ID: 1165895625

View in Genome Browser
Species Human (GRCh38)
Location 19:39139354-39139376
Sequence CCCGCTGGGTACCCCGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165895625_1165895636 9 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895636 19:39139386-39139408 TCGGGACCTGGGCTCCAAGGAGG 0: 1
1: 0
2: 2
3: 10
4: 154
1165895625_1165895643 21 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895643 19:39139398-39139420 CTCCAAGGAGGGGGCTGGGAAGG 0: 1
1: 1
2: 8
3: 61
4: 590
1165895625_1165895634 -2 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895634 19:39139375-39139397 GGATAAAGGGTTCGGGACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1165895625_1165895637 10 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895637 19:39139387-39139409 CGGGACCTGGGCTCCAAGGAGGG 0: 1
1: 0
2: 3
3: 22
4: 224
1165895625_1165895633 -3 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895633 19:39139374-39139396 GGGATAAAGGGTTCGGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1165895625_1165895639 12 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895639 19:39139389-39139411 GGACCTGGGCTCCAAGGAGGGGG 0: 1
1: 0
2: 3
3: 45
4: 384
1165895625_1165895644 22 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895644 19:39139399-39139421 TCCAAGGAGGGGGCTGGGAAGGG 0: 1
1: 0
2: 10
3: 52
4: 562
1165895625_1165895635 6 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895635 19:39139383-39139405 GGTTCGGGACCTGGGCTCCAAGG 0: 1
1: 0
2: 0
3: 29
4: 192
1165895625_1165895638 11 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895638 19:39139388-39139410 GGGACCTGGGCTCCAAGGAGGGG 0: 1
1: 1
2: 2
3: 34
4: 383
1165895625_1165895642 17 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895642 19:39139394-39139416 TGGGCTCCAAGGAGGGGGCTGGG 0: 1
1: 0
2: 5
3: 48
4: 434
1165895625_1165895629 -10 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895629 19:39139367-39139389 ACCCAGCGGGATAAAGGGTTCGG 0: 1
1: 0
2: 0
3: 2
4: 67
1165895625_1165895631 -9 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895631 19:39139368-39139390 CCCAGCGGGATAAAGGGTTCGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1165895625_1165895641 16 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895641 19:39139393-39139415 CTGGGCTCCAAGGAGGGGGCTGG 0: 1
1: 0
2: 6
3: 72
4: 581
1165895625_1165895646 23 Left 1165895625 19:39139354-39139376 CCAGTGTCGGGGTACCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1165895646 19:39139400-39139422 CCAAGGAGGGGGCTGGGAAGGGG 0: 1
1: 2
2: 6
3: 104
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165895625 Original CRISPR CCCGCTGGGTACCCCGACAC TGG (reversed) Intronic
900287552 1:1908874-1908896 CCCGCAGGGTGCCCCGACCGCGG - Intergenic
902282503 1:15384668-15384690 CCAGCTGGGGACGCTGACACAGG - Intronic
905106124 1:35564578-35564600 CCAGCAGGGTACCCCGTCATGGG + Intronic
912097136 1:106159639-106159661 CCTGATGGGTACCCAGACAGGGG - Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1072638900 10:97196278-97196300 CCGGCTGGGTTCGCGGACACTGG + Intronic
1076063361 10:127430086-127430108 CCCGCTGGCCACCCAGACCCGGG + Intronic
1083296379 11:61717720-61717742 CCTGCTGGGTACCCAGTGACAGG - Intronic
1085250352 11:75139496-75139518 CCCACTGGGAGCCCAGACACTGG - Intronic
1085307025 11:75492273-75492295 CCAGCTGGGTGACCTGACACAGG - Intronic
1088750494 11:112838456-112838478 CCCACTGGGTGCCCTCACACTGG - Intergenic
1101501813 12:105311191-105311213 CCTGGTGGGTACCCAGACAGGGG - Intronic
1104425858 12:128677642-128677664 CCCCCTGGGTGCCCCCACCCTGG + Intronic
1104665530 12:130644876-130644898 CCCACTGGGTTTCCCCACACAGG + Intronic
1104950908 12:132439474-132439496 CACTCTGGGTTCCCCAACACTGG - Intergenic
1104954312 12:132457019-132457041 CCCGCCCGGTAACCCGACACAGG - Intergenic
1104983204 12:132583020-132583042 CCCGCTGGCCACCCCGTCAGCGG + Exonic
1105528725 13:21199348-21199370 CCCTCTGGGTACCCAGTCCCAGG + Intergenic
1112322048 13:98416747-98416769 CCAGCTGGGTTCCCCGAGACAGG + Intronic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1118718081 14:68574556-68574578 CCCTCTGGGTGCCCCTATACAGG - Intronic
1122138041 14:99645817-99645839 CCACCTTGGTACCCCGACAAGGG - Intronic
1128633429 15:69287587-69287609 CCTGCTGGGTCCCCAGACCCTGG - Intergenic
1129838250 15:78727356-78727378 CGGGCTGGGTCCCCCCACACTGG + Intronic
1136451132 16:30354920-30354942 CCCTCTGGATCCCCCGACCCTGG + Intronic
1140456581 16:75109283-75109305 CCCGCTGGGCACGGGGACACAGG - Exonic
1142266642 16:89067003-89067025 CCCGCCTGGTCCCCCGACCCTGG + Intergenic
1152345409 17:79748104-79748126 CCCACTCGGGACCCCGACGCGGG + Intergenic
1153523995 18:5977887-5977909 GCCCCTGGGTACCCTGCCACTGG + Intronic
1161265098 19:3360141-3360163 CCCGCGGGGTGCCCCGGCCCGGG + Intronic
1162079169 19:8208734-8208756 CACCCTGGGTACCCCGAGTCTGG - Intronic
1162417493 19:10546920-10546942 CCCGCTGGATGCCCCCACGCTGG + Exonic
1165895625 19:39139354-39139376 CCCGCTGGGTACCCCGACACTGG - Intronic
1202714897 1_KI270714v1_random:36733-36755 CCCGCTGTGTACACCGCCATGGG - Intergenic
933809203 2:86021931-86021953 CCTGCTGGGTACCTCAACCCAGG + Exonic
935142419 2:100365087-100365109 CCTGGTGGGTACCCAGACAGGGG + Intergenic
937293689 2:120797384-120797406 GCCGCTGGCTTCCCCGACCCGGG + Exonic
937727592 2:125186128-125186150 CCTGCTGGGAACCCTTACACAGG - Intergenic
944920624 2:204409185-204409207 CCCCATGGGAACCCCCACACTGG + Intergenic
949039783 2:241842910-241842932 CCCGCTGGCTCCCCCGACCCCGG + Intergenic
1168800627 20:642002-642024 CCCGCTGGGCACCCCCCCCCAGG - Intergenic
1168800722 20:642195-642217 CCCGCTGGGCACCCCCCCCCAGG - Intergenic
1183333629 22:37234540-37234562 CCCGCTGTGGTCCCCCACACAGG + Intronic
950215197 3:11154228-11154250 CCCGCTGGGTACCCGGGCTCGGG - Intronic
968425740 4:522116-522138 GCCTCTGGGTGTCCCGACACAGG + Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
984757434 4:183337518-183337540 CCAGCTGGGTGCCCCCAGACAGG - Intergenic
997125704 5:131224921-131224943 CCTGCTGGGCACCCCCACATGGG - Intergenic
998129072 5:139642280-139642302 CCCGCTAGGTGCCACGACAGAGG - Intergenic
998150794 5:139756383-139756405 CCTGGTGGGTGCCCCGACCCCGG - Intergenic
1011921076 6:92577732-92577754 CCCCCTGGGCACTCCAACACAGG - Intergenic
1017962525 6:159233949-159233971 CCTGCTGGGTACCCGGGCGCGGG - Exonic
1022913022 7:34918693-34918715 CCAGCTGGGGATCCTGACACAGG - Intergenic
1023951209 7:44847792-44847814 CCAGCTGCGGAGCCCGACACGGG - Intronic
1029278260 7:99420335-99420357 CCCGCTGGGTACCCTGGGGCAGG + Intronic
1038039775 8:23714855-23714877 CCCGCAGGGAACCGCGACCCGGG - Intergenic
1041050036 8:53925428-53925450 CCTGCTGGGAACCCTGCCACAGG - Intronic
1048275927 8:133065915-133065937 CCCGCTGGAAACCCAGACCCGGG - Intronic
1059026612 9:110640821-110640843 CCCACTGGGCACCCAGCCACAGG - Intergenic
1187503922 X:19863643-19863665 CCAGCTGGGGACCCCGTCCCAGG - Intronic
1187508594 X:19897499-19897521 CACGCTGGGGACCCCGCCCCAGG + Intergenic
1190756661 X:53407356-53407378 CCCTCCAGGTACCCCCACACAGG - Intronic
1191125201 X:56946986-56947008 CCTGGTGGGTACCCAGACAGGGG - Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202342968 Y:23888769-23888791 CCTGATGGGTACCCCAATACTGG - Intergenic
1202527800 Y:25781316-25781338 CCTGATGGGTACCCCAATACTGG + Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic