
938310355 2:130285265-130285287 TTGGGTCCCACAGGCCCAGCTGG + Intergenic
938401012 2:130991543-130991565 CCGGGGCCGGCAGGGCCGGCCGG - Intronic
938734898 2:134176948-134176970 CCTGGTCCCACATGTCCTGTCGG - Intronic
939229741 2:139410438-139410460 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
942446117 2:176080124-176080146 CCTCGTCCCTCTGGTCCGGCGGG + Exonic
942867272 2:180691485-180691507 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
943680360 2:190761217-190761239 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
944632778 2:201643472-201643494 CGGCGTCCCACAGGTCCCGGAGG - Exonic
946432217 2:219631926-219631948 GGGGGTCCCACAGGTCCAGCTGG - Intronic
948630742 2:239301064-239301086 CCGGGTCCCTCAGCCCCGGCGGG + Intronic
948870991 2:240797992-240798014 CTGGGTTCCACTGGTCCCGCTGG - Intronic
1170434868 20:16315871-16315893 CCAGGTCCTACAGGTGGGGCTGG + Intronic
1170989869 20:21291969-21291991 CCGGGGCCAGCAGGGCCGGCCGG - Intergenic
1173601581 20:44299231-44299253 CCGGGTCCGGCAGGGCCGGCCGG - Intergenic
1173895213 20:46545832-46545854 CTGGGCCCCACAGGCCAGGCAGG - Exonic
1175532096 20:59680817-59680839 CCGTGTTCCACAGGACAGGCCGG + Intronic
1175899134 20:62353185-62353207 CCAGCACCCAGAGGTCCGGCCGG + Exonic
1176150382 20:63587891-63587913 CCGGCTCCTCCAGGTCCTGCTGG - Exonic
1177565843 21:22819102-22819124 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
1178992672 21:37367794-37367816 CCGGGTCCCGGAGGAGCGGCGGG + Intronic
1179653883 21:42833132-42833154 GCGGGTCCCTCAGGACCTGCAGG + Intergenic
1180066419 21:45414806-45414828 ACGGGTCCCACAGGCCGGGGTGG - Intronic
1180741061 22:18053619-18053641 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1182211389 22:28679974-28679996 CCGAGTCCGACGGGCCCGGCGGG - Intergenic
1184244763 22:43230380-43230402 CTGGGCTCCACAGGTCCAGCAGG - Intronic
950929380 3:16773814-16773836 CCGGGGCCAGCAGGGCCGGCTGG - Intergenic
951951104 3:28200675-28200697 CCGGGGCCGGCAGGGCCGGCTGG + Intergenic
952398214 3:32939781-32939803 CCGGGGCCGACAGGGCTGGCGGG - Intergenic
952795231 3:37233101-37233123 CCGGGGCCGGCAGGGCCGGCAGG - Intergenic
955183334 3:56691977-56691999 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
957665198 3:83217873-83217895 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
957804922 3:85134123-85134145 CTGGGGCCCGCAGGGCCGGCCGG + Intronic
957830034 3:85504938-85504960 CCGGGGCCGGCAGGGCCGGCCGG + Intronic
961454222 3:127016281-127016303 CCGGGTCCCAAATGCCAGGCTGG + Intronic
962600519 3:136987849-136987871 CCGGGGCCGGCAGGGCCGGCCGG + Intronic
965109440 3:164402152-164402174 CCAGGGCCGGCAGGTCCGGCGGG + Intergenic
965200359 3:165649579-165649601 CCGGGGCCTGCAGGGCCGGCCGG + Intergenic
966735294 3:183182313-183182335 CCGGGTGCCACAGGTGAGGGTGG + Intronic
969258457 4:6019047-6019069 CCGGGTCCCACAGGTGGGATGGG + Intergenic
969522834 4:7688813-7688835 CTGGGTCCCAGAGGTCTGGCTGG - Intronic
970649342 4:18159531-18159553 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
970803511 4:20004110-20004132 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
971377130 4:26064241-26064263 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
974900686 4:67993575-67993597 ACAGGTCCCACAGGTCCCACAGG - Intergenic
974900689 4:67993584-67993606 CAGCGTCCCACAGGTCCCACAGG - Intergenic
979688572 4:123538015-123538037 CCGGGGCCGGCAGGGCCGGCTGG - Intergenic
980051947 4:128047820-128047842 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
980230267 4:130038804-130038826 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
981146739 4:141333280-141333302 CCGGGTCCGGCAGGGCCGGCCGG + Intergenic
982921257 4:161277349-161277371 CCGGGTCCGGCAGGGCGGGCCGG - Intergenic
983230673 4:165126199-165126221 CCGGGGCCGGCAGGGCCGGCCGG + Intronic
984265640 4:177495690-177495712 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
984948736 4:184990350-184990372 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
985087084 4:186324682-186324704 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
985203235 4:187505729-187505751 CCGGGGCCGACAGGGCCGGCCGG - Intergenic
985639987 5:1059089-1059111 CCAGGTCCCTGAGATCCGGCAGG - Intronic
987146264 5:14994067-14994089 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
987476711 5:18399934-18399956 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
987543815 5:19287843-19287865 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
988087004 5:26485542-26485564 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
988177249 5:27743560-27743582 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
988883574 5:35531725-35531747 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
989965814 5:50465113-50465135 CCGGGGCCAGCAGGGCCGGCTGG - Intergenic
990345248 5:54865175-54865197 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
992703375 5:79362977-79362999 CCGTGTCCCACTGCTCCAGCAGG - Intergenic
992940008 5:81751717-81751739 CCTGTTCCCAGAGGGCCGGCTGG + Intronic
993520074 5:88889544-88889566 CCAGGTCCAGCAGGTCCAGCAGG - Intronic
993529204 5:89003881-89003903 CCGGGGCCTGCAGGGCCGGCCGG + Intergenic
996716918 5:126595427-126595449 CCGGGAGCCACAGTTCCAGCTGG + Intergenic
998040337 5:138947374-138947396 CCTGTTCCCACAGGCCTGGCAGG + Exonic
999144203 5:149381805-149381827 CTGGGTCCCACAGGCCTGCCTGG - Intronic
999855298 5:155587013-155587035 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1000329204 5:160194158-160194180 CCGGGGCCAGCAGGGCCGGCCGG + Intronic
1001052351 5:168423574-168423596 CCGGATCCCTCACGTCCAGCCGG + Exonic
1002004649 5:176222286-176222308 CCGGGGCCGGCAGGGCCGGCTGG + Intergenic
1002221728 5:177688334-177688356 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1003081900 6:3027801-3027823 CCGGGGCCGACAGGGCCGCCCGG - Intergenic
1003982480 6:11402843-11402865 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1004053165 6:12108651-12108673 CCGGGGCCAGCAGGGCCGGCCGG + Intronic
1004866069 6:19854688-19854710 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1005600886 6:27425089-27425111 CCGGGGCCGCCAGGGCCGGCCGG + Intergenic
1005707458 6:28469614-28469636 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1005994914 6:30925312-30925334 CCGGGTCCAAGAGGTCGTGCAGG + Exonic
1006470596 6:34226651-34226673 CTTGGTCCCACAGGTCCCCCAGG - Intergenic
1006695997 6:35931366-35931388 CCGGGGCCAGCAGGGCCGGCTGG - Intergenic
1007115474 6:39340124-39340146 CCAGGTCCCAAAGGGCCAGCAGG - Intronic
1008038769 6:46774698-46774720 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1010199327 6:73269135-73269157 CCGGGGCCAGCAGGGCCGGCCGG + Intronic
1012189354 6:96261206-96261228 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
1012939556 6:105402775-105402797 GCGGGTGCCACGGGTCAGGCAGG + Intronic
1013025735 6:106269667-106269689 CCGGGGCCGGCAGGGCCGGCCGG + Intronic
1013980393 6:116121472-116121494 CAGGGTCCCACAGGACCATCTGG - Exonic
1014240728 6:119015423-119015445 CCGGGGCCCGCAGGGCCGGCCGG - Intronic
1015572267 6:134633806-134633828 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1016969630 6:149750009-149750031 CCGGGTCCCCCTGGGCCGTCCGG + Intronic
1017581236 6:155867016-155867038 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1017839523 6:158210049-158210071 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
1018488974 6:164272384-164272406 CCAAGTCCCACAGCTCCTGCTGG + Intergenic
1019000278 6:168744046-168744068 CCGGGGCCAGCAGGGCCGGCTGG + Intergenic
1019944283 7:4314199-4314221 CCGGGGCCCGCAGGGCCGGCCGG + Intergenic
1024248507 7:47488783-47488805 CTGGGTCCCCCAGGTGAGGCCGG + Intronic
1024269064 7:47628576-47628598 CCGGGGCCAGCAGGGCCGGCCGG - Intergenic
1028070082 7:86440666-86440688 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1028754033 7:94414228-94414250 CCTGGCCCCTCAGGTCCCGCTGG + Exonic
1028754818 7:94422972-94422994 CCTGGTCCCCCTGGTCCTGCTGG + Exonic
1029456595 7:100675129-100675151 CCGGGCCCCAGGGGCCCGGCTGG - Intronic
1030780399 7:113593418-113593440 CCGGGGCCAGCAGGGCCGGCCGG - Intergenic
1032076518 7:128838634-128838656 CGTGGACCCACAGGGCCGGCGGG + Exonic
1032561620 7:132898868-132898890 CCGGGGCCGGCAGGGCCGGCCGG + Intronic
1033585794 7:142773475-142773497 CCGAGTCCCTCATCTCCGGCTGG + Intergenic
1034097896 7:148426507-148426529 CCGGGGCCGGCAGGGCCGGCTGG - Intergenic
1035151199 7:156874265-156874287 CCGGGGCCAGCAGGGCCGGCTGG + Intronic
1036398350 8:8386863-8386885 CAGGGTCCCGCAGGGCCGGCTGG - Intergenic
1036441048 8:8781653-8781675 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1037810959 8:22086653-22086675 CCGGGGCCTGCAGGGCCGGCCGG - Intergenic
1037957570 8:23071047-23071069 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1043129954 8:76447875-76447897 CCGGGGCCGGCAGGGCCGGCGGG + Intergenic
1043346446 8:79303593-79303615 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1047750363 8:127875989-127876011 CCAGGTCCCCCAGGTAAGGCAGG - Intergenic
1048789157 8:138084234-138084256 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1049087654 8:140490776-140490798 CCGGGGCCAGCAGGGCCGGCCGG + Intergenic
1049545229 8:143227737-143227759 CCAGGTCCCATGGGTCCAGCAGG - Intergenic
1050455715 9:5832579-5832601 GCGAGTCCCAGCGGTCCGGCAGG + Intronic
1053725259 9:40992488-40992510 CTGGGTCCTGCAGCTCCGGCGGG + Intergenic
1054340684 9:63859394-63859416 CTGGGTCCTGCAGCTCCGGCGGG - Intergenic
1057047918 9:91900193-91900215 GCGGGTCCCCCAGGGCCGCCAGG + Intronic
1059433938 9:114265428-114265450 CCGGGTCCCTCAGGCCCCCCAGG + Exonic
1062115536 9:134806258-134806280 CAGGGACCCCCAGGGCCGGCAGG + Exonic
1062117591 9:134817775-134817797 CAGGGTCCCCCAGGCCCCGCAGG + Exonic
1062542183 9:137046361-137046383 GCGGTTCCCAGAAGTCCGGCTGG + Intergenic
1186152614 X:6690769-6690791 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1190758598 X:53422134-53422156 CCGGCTCCGGCCGGTCCGGCGGG + Intronic
1192205866 X:69095549-69095571 CAGGGTCCCAGAGGCCTGGCAGG + Intergenic
1192318550 X:70069719-70069741 CCTCTTCCCACAGGTCCTGCAGG + Intergenic
1196582677 X:117394779-117394801 CCAGGGCCGACAGGGCCGGCCGG - Intergenic
1196827295 X:119751091-119751113 CCGGGGCCGGCAGGGCCGGCCGG + Intergenic
1196845041 X:119890689-119890711 CCGGGGCCGGCAGGGCCGGCCGG - Intergenic
1197340033 X:125255745-125255767 CCGGGGCTGACAGGGCCGGCCGG - Intergenic
1198299966 X:135325552-135325574 CCGGGGCCGGCAGGGCCGGCCGG - Intronic
1200146327 X:153928149-153928171 CCGGGTCCCATGGGCCTGGCCGG + Intronic
1201188826 Y:11429733-11429755 CCATGTCCGACAGGCCCGGCGGG + Intergenic