ID: 1165891911

View in Genome Browser
Species Human (GRCh38)
Location 19:39117728-39117750
Sequence CTGAAGATCTGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165891911_1165891916 6 Left 1165891911 19:39117728-39117750 CCTTCCTCCCTCCAGATCTTCAG No data
Right 1165891916 19:39117757-39117779 TTTTCAGCAAATTTTAAAAATGG No data
1165891911_1165891917 29 Left 1165891911 19:39117728-39117750 CCTTCCTCCCTCCAGATCTTCAG No data
Right 1165891917 19:39117780-39117802 TAATAGTTTTATTTTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165891911 Original CRISPR CTGAAGATCTGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr