ID: 1165891111

View in Genome Browser
Species Human (GRCh38)
Location 19:39112730-39112752
Sequence CTGTGTGACCATGGGCAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165891102_1165891111 -6 Left 1165891102 19:39112713-39112735 CCCAGCCCCACCAATTCCTGTGT No data
Right 1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG No data
1165891103_1165891111 -7 Left 1165891103 19:39112714-39112736 CCAGCCCCACCAATTCCTGTGTG No data
Right 1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165891111 Original CRISPR CTGTGTGACCATGGGCAAGT CGG Intergenic
No off target data available for this crispr