ID: 1165895064

View in Genome Browser
Species Human (GRCh38)
Location 19:39136463-39136485
Sequence CTGACTGAACAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165895064_1165895067 -7 Left 1165895064 19:39136463-39136485 CCTCCTTCCTTCTGTTCAGTCAG 0: 1
1: 0
2: 2
3: 48
4: 354
Right 1165895067 19:39136479-39136501 CAGTCAGCCTCTGCTGACAGTGG 0: 1
1: 1
2: 3
3: 31
4: 243
1165895064_1165895071 4 Left 1165895064 19:39136463-39136485 CCTCCTTCCTTCTGTTCAGTCAG 0: 1
1: 0
2: 2
3: 48
4: 354
Right 1165895071 19:39136490-39136512 TGCTGACAGTGGCCCCCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 153
1165895064_1165895069 2 Left 1165895064 19:39136463-39136485 CCTCCTTCCTTCTGTTCAGTCAG 0: 1
1: 0
2: 2
3: 48
4: 354
Right 1165895069 19:39136488-39136510 TCTGCTGACAGTGGCCCCCTTGG 0: 1
1: 0
2: 1
3: 20
4: 229
1165895064_1165895070 3 Left 1165895064 19:39136463-39136485 CCTCCTTCCTTCTGTTCAGTCAG 0: 1
1: 0
2: 2
3: 48
4: 354
Right 1165895070 19:39136489-39136511 CTGCTGACAGTGGCCCCCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 157
1165895064_1165895077 27 Left 1165895064 19:39136463-39136485 CCTCCTTCCTTCTGTTCAGTCAG 0: 1
1: 0
2: 2
3: 48
4: 354
Right 1165895077 19:39136513-39136535 AGATGTTTCTTCCCGACCATGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1165895064_1165895076 26 Left 1165895064 19:39136463-39136485 CCTCCTTCCTTCTGTTCAGTCAG 0: 1
1: 0
2: 2
3: 48
4: 354
Right 1165895076 19:39136512-39136534 GAGATGTTTCTTCCCGACCATGG 0: 1
1: 0
2: 0
3: 11
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165895064 Original CRISPR CTGACTGAACAGAAGGAAGG AGG (reversed) Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
901057080 1:6453571-6453593 CTGACTGTCCTGGAGGAAGGGGG + Intronic
901304800 1:8225075-8225097 CAGACAGAACAGAAGCCAGGCGG - Intergenic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902477289 1:16694922-16694944 CTGACTGTCCTGGAGGAAGGGGG - Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
904246783 1:29193730-29193752 ATGACAGAAAAGCAGGAAGGGGG + Intronic
904558829 1:31383382-31383404 CTGCCTGAACAGATGGTAAGTGG - Intergenic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905809656 1:40902723-40902745 CTGACGGAACAGAAATAGGGTGG + Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
908127434 1:61044898-61044920 CTGACTGAACATAAACAAGATGG - Intronic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
910488733 1:87745042-87745064 GTGACTTAACAGAAGAAAGTTGG + Intergenic
911226649 1:95314411-95314433 ATGAATGAATAAAAGGAAGGAGG + Intergenic
911377095 1:97064103-97064125 ATAACTGAACAGGAGAAAGGAGG + Intergenic
911671584 1:100614317-100614339 CTGACTGAATGGAAGGAACATGG - Intergenic
911889441 1:103348533-103348555 CTGACTGAAATGAGGGAATGAGG + Intergenic
912265409 1:108152268-108152290 CTCACTGAAGAGACTGAAGGTGG - Intronic
915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG + Intronic
915304478 1:154969825-154969847 GGGAGTGAAAAGAAGGAAGGGGG + Intronic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
917085015 1:171296520-171296542 CTCACTTAACAGAAGGCAGTTGG - Intergenic
917571086 1:176266165-176266187 ATGACTGAACCCAAGGAAAGGGG + Intergenic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
920497354 1:206464745-206464767 CTTATTGAAAACAAGGAAGGTGG - Intergenic
921343362 1:214156378-214156400 CTGCCTGAACTGAAGGGAGCAGG - Intergenic
921593259 1:217027699-217027721 CCCACAGATCAGAAGGAAGGTGG + Intronic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
924689067 1:246327304-246327326 CTGACTGAAGATAAGAAAGAGGG - Exonic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063534741 10:6872435-6872457 CTCACTGGACAGAACCAAGGGGG + Intergenic
1063971775 10:11386039-11386061 CTGGCTGAAGAGAAGAAAAGGGG + Intergenic
1064018580 10:11791643-11791665 CTAACTCCTCAGAAGGAAGGGGG + Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1065104464 10:22368302-22368324 GTTACTGAACAGAAGCAATGAGG + Intronic
1065564938 10:26998824-26998846 CTCACTCAACAGAAGGCAGCTGG - Intronic
1065646934 10:27844881-27844903 TTGACTTAGCAGAAGCAAGGTGG + Intronic
1066065136 10:31756334-31756356 CTGACAGCCCAGAAGGAAGGAGG + Intergenic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067305377 10:45059443-45059465 CTGAATGAACTGACTGAAGGAGG + Intergenic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1070106086 10:73432723-73432745 CTGGCAGAAAAGAAAGAAGGTGG + Intronic
1071986937 10:91061391-91061413 CTGACTGAAAGGAAGGAAGTGGG + Intergenic
1072392043 10:94997369-94997391 CTGCCTGTAAAGAAGGCAGGTGG - Intergenic
1074372850 10:112914192-112914214 CTGTCTGAAAAGAAAGAAGGAGG - Intergenic
1074522861 10:114240374-114240396 CAGACAGAAGAGAAGGGAGGAGG + Intronic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075388837 10:122077652-122077674 CTGGCAGAACAGAATGAAGGGGG + Intronic
1076273168 10:129174492-129174514 CTGGCAGAGCAGAAAGAAGGAGG - Intergenic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1076431479 10:130406764-130406786 CTGATTCAAAAGAAGGAAAGAGG + Intergenic
1076902699 10:133347720-133347742 GTGACTGCCCAAAAGGAAGGGGG + Intronic
1078390510 11:10931987-10932009 GTGACAGAACAGGAGGAAAGGGG + Intergenic
1079242162 11:18728822-18728844 CTGACTGAAGGGGAGGAAGCGGG + Exonic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1081012203 11:37827527-37827549 CTGCCTACACAGAATGAAGGAGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083433309 11:62626204-62626226 ATAACAGAACAGAAGGAAGGAGG + Intronic
1083609546 11:63998517-63998539 CTGACTGGGGGGAAGGAAGGCGG - Intronic
1083690425 11:64404943-64404965 CTGGCTGAACTGGAGGAAGAGGG - Intergenic
1084328590 11:68416334-68416356 CTGGCTGAACAGCAAGAAGGTGG - Exonic
1085064758 11:73484081-73484103 TTGACTGAAGATAAGGAGGGAGG - Intronic
1085303558 11:75472721-75472743 CTGAATGAACAACTGGAAGGAGG - Intronic
1085402789 11:76244555-76244577 CTGACTAACCAGGAGAAAGGAGG + Intergenic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1086320474 11:85641709-85641731 CTGATTCAAAGGAAGGAAGGAGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1087621561 11:100548861-100548883 CTGTCTGTAAACAAGGAAGGGGG - Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1089836179 11:121372708-121372730 CTCACTCAACAGAAGGTAGTAGG - Intergenic
1090578100 11:128130794-128130816 CTAACTGAACAAAAGGCAGCAGG + Intergenic
1090991861 11:131824914-131824936 CTGACAGAGCAGAAGGAACACGG + Intronic
1091755868 12:3051157-3051179 GTGGCTGAAAGGAAGGAAGGAGG - Intergenic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1092265126 12:6975029-6975051 ATGACTGGACAGAAGGACTGTGG + Intronic
1092889382 12:12954548-12954570 ATGACTAACCAGCAGGAAGGGGG - Intergenic
1093950258 12:25157461-25157483 CTGACTTAACAGAAGACAGCTGG - Intronic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1097666876 12:62488442-62488464 CTGACTGTAGAGTATGAAGGGGG + Intronic
1100272920 12:93043540-93043562 CTGTCTCAAAAAAAGGAAGGAGG - Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101900738 12:108789490-108789512 CTCACTGACCAAAAGGCAGGAGG - Intronic
1102138256 12:110593211-110593233 CTGACTAAACTGGAGGAGGGTGG + Intergenic
1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG + Intronic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104613455 12:130249514-130249536 CTGGCTGAAAAACAGGAAGGAGG + Intergenic
1105734239 13:23251324-23251346 CTGACTGACCCAAAGGAATGTGG - Intronic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1107430051 13:40332415-40332437 ATGACTGAACCTGAGGAAGGGGG + Intergenic
1107830164 13:44367989-44368011 CTGATTGAACAGAAACAAAGTGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1109159962 13:58958921-58958943 ATTAGTGAACAGAATGAAGGTGG - Intergenic
1109853993 13:68105201-68105223 CTCACAGACCAGAAAGAAGGTGG - Intergenic
1110448497 13:75615812-75615834 TTCACTAAAAAGAAGGAAGGAGG - Intergenic
1113571748 13:111362916-111362938 ATGACTGAAGACAAGGGAGGTGG + Intergenic
1113695032 13:112339238-112339260 AGGACTGAAGAGAAGGAGGGAGG - Intergenic
1114686264 14:24534661-24534683 CTGATTGAAGAGAAGGACTGCGG + Intergenic
1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1117094351 14:52282352-52282374 CTCACTCAACAGAAGGCAGTAGG + Intergenic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1120959518 14:90111737-90111759 CTGCCTGCACAGAGGGAAAGTGG - Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121330988 14:93049733-93049755 GTCACAGAACAGAAGGACGGGGG + Intronic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1125012668 15:34897416-34897438 CTGACAGAATAGAAAGAAAGAGG + Intronic
1125386540 15:39142714-39142736 CTGGCAGAGCAGGAGGAAGGAGG - Intergenic
1125646784 15:41279234-41279256 TTTACTGCACAGGAGGAAGGGGG + Intronic
1125711822 15:41793081-41793103 CTGGCTTAACAGAAGGGAGCTGG - Intronic
1126798599 15:52280585-52280607 CTGACTGAATACCTGGAAGGCGG - Intronic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128292259 15:66486919-66486941 CTCTCTCAATAGAAGGAAGGGGG + Intronic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1129192340 15:73944774-73944796 TTAACTGAACAGAGGGAAGGAGG + Intronic
1130104449 15:80918970-80918992 GTGACTGAAGAGAAGATAGGAGG + Intronic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1135565165 16:23506405-23506427 CTGACTGGACATCAGGAATGTGG - Intronic
1135716273 16:24771045-24771067 CTGGCTTAACAGAAGGTAGGTGG - Intronic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1137582699 16:49643504-49643526 CTGACTGAACAGGACTAAGGGGG - Intronic
1137977084 16:53041122-53041144 CTGGATGAAAGGAAGGAAGGAGG + Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141384027 16:83602969-83602991 CAGACGGAACAGTAGCAAGGAGG + Intronic
1141773196 16:86103854-86103876 CTGACATAATAGAAGCAAGGTGG - Intergenic
1142712527 17:1731097-1731119 CCGACTGAACAGCCGTAAGGAGG + Exonic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1143408106 17:6691347-6691369 CTGACTGGGTATAAGGAAGGAGG - Intronic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1144402894 17:14923683-14923705 CTGACAGAAAGGAAGGCAGGTGG - Intergenic
1145203217 17:20966041-20966063 CTGAGTTAACATATGGAAGGGGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146553590 17:33803702-33803724 TTGTCTGAATAGAAGGCAGGCGG - Intronic
1147371839 17:39997763-39997785 CTTACTGTACAGCAGGCAGGAGG + Exonic
1148634147 17:49134093-49134115 GTGACTGAAAAGGAGGAAGCTGG + Intronic
1149537857 17:57446281-57446303 TTCAGGGAACAGAAGGAAGGAGG + Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151881095 17:76895008-76895030 CTGGCTGCACAGCAGGAAGTGGG + Intronic
1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG + Intergenic
1152421353 17:80195071-80195093 CTGACTGGAGAGGAGGCAGGAGG - Intronic
1153439541 18:5101403-5101425 TTGACTAAACTGAGGGAAGGGGG - Intergenic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1155141303 18:23047014-23047036 CTGAATGATCAGAAAAAAGGGGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1159010823 18:63057594-63057616 CTGCTTGGAAAGAAGGAAGGTGG - Intergenic
1159349957 18:67259601-67259623 CTTACTGCACAGAAGGCAGCAGG + Intergenic
1159921367 18:74230191-74230213 CTGGCCGGTCAGAAGGAAGGAGG + Intergenic
1160357265 18:78238982-78239004 CGGCCTGAGAAGAAGGAAGGAGG + Intergenic
1160598568 18:79994892-79994914 CTCACTGAACCGAAGGCAGTAGG + Intronic
1160928769 19:1559946-1559968 CGGACTGTACAGAAGAATGGAGG - Intronic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161766218 19:6210344-6210366 CTGACTGGACAGGAGGAACCAGG + Intergenic
1161852539 19:6745126-6745148 CGGACTGGAGGGAAGGAAGGCGG + Intronic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165895132 19:39136775-39136797 CTGACTGAACTGTAGTAAGCTGG + Intronic
1165919905 19:39289908-39289930 CTGGATGAACAGAAAGAAAGTGG - Intergenic
1165920400 19:39294154-39294176 CTGCCTGGAGAGAAGGCAGGCGG - Intergenic
1166594671 19:44034920-44034942 ATGCCTGGACATAAGGAAGGCGG + Intergenic
1168297593 19:55384959-55384981 CCTACTGAACAAAAGGAATGAGG - Intergenic
1202711304 1_KI270714v1_random:20748-20770 CTGACTGTCCTGGAGGAAGGGGG - Intergenic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
927539447 2:23895068-23895090 GTGACTGAACAGAAGTAAAAGGG - Intronic
927709158 2:25314434-25314456 GTGAATGAAGAGAAGGGAGGAGG - Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
929848240 2:45555445-45555467 CTGAGTGAAGAGATGGGAGGAGG - Intronic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
931987931 2:67758968-67758990 CTACCTGAACAGAGAGAAGGAGG + Intergenic
932027609 2:68151365-68151387 CTGAATGAAGAGAAGGATAGAGG - Intronic
932570537 2:72936173-72936195 CTGACTGGACACAAGTGAGGTGG - Intergenic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934611802 2:95743911-95743933 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935211897 2:100945675-100945697 CTGACAGCACTGCAGGAAGGTGG - Intronic
936545138 2:113385529-113385551 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
936748078 2:115604517-115604539 CTGACAGAACAGAACTATGGTGG - Intronic
937284229 2:120739709-120739731 CTTAGTGAAAAGAAGAAAGGGGG - Intronic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
938339154 2:130523889-130523911 CTGACTGAAGTGGAGGGAGGGGG - Intronic
938350683 2:130596861-130596883 CTGACTGAAGTGGAGGGAGGGGG + Intronic
940129737 2:150367782-150367804 CTGACTTAACAGAAGACAGGTGG + Intergenic
940882910 2:158964743-158964765 CTTGCTGAAAAGAGGGAAGGTGG + Intergenic
942841852 2:180371524-180371546 CTGAGTGAACAGAAGCTAAGTGG - Intergenic
945071071 2:205989489-205989511 GTGACTGAGCATAAGGAATGTGG - Intergenic
945187475 2:207154353-207154375 CAGACTGGACAGAAAGAAAGGGG + Intronic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945856664 2:215077022-215077044 CTTCAGGAACAGAAGGAAGGAGG + Intronic
946486544 2:220105944-220105966 CTTACAGAACTGAAGGAAGATGG - Intergenic
947246813 2:228057729-228057751 GGGACTGAACAGAAGAATGGTGG + Intronic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
948525720 2:238569779-238569801 AGGACAGAACAGAAGGCAGGCGG + Intergenic
1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG + Intergenic
1169348012 20:4844757-4844779 CTGTCTCAAGAAAAGGAAGGAGG + Intergenic
1170084268 20:12511723-12511745 CTGAGTGAAGAGAAGTAATGAGG - Intergenic
1172539536 20:35699900-35699922 CTGACTTTACAGATTGAAGGTGG - Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173094824 20:40015409-40015431 CAGTCTGAACAGATGAAAGGGGG + Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1174059631 20:47823543-47823565 CTGACTGTTCACAAGGGAGGAGG - Intergenic
1174491652 20:50902309-50902331 CTGACTGACCATCAGGAAAGTGG - Intronic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175748408 20:61477579-61477601 CAGACTGAGCTCAAGGAAGGCGG - Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176884131 21:14233825-14233847 CTGACTATACAGAATAAAGGAGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177299508 21:19223923-19223945 CTGACTGAACACAAAGTAGTAGG - Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1179335562 21:40448943-40448965 CTCACTGAACTAAATGAAGGTGG + Intronic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1182621772 22:31622373-31622395 CTGTCTTAACAGGAAGAAGGAGG + Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1185059491 22:48598853-48598875 CTGACTGAATATAAGTCAGGGGG + Intronic
949765057 3:7516965-7516987 CTGACTGTCCAGAGGGCAGGTGG - Intronic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950195326 3:11005456-11005478 CTCACTGAACCCAAGGAGGGAGG - Intronic
950249033 3:11448629-11448651 TTGACTGAAGAGAATGATGGAGG + Intronic
950575794 3:13831452-13831474 GTGGCCGAACAGAAGGAAGGTGG + Intronic
950720103 3:14876621-14876643 CTGGCTGAACAGAAGGTAGCTGG + Intronic
951074295 3:18370359-18370381 CTGATTTAACAGAGGGAAAGGGG - Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
955017491 3:55086650-55086672 TTCACTGAACAGCAGGAAAGAGG - Intergenic
962859295 3:139383929-139383951 CTGACTTAACAGAAGACAGATGG + Intronic
963825390 3:149947698-149947720 TTGACAGAACTGAAGGAAGATGG - Intronic
964849639 3:161081323-161081345 CTGCCTGCACAGAAGAAAGCGGG + Intergenic
965211330 3:165793328-165793350 CTGTCTGAAGAGATGGTAGGAGG - Intronic
967356512 3:188577926-188577948 CTTTCTGGAAAGAAGGAAGGCGG - Intronic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
971059993 4:22957093-22957115 CTGATTGGAGGGAAGGAAGGTGG + Intergenic
971907063 4:32739648-32739670 GTGACTGAGCTGAATGAAGGTGG + Intergenic
973550033 4:52025059-52025081 GTGAATGAAAAGAAGAAAGGAGG - Intronic
975395696 4:73870529-73870551 CCAACTGACCAGAAGGGAGGAGG + Exonic
975415170 4:74097741-74097763 CCAACTGACCAGAAGGAAGGAGG - Exonic
977911508 4:102542577-102542599 CTTACCTAAGAGAAGGAAGGAGG - Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
980912169 4:139003749-139003771 GTGACTGAACAGCAAAAAGGAGG + Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
984887021 4:184458112-184458134 CTGACTGGCCGGAAGGAGGGAGG - Intronic
984938401 4:184909880-184909902 CTGAATGCAAAGAAGGAATGAGG - Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986214426 5:5705692-5705714 CTCACAGAGCAGAAGGAATGAGG + Intergenic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989996552 5:50839872-50839894 CTGACTGAAAAGAGTGATGGGGG + Intronic
990757155 5:59086306-59086328 CTGACAGAGCAGAAAGGAGGAGG - Intronic
992721371 5:79564607-79564629 CTTACAGGACGGAAGGAAGGGGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
996341153 5:122440443-122440465 CTGACTGAAATGAATGAAAGAGG - Intronic
996786741 5:127245334-127245356 CTGACAAAACACAAGGAATGGGG + Intergenic
997532719 5:134592144-134592166 CTGACTGACCAGAGGCAAGGAGG + Intergenic
998268470 5:140684930-140684952 CTGACTGAATAGAAGACAGCAGG + Intronic
999199305 5:149804751-149804773 GCGACTGAACAGTGGGAAGGTGG + Intronic
1000572529 5:162932977-162932999 CTGACTGAAAAGAACAAAGCTGG - Intergenic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1001815311 5:174663824-174663846 CTGAAATAAAAGAAGGAAGGAGG - Intergenic
1002633887 5:180597767-180597789 CTCACTGAACAGACTGAAGCAGG - Intergenic
1003285109 6:4727551-4727573 GTGACTGAACAGAGAGAGGGAGG - Intronic
1009733820 6:67648126-67648148 CTGACTGATCAGAGAGATGGTGG - Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011082667 6:83506948-83506970 GTGACTGAACATAAGGAGTGAGG - Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1013157176 6:107504217-107504239 CCCACTGAAAAAAAGGAAGGAGG - Intronic
1014745120 6:125191791-125191813 CCCAATGAACAGAAGGGAGGGGG - Intronic
1015026522 6:128539605-128539627 CTGATGGAACAGAAGGCAGTTGG + Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015551829 6:134419985-134420007 CTTACAGAACAAAAGGAAAGGGG + Intergenic
1015574102 6:134652578-134652600 CTGACTCAACAGAGAGTAGGGGG - Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1016087751 6:139935791-139935813 CTGAAGGCACTGAAGGAAGGAGG - Intergenic
1016547363 6:145239132-145239154 ATGACAGAAAAGAAGGAGGGAGG - Intergenic
1017154830 6:151313665-151313687 CTGACTTAACAAAAGGAGTGAGG + Intronic
1017865771 6:158441991-158442013 ATAACTGAAAAGCAGGAAGGGGG - Intronic
1019224474 6:170498780-170498802 ATGCGTGAACAGAATGAAGGGGG + Intergenic
1019464055 7:1176775-1176797 CTGACTCATCAGAAGCCAGGTGG - Intergenic
1020133785 7:5574683-5574705 CTAAGGGAAGAGAAGGAAGGAGG + Intergenic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1022746523 7:33178381-33178403 CTGAGTGGACACAATGAAGGTGG - Intronic
1022759841 7:33336017-33336039 CTGGCTGAAGACCAGGAAGGAGG - Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1024013676 7:45292359-45292381 TTGACAGCACAGAAAGAAGGTGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024374067 7:48618185-48618207 CTGACTGAACCGACAGAGGGTGG - Intronic
1026481760 7:70785603-70785625 CTAACAGAACAGAAAGGAGGTGG - Intronic
1029243922 7:99184770-99184792 TTGCCTGAAAAAAAGGAAGGGGG - Intronic
1029282620 7:99446134-99446156 CTGACTGGACAGTGTGAAGGTGG - Intronic
1030102204 7:105956356-105956378 CTGACTGGATGGATGGAAGGAGG + Intronic
1030241672 7:107332836-107332858 AACACTGAAAAGAAGGAAGGAGG + Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1032930033 7:136655636-136655658 TTGACTGAACAGAGGAAATGAGG - Intergenic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1034060731 7:148085724-148085746 CAGACTGACAGGAAGGAAGGAGG - Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034431287 7:151042461-151042483 CAGACTGAACAGAAGAAATGGGG + Intronic
1035057715 7:156046994-156047016 CAGACAGAAATGAAGGAAGGGGG + Intergenic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037843559 8:22262912-22262934 CAGACTGAACAGACGGGCGGTGG - Intergenic
1038621190 8:29144581-29144603 CTGGCTGAATATAAGGTAGGAGG - Intronic
1038636233 8:29289519-29289541 CTCCCTTCACAGAAGGAAGGTGG - Intergenic
1038646818 8:29368994-29369016 CTGTCTGAACAACAGCAAGGAGG + Intergenic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1040425527 8:47281261-47281283 CTGACTGATCAGATGGTTGGTGG + Intronic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1041731968 8:61071447-61071469 CTGACTGCATAGGAGGAAGTAGG - Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1044288224 8:90436236-90436258 CTTACAGTACAGAATGAAGGAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1047330571 8:123883312-123883334 CTGCCTCAAGAGAAGGAAGTGGG + Intronic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1048184441 8:132226726-132226748 CTGACTGAGCAGAAGAAAATGGG + Intronic
1048557741 8:135497018-135497040 CTGACTGAACCAAAAGAATGTGG - Intronic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049732040 8:144183502-144183524 CTGATTGATCAGAAGGATGCTGG - Intronic
1049785781 8:144450042-144450064 CTGACTGCACAGAAGGGCTGGGG + Exonic
1051015129 9:12465031-12465053 CTTACTGAAAAGGAGAAAGGGGG + Intergenic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1051867811 9:21700982-21701004 ATGATTGCTCAGAAGGAAGGGGG - Intergenic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1055865000 9:80802413-80802435 CTCACTGAACAGATGGAGGCAGG + Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056383227 9:86074545-86074567 GTGTCTGCACTGAAGGAAGGCGG + Intronic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1058613829 9:106804647-106804669 CTAACTGAACAGGAGAAAAGTGG - Intergenic
1058640686 9:107081058-107081080 CTGATTAAGCAGAAGGAAAGAGG + Intergenic
1059684922 9:116625814-116625836 CTTACTGAACTCTAGGAAGGAGG + Intronic
1060184091 9:121553293-121553315 CTTCCTGAACAGAAGGATGAGGG - Intergenic
1203790233 EBV:147518-147540 CTGACCCAACAGAAGCCAGGTGG - Intergenic
1186500207 X:10044888-10044910 CTGACTGGACAAAGGGATGGGGG - Intronic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1187334122 X:18366917-18366939 CTCACTGAACAGAAACAAGGGGG + Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1190025017 X:46914025-46914047 CAGACTGAACACAGGGAATGAGG - Intronic
1190915994 X:54811525-54811547 CTGACTGAAGAGATGCCAGGTGG - Intronic
1192936861 X:75869565-75869587 CTGAAGGAAAAGAAGGAACGAGG - Intergenic
1193189158 X:78548960-78548982 ATGACTGAACAATAGGAAAGTGG + Intergenic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1193848690 X:86508029-86508051 CTGACAGAACAGGAGAAGGGTGG + Intronic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1195630432 X:107050275-107050297 CTGACTAAACTGAATTAAGGAGG + Intergenic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1198178215 X:134175940-134175962 CTCACTAAACAGAATGGAGGCGG + Intergenic
1199427304 X:147717775-147717797 GTGACTGGACAGATAGAAGGGGG - Intergenic
1200239166 X:154484862-154484884 TTTACTGAACAGAAGGGAGAGGG + Exonic
1200367664 X:155684379-155684401 CCGTCAGAACAGAAGGAAAGGGG + Intergenic
1201147286 Y:11072259-11072281 TTAAATGAACAGAAGGAAGCCGG - Intergenic
1201888491 Y:18915177-18915199 CTAACTGAAAAGAACAAAGGTGG + Intergenic