ID: 1165900341

View in Genome Browser
Species Human (GRCh38)
Location 19:39166749-39166771
Sequence CCGTGCCAGGCCTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 298}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165900341_1165900350 2 Left 1165900341 19:39166749-39166771 CCCTCTTCCCAGGCCTGGCACGG 0: 1
1: 0
2: 5
3: 29
4: 298
Right 1165900350 19:39166774-39166796 TCTGTGGCCCCCATGAGGTCAGG 0: 1
1: 0
2: 5
3: 21
4: 274
1165900341_1165900355 14 Left 1165900341 19:39166749-39166771 CCCTCTTCCCAGGCCTGGCACGG 0: 1
1: 0
2: 5
3: 29
4: 298
Right 1165900355 19:39166786-39166808 ATGAGGTCAGGAGCATCTGTTGG 0: 1
1: 0
2: 3
3: 10
4: 182
1165900341_1165900357 19 Left 1165900341 19:39166749-39166771 CCCTCTTCCCAGGCCTGGCACGG 0: 1
1: 0
2: 5
3: 29
4: 298
Right 1165900357 19:39166791-39166813 GTCAGGAGCATCTGTTGGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 215
1165900341_1165900348 -3 Left 1165900341 19:39166749-39166771 CCCTCTTCCCAGGCCTGGCACGG 0: 1
1: 0
2: 5
3: 29
4: 298
Right 1165900348 19:39166769-39166791 CGGCCTCTGTGGCCCCCATGAGG 0: 1
1: 0
2: 1
3: 18
4: 201
1165900341_1165900358 20 Left 1165900341 19:39166749-39166771 CCCTCTTCCCAGGCCTGGCACGG 0: 1
1: 0
2: 5
3: 29
4: 298
Right 1165900358 19:39166792-39166814 TCAGGAGCATCTGTTGGGAAGGG 0: 1
1: 0
2: 3
3: 19
4: 247
1165900341_1165900356 15 Left 1165900341 19:39166749-39166771 CCCTCTTCCCAGGCCTGGCACGG 0: 1
1: 0
2: 5
3: 29
4: 298
Right 1165900356 19:39166787-39166809 TGAGGTCAGGAGCATCTGTTGGG 0: 1
1: 0
2: 1
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165900341 Original CRISPR CCGTGCCAGGCCTGGGAAGA GGG (reversed) Intronic
900612141 1:3548737-3548759 GTGTTCCAGGCCTGGGAAGCTGG - Intronic
900985314 1:6069754-6069776 CGCTGCCAGGCCTCGGGAGAAGG - Intronic
901639945 1:10688074-10688096 CCGTACCAGGCCCGGGGAGGAGG + Intronic
902177894 1:14665034-14665056 CAGTCCCATGCCTGGGCAGAAGG - Intronic
902203734 1:14852404-14852426 CGGTGCCAGGCCTGCGAATGAGG + Intronic
905489907 1:38335216-38335238 CCTTGCCAGTCCTGGGAGGGGGG - Intergenic
905544152 1:38784412-38784434 CTGTGACAAGACTGGGAAGAGGG + Intergenic
906309007 1:44739709-44739731 CGGTGCCAAGCGTAGGAAGATGG + Intergenic
911044284 1:93615893-93615915 CCATCCCAGGCCTGAGAAAAGGG + Intronic
911055001 1:93701683-93701705 CAGGGGCAGGCCTGGGAAGCAGG - Intronic
911417617 1:97595120-97595142 CTGCGTCAGGCCTTGGAAGATGG + Exonic
911546004 1:99217752-99217774 CCGTGGCTGGAGTGGGAAGATGG + Intergenic
914765265 1:150631760-150631782 CCGTGCCCGGCCTGAAAACATGG + Intergenic
914845888 1:151283198-151283220 CCGCGCCAGCCCTCGGCAGATGG + Intronic
914899304 1:151703393-151703415 CGGGGCCAGTCGTGGGAAGAGGG + Exonic
915824600 1:159061693-159061715 CCGTGCCTGGCCTGGATACAGGG + Intergenic
915916065 1:159941745-159941767 CCCTCCCAGGCCTGGGCAGGCGG + Intronic
919839207 1:201597114-201597136 CCGTGCCTGGCCTGGCAGGGTGG + Intergenic
920046347 1:203135178-203135200 CTGTGCCAGGCATGGGGAAATGG - Intronic
920078499 1:203354622-203354644 CCAAGGCAGGCCTGGGATGAAGG + Intergenic
920703524 1:208235438-208235460 TGGAGCCAGGCCCGGGAAGAGGG - Intronic
920840731 1:209551635-209551657 TCCTGCCAGGGCTGGGATGAGGG + Intergenic
921138217 1:212282089-212282111 TCATGCCAGCCCTGTGAAGAAGG + Intergenic
921149128 1:212385875-212385897 AGGTGCCTGGGCTGGGAAGAGGG - Intronic
921440742 1:215182798-215182820 CTGTCCCAGGTCTGGGAAAATGG + Intronic
922167704 1:223129505-223129527 CCGTGTCAGGCCCGCGAGGAGGG + Intronic
924009049 1:239644343-239644365 CAGAGCCAGGGGTGGGAAGACGG - Intronic
924107812 1:240667092-240667114 CCGTGCCCGGCCTGAGGAGCTGG - Intergenic
1064331220 10:14396134-14396156 CAGTGCCATGCCTAGGAAAATGG + Intronic
1065486559 10:26241473-26241495 CTGTGCCAAGCCTGGGATCAGGG - Intronic
1067682745 10:48450865-48450887 CCGGTGCAGCCCTGGGAAGAAGG - Exonic
1067763997 10:49071558-49071580 CAGTGCCAGGCTTGGGGTGAGGG + Intronic
1069660059 10:70117582-70117604 CCGTCCCTGGGCAGGGAAGAGGG - Intronic
1069869471 10:71524424-71524446 CCCTGCCAGGCCGTGGGAGAAGG + Intronic
1070786313 10:79164165-79164187 GTGGGCCAGCCCTGGGAAGAAGG - Intronic
1071405215 10:85323396-85323418 CCTTGCCAGTGCTGGGATGAGGG + Intergenic
1071598686 10:86945519-86945541 CCGCTCCAGGCCTGGGCAAATGG + Intronic
1072660362 10:97360145-97360167 CGGTGCCAGGGCTGGGAACTGGG - Intronic
1073233053 10:101988992-101989014 CAGTGCCAGGCCTGGGATCTAGG - Intronic
1074358694 10:112807910-112807932 CCATGCCCAGCCTGGAAAGAAGG - Intronic
1074413804 10:113249728-113249750 CCAGGCCAGGCCTGGGGAGGTGG - Intergenic
1075736307 10:124666643-124666665 CCGGGGCAGGGCTGGGGAGATGG - Intronic
1075946013 10:126433608-126433630 TTGCGCCAGGCCGGGGAAGATGG - Intronic
1075954033 10:126506987-126507009 CAGAGTCAGGCATGGGAAGATGG + Intronic
1076289788 10:129336314-129336336 CAGTGCCTGGCCTCTGAAGAGGG - Intergenic
1076895270 10:133308549-133308571 CCCTCCCAGCCCTGGGAAGCCGG - Exonic
1076915697 10:133422268-133422290 CTGTTCCAGGCCTCGGAACAGGG - Exonic
1077368391 11:2170509-2170531 CCGTCCCAGGCCTGGACAGAGGG + Intronic
1077850273 11:6069332-6069354 CGGTGAGAGGGCTGGGAAGATGG + Intergenic
1081862624 11:46342180-46342202 ATGTGCCAGCCCTGGGAAGCTGG - Intronic
1084212879 11:67631942-67631964 CCAGGGCAGGCCTGGGATGAGGG - Intronic
1084558976 11:69892138-69892160 CCGGGCCTGGCCAGAGAAGAGGG + Intergenic
1084946412 11:72641310-72641332 CCATGCCATGCCTGAGAACATGG + Intronic
1085413687 11:76306635-76306657 CCAGGCCAGGCCTGGCATGAAGG - Intergenic
1085519280 11:77128653-77128675 CTGTCCCGAGCCTGGGAAGATGG + Intronic
1087818357 11:102683594-102683616 CCCTTCCAGGGCTGGGAACAGGG - Exonic
1087838752 11:102901023-102901045 CAGTCCCAGGCCTGGGTAGCTGG + Intergenic
1088675065 11:112184541-112184563 CTGTGCCTGGCCTGGGAATGAGG + Intronic
1090387125 11:126363868-126363890 CGGTGCCGGGCCTGGGAGGGTGG - Intronic
1092728470 12:11507095-11507117 CCGAGGCCAGCCTGGGAAGAGGG + Intergenic
1092982130 12:13807224-13807246 CCGTGGCAGGTTTGGGCAGAAGG - Intronic
1094441712 12:30485427-30485449 CTGTGGCAGGGCTGGGAAAATGG - Intergenic
1096464551 12:51841090-51841112 CCCCCCCAGGGCTGGGAAGAGGG - Intergenic
1096707866 12:53433941-53433963 CCCTGCCAGGCCTAGGAAGAAGG - Intergenic
1096871310 12:54594118-54594140 CTCTGCCAAGCCTGGGAGGACGG - Intergenic
1100860736 12:98803686-98803708 CAGGGCCAGGGCTGGGAACAGGG + Intronic
1102084380 12:110124253-110124275 CCGGGCCAGGGCGGGGAGGACGG - Intergenic
1102520294 12:113473845-113473867 CAGTGCTAGGCCTGAGAGGAAGG - Intergenic
1102976158 12:117208452-117208474 CCGTTCCGGGCTTGGGAAGCTGG - Exonic
1103008185 12:117438549-117438571 CAGGGCCTGGCCTGGGGAGATGG - Intronic
1103038684 12:117677033-117677055 TGATGCCAGGCCTGGGAAGCAGG + Intronic
1103405058 12:120669164-120669186 CCCTGCCAGGTCTGAGAATAAGG - Intergenic
1103913918 12:124366416-124366438 GGGTGCCAGGGCTGGGAGGAGGG + Intronic
1104435022 12:128748824-128748846 CCGTGCAGGGCCTGTGAAGTGGG + Intergenic
1104920829 12:132289878-132289900 CCGTCCCAGGACTGTGCAGATGG + Intronic
1104990349 12:132620913-132620935 CAGTCCCAGGCCAGGGAAGGGGG - Intronic
1105532911 13:21236383-21236405 CCGTTCCAGACCTGGAAAGTGGG + Intergenic
1109786182 13:67177997-67178019 CCATGCCAGGCTTGGGCAGTTGG - Intronic
1113071303 13:106423893-106423915 CTGTGGAAGGCCTGGGAAGTAGG + Intergenic
1113135614 13:107085793-107085815 CCTGGGCAGTCCTGGGAAGAAGG - Intergenic
1113647753 13:112011111-112011133 TGGGGCCAGGCCTGGGCAGAGGG - Intergenic
1118838857 14:69496226-69496248 CTGTGCCAGGGCTGGGAAGTGGG - Intronic
1119459646 14:74789502-74789524 GCTTGCCAGGCCAGGGATGATGG - Intronic
1119725281 14:76918497-76918519 ACCTGGCAGGCCTGGGGAGAAGG + Intergenic
1121323553 14:93006826-93006848 CAGTGGCAGGCCTGGAAAAAGGG - Intronic
1121483363 14:94295028-94295050 CCGTGCCTGGCCAGGGCACAGGG + Intergenic
1121568405 14:94927867-94927889 CCTGGTCAGGGCTGGGAAGAGGG + Intergenic
1122070149 14:99200833-99200855 CTGTGCCAGGCCTCGGGGGAGGG - Intronic
1122347503 14:101069654-101069676 GCGTGTCTGGCCTGGGGAGAGGG + Intergenic
1122944393 14:104999484-104999506 GCATGCCAGCCCTGGGAGGAGGG + Intronic
1123049163 14:105532323-105532345 CTGTGGCAGGGCTGGGAAGCAGG + Intergenic
1124851185 15:33340254-33340276 CAGTGCCAGACCTGTGCAGAGGG + Intronic
1125919542 15:43517541-43517563 CGGCGCCAGGGCGGGGAAGAGGG - Intronic
1126112648 15:45184870-45184892 CCCTGCCAGGCCTGCCCAGATGG + Intronic
1128317580 15:66670979-66671001 ACGTTCCAGGAATGGGAAGAAGG + Intronic
1128358684 15:66945583-66945605 CCCTGCCAGCACTGGGAAGCAGG + Intergenic
1128512830 15:68324173-68324195 CTGTGGGAGGCCTGGGGAGAGGG + Intronic
1128905680 15:71465911-71465933 GAGTGAAAGGCCTGGGAAGAAGG + Intronic
1129051305 15:72783865-72783887 CAGTGCCAGGCCTGGGACTGAGG - Intronic
1132016362 15:98320819-98320841 CCGTGCCAGGCGTGGGGAGGTGG + Intergenic
1132300317 15:100771280-100771302 CCATTCCACACCTGGGAAGAGGG - Intergenic
1132603921 16:785801-785823 CCCGGCCAGGCCTGCGAGGAAGG - Exonic
1132615367 16:838894-838916 CCAGACGAGGCCTGGGAAGATGG + Intergenic
1132733968 16:1376434-1376456 GTGTGCCAGCCCTGGAAAGAGGG - Intronic
1133343624 16:5055404-5055426 CCGTGGCAGCCCTGGGGAGTGGG - Intronic
1135533570 16:23275312-23275334 CTGTGCCAGACTTGGGAAGATGG + Intergenic
1136235037 16:28908540-28908562 CTCTGCCCTGCCTGGGAAGAAGG + Intronic
1136570457 16:31093625-31093647 CCGGGCCTGGTCTGGGGAGAGGG - Intronic
1137686483 16:50390438-50390460 CTGGGCAAGGCCTGGGCAGATGG - Intergenic
1141153996 16:81584143-81584165 ACAAGCCAGGCCTGGGAAGACGG + Intronic
1141701558 16:85644638-85644660 GCGTGCGGGGCCTGGGGAGACGG + Intronic
1141870155 16:86779775-86779797 CCGGGGCAGCCCCGGGAAGACGG + Intergenic
1141996718 16:87640805-87640827 CCGTGCCAGGGCTGTGGACAGGG - Intronic
1142127869 16:88419209-88419231 CCGTGCCAAGCCACGGAAGGGGG + Intergenic
1142159586 16:88550210-88550232 CCACGCCAGGCCAGGGGAGAGGG + Intergenic
1142890183 17:2938055-2938077 CGGAGCCAGGGCTGGGAGGAAGG + Intronic
1143301079 17:5911114-5911136 CCTTGCCAGGACTGGGCTGATGG - Intronic
1144891587 17:18497302-18497324 CAATGCCAGGCCTGGCAAGTGGG - Intergenic
1145140634 17:20447015-20447037 CAATGCCAGGCCTGGCAAGTGGG + Intergenic
1146287932 17:31586917-31586939 TGGTGGCAGGCCTGGGAAGGGGG - Intergenic
1146599868 17:34205008-34205030 CAGTGCCAGGCATGGGGAGAAGG - Intergenic
1146935990 17:36813058-36813080 CCCAGCCGTGCCTGGGAAGAAGG + Intergenic
1147131252 17:38410645-38410667 CTGTGCCAGGCCCTGGAAGTGGG - Intergenic
1147260380 17:39206655-39206677 CTGGGCCAGGCCTGGGAAGCAGG - Intergenic
1147263798 17:39223536-39223558 GGGTCCCTGGCCTGGGAAGAGGG + Intronic
1147312064 17:39601320-39601342 CTGTGCCTGGCCTGGGGAGAAGG - Intergenic
1147976307 17:44250139-44250161 CCCTGCCTGTGCTGGGAAGAGGG + Exonic
1147981600 17:44278140-44278162 CCGTCCCAGGGCTGTTAAGAGGG + Intergenic
1148580257 17:48738615-48738637 CAGTGCAAGGCCGGGGAGGATGG - Intergenic
1148740860 17:49891452-49891474 CCATGCCAGGCCCAGGAAGTGGG + Intergenic
1149300792 17:55303257-55303279 CCATGGCAGCCCTGGGAGGAGGG + Intronic
1149532078 17:57403457-57403479 GAGTGCCATGCCAGGGAAGATGG - Intronic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1150847806 17:68677226-68677248 TAGTGCCAGGTTTGGGAAGAGGG - Intergenic
1151508076 17:74542337-74542359 CCTGGCCAGGCCAGGGAAGGGGG - Intronic
1151624039 17:75265572-75265594 CCTGGTCAGGCCTGGGGAGAAGG - Intronic
1151648722 17:75452135-75452157 CCGCGCCCGGCCTAGGCAGAAGG + Intronic
1151659273 17:75510067-75510089 CAGCGCCAGGCCCGGGAAGAAGG - Intronic
1151692829 17:75697382-75697404 CTATTCCAGGGCTGGGAAGAAGG + Intronic
1151829666 17:76542232-76542254 CCAGGCCAGGCCTGGCCAGATGG - Intronic
1152025280 17:77804921-77804943 GCGTGGCAGGCCTGGTCAGAGGG - Intergenic
1152161418 17:78670887-78670909 GCGGGCCAGGCCTGTGATGAAGG + Intergenic
1152457135 17:80422987-80423009 CCGCGCCCGGCCTAGGGAGATGG + Intronic
1152472682 17:80499174-80499196 CCCTGCCAGGGGTGGGAAGCAGG - Intergenic
1152474389 17:80508642-80508664 CTGTGCAAGGCCTAGGATGATGG - Intergenic
1153075989 18:1162217-1162239 TCTTGTCAGGCCTGGTAAGATGG - Intergenic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1153529711 18:6032714-6032736 GCTTGCCAGGGCTGGGAGGAGGG - Intronic
1155261729 18:24050043-24050065 GCCAGCCAGGCCTGGGAAGAAGG - Intronic
1155326683 18:24671741-24671763 CCGTGCCAGGGCTGAGAGGCTGG + Intergenic
1157204844 18:45689182-45689204 ACGTGCCAGGCCTGGAATGGGGG - Intergenic
1157209087 18:45725936-45725958 CGGTGCCAGGCAGGGGCAGAAGG + Intronic
1157557369 18:48621628-48621650 CACTGCCAGGCCAGGTAAGAGGG + Intronic
1158782057 18:60663494-60663516 CTGTGCCAGGCATGGCCAGAAGG + Intergenic
1160834212 19:1116988-1117010 ACCTGCCAGGCCTGGGGTGATGG + Intronic
1161354849 19:3813341-3813363 ACCTGCCAGGCCTGGGAGGGTGG - Intronic
1161759436 19:6160451-6160473 CCGTGCTAGGTATGGGTAGAGGG + Intronic
1161854906 19:6758751-6758773 CCGTGCAGGGCCTGGGATGCAGG + Intronic
1162029160 19:7909947-7909969 CCGTGCCAGCCCTGGGAGGAGGG + Intronic
1162143107 19:8596402-8596424 CGGGGCCAGGCCTGGGAAGACGG + Exonic
1162460308 19:10810672-10810694 CCGGGCCAGGCCTAGGAGTATGG + Intronic
1162479338 19:10919698-10919720 CTGAGCCAGGCCTGGGAGGATGG - Intronic
1163039087 19:14589133-14589155 CCTTGCCAGGTTTGGGAAGGGGG - Intronic
1163270091 19:16247848-16247870 GCGGGACAGGCCTGGGAAGAGGG + Intergenic
1163550033 19:17961284-17961306 CTGTGCCTGGCCTGGAAACAAGG - Intronic
1163552116 19:17971284-17971306 ATGTGCCAGGCCTGGGAGAAGGG - Intronic
1163702949 19:18795657-18795679 CCCGGCCAGGCTGGGGAAGAGGG + Intergenic
1163797479 19:19345853-19345875 CCCCGCCAGGCCCTGGAAGAAGG + Intronic
1165900341 19:39166749-39166771 CCGTGCCAGGCCTGGGAAGAGGG - Intronic
1166518696 19:43465215-43465237 CCGCGCCCGGCCTAGGAACAGGG + Intronic
1166855455 19:45780854-45780876 CCCTGCCAGGCCTGGGGCGGGGG - Intronic
1166999315 19:46736646-46736668 CGGAGCCTGGCCTGGGGAGAGGG - Intronic
1167356427 19:49007006-49007028 CTGCGCCATGCCTGGGAAGGAGG - Exonic
1167672055 19:50859120-50859142 TCTGGCCAGGCCTGGGAGGAGGG + Intronic
1167674800 19:50877533-50877555 CCTGCCCAGGCCTGGGAGGAGGG + Intronic
926148960 2:10414010-10414032 CCATGCAAGGCCTGGGGAGGAGG + Intronic
926592048 2:14750558-14750580 CCCTGCCAAGCCTGGGTGGAGGG - Intergenic
928651252 2:33405855-33405877 TTGTGCCAGCCCTGGGAATATGG + Intergenic
929831019 2:45346303-45346325 CAGTGCAGGGGCTGGGAAGAAGG - Intergenic
932172698 2:69572035-69572057 CCTGGCAAGGCCTGTGAAGAAGG + Intronic
932453474 2:71831140-71831162 AGGAGCCAGGCCTGGGTAGAAGG + Intergenic
932583340 2:73006882-73006904 CCCTGACAGGCCCAGGAAGAGGG + Intronic
932688683 2:73894411-73894433 ACATGCCAGGCCTGAGAAAAGGG + Intronic
933032428 2:77346974-77346996 CTGTCCCAGGGCAGGGAAGAGGG - Intronic
934617711 2:95785208-95785230 CCCAGCCACGCCTGGCAAGAGGG + Intergenic
934643182 2:96039351-96039373 CCCAGCCACGCCTGGCAAGAGGG - Intronic
936079651 2:109423609-109423631 CCCTGCCAGGCTTGGAACGAAGG + Intronic
936523435 2:113226920-113226942 ATGTAGCAGGCCTGGGAAGAAGG + Intronic
937449464 2:121989860-121989882 CTGGGCCAGCCCTGGGAATAGGG + Intergenic
941885675 2:170524773-170524795 CCGTGCCTGGCCTGTGCTGAGGG + Intronic
942034960 2:172001803-172001825 GGGTGCCAGGCCTGGCAAGGTGG + Intronic
946153798 2:217793891-217793913 CAGGGCCAGACCTGGGAAGGGGG + Intergenic
948048964 2:234964946-234964968 TAGTGCCAGGGCTGTGAAGATGG - Intronic
948114144 2:235481301-235481323 CAGTGCCCGGCCTGGGCAGAGGG - Intergenic
948345902 2:237297887-237297909 CAGTCCCTGGCCTGTGAAGATGG - Intergenic
948519921 2:238529656-238529678 GCGTGGCAGGCAGGGGAAGAAGG + Intergenic
948591011 2:239050193-239050215 CCCTGCCAGGCCTTTGCAGAGGG + Exonic
1168827443 20:823254-823276 CTGTGCCAGCCCTGGGTAGAGGG + Intergenic
1169171765 20:3471089-3471111 CCGTCTCAGCCCCGGGAAGATGG + Exonic
1170422795 20:16209097-16209119 CCTTGCCAGGCCTGTGAAGTTGG + Intergenic
1171542911 20:25978216-25978238 CCCTGTGAGGCCTGGGATGAAGG + Intergenic
1172214283 20:33224044-33224066 AGGTGCAAGGCCTGTGAAGAGGG + Intronic
1172361605 20:34316566-34316588 CCATTCCAGGCCTGGGCAGAGGG + Intergenic
1172655116 20:36532128-36532150 CCGTGCCCGGCCTGGGTTTAGGG - Intergenic
1172865526 20:38094002-38094024 CAGTGCCACGACCGGGAAGATGG + Intronic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1175228937 20:57461329-57461351 AGGAGCCAGGCCTGGGATGAAGG + Intergenic
1175258167 20:57659225-57659247 CTGTGCAGGGCCTGGGGAGAGGG - Intronic
1175860843 20:62149243-62149265 GCCTGGGAGGCCTGGGAAGAGGG + Intronic
1176126991 20:63480016-63480038 CCGTGCGAGACCAGGGAAGAGGG - Intergenic
1176127007 20:63480079-63480101 CCGTGCGAGACCAGGGAAGAGGG - Intergenic
1176303842 21:5113373-5113395 CCGGGCCTGGCCGGGGAAGGTGG + Intergenic
1176380097 21:6108039-6108061 ACGGCCCTGGCCTGGGAAGAGGG - Intergenic
1178480518 21:32976031-32976053 CCTTCCCAAGCCTTGGAAGATGG - Intergenic
1178619010 21:34158257-34158279 CCGCGCCCGGCCTGGAAGGAGGG + Intergenic
1178917699 21:36717992-36718014 AAGTGCCAGGCTTGGGAAGTGGG + Intronic
1179557331 21:42188084-42188106 CTTTGCCAGGACTGGGAAGGAGG - Intergenic
1179743377 21:43430199-43430221 ACGGCCCTGGCCTGGGAAGAGGG + Intergenic
1179853188 21:44148577-44148599 CCGGGCCTGGCCGGGGAAGGTGG - Intergenic
1179892884 21:44345769-44345791 CAGAGCCAGGCCTGGGAGAAGGG + Intergenic
1180096189 21:45556150-45556172 CCGTTCCAGTCCCCGGAAGAGGG + Intergenic
1183417165 22:37689084-37689106 CACTGCCAGCCCTGGGAAGAAGG + Intronic
1183444962 22:37847450-37847472 CTGTGCCAGGCCTCGGAGAAGGG + Intronic
1183513677 22:38250791-38250813 CCGAGCCAGGGCTGGGATGTGGG + Intronic
1183722994 22:39573118-39573140 GAGTGCCAGGCCTGAGAAGGGGG + Intronic
1183739708 22:39662882-39662904 CAGGGCCAGGCCTGGGGTGAGGG + Intronic
950044562 3:9941218-9941240 CCTAGCTAGGTCTGGGAAGATGG + Intronic
950464979 3:13148341-13148363 CTGTGCCGGGCTTGGGGAGAGGG - Intergenic
950525448 3:13520301-13520323 CTGTGCCAGGCCTTGGGAGAGGG - Intergenic
953610187 3:44441198-44441220 CCATGGCAGGCCTGGCACGATGG - Exonic
953742197 3:45547573-45547595 TCCTTCCAGGCCTGGGATGAGGG + Exonic
953773070 3:45793582-45793604 CCGGGCCTGGCCTGGGGAGCAGG + Intronic
953890833 3:46750622-46750644 CCGTGCCTGGCCTTGGAGGCGGG - Intronic
953947601 3:47163439-47163461 CGGTGCCGGGCCCGGCAAGAGGG - Intronic
954142958 3:48619785-48619807 CCTTGCAGGGCCTGGGAAGAAGG + Intergenic
954419842 3:50412989-50413011 TCGTGCCAGGTGAGGGAAGATGG - Intronic
955327450 3:58020272-58020294 GGGTGCTAGGCCTGGAAAGAAGG - Intronic
961947996 3:130713960-130713982 CCGCGCCGGGCCTGGGATGAAGG + Intronic
965991784 3:174827863-174827885 GAGTCCCATGCCTGGGAAGAGGG - Intronic
966929016 3:184663814-184663836 CCCTGGCAGGCCTGGTCAGAGGG + Intronic
966984937 3:185171725-185171747 CAGTGCCAGGCCAGTGGAGATGG + Intergenic
967318983 3:188177275-188177297 CAGACCCAGGCCTGGGAAGGAGG + Intronic
968492621 4:898354-898376 CCGCTCCAGGCCTAGGCAGAGGG + Intronic
968968895 4:3783394-3783416 CTGTGCCAGGGCTGGGAGGGAGG + Intergenic
969601997 4:8182189-8182211 CCCTGCCAGGGAAGGGAAGAGGG - Intronic
970449623 4:16154155-16154177 CAGTGCCTGGGCTGGGAAGTGGG - Intergenic
972539885 4:40030105-40030127 CCGTGCCCAGCCTGGCAAGCAGG - Intergenic
976631107 4:87237140-87237162 CTGTGTCAGGCCTGAGAATATGG + Intronic
979649770 4:123115419-123115441 GCTTGCCAGGTCTGGGAAGCGGG + Intronic
983959190 4:173732027-173732049 CCGTGCCAGGCCTGGGATCAGGG - Intergenic
985761646 5:1752045-1752067 CCTCACCAGGACTGGGAAGAGGG - Intergenic
987121243 5:14769181-14769203 CGGTTCAAGGCCTGGGAAGGGGG + Exonic
988694578 5:33608185-33608207 CTGTGCCACACCTGGGAAGGAGG + Intronic
992407816 5:76476221-76476243 CAGAGGCAGGCCTGGGAGGAAGG + Intronic
997239383 5:132295354-132295376 TCCTGCCAGGCATGGGAGGAGGG + Intronic
997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG + Intergenic
997528240 5:134567075-134567097 CCGGGCCAGGGCAGGGTAGATGG + Intronic
998129274 5:139643195-139643217 GCCTGCCAGGCCTGGGAGGAGGG - Intergenic
999144214 5:149381838-149381860 CAGTGCCAGGCCTGAGAGGGAGG + Intronic
999317068 5:150591053-150591075 AGGTGCCAGGCCTGGGATGGGGG + Intergenic
1000128416 5:158270429-158270451 CTGTGCTAGGCCTTGGAATATGG - Intergenic
1000367660 5:160506095-160506117 CGTTCCCAGGCCAGGGAAGAGGG - Intergenic
1000608704 5:163351945-163351967 CAGTGGCAGGCCTAGGAGGAAGG + Intergenic
1001001125 5:168008163-168008185 CCGACCCAGACCTGGGAAGATGG + Intronic
1001562444 5:172678361-172678383 AGGTGTCAGGGCTGGGAAGATGG - Intronic
1001742737 5:174067534-174067556 CCCTGTCAGGCATGGGCAGAGGG + Intronic
1001997023 5:176170315-176170337 CTGTGCCAGGCCTTGGATGTGGG - Intergenic
1002361133 5:178671881-178671903 CTAAGCCTGGCCTGGGAAGAAGG + Intergenic
1002570554 5:180137243-180137265 CCCGGCCAGGACTGGGAAGGTGG + Intronic
1004075198 6:12338744-12338766 CCCTTCCAGGCATGGGAAGTAGG - Intergenic
1004290286 6:14360811-14360833 CCATAGCAGGCCTGGAAAGAAGG - Intergenic
1004712745 6:18187950-18187972 CAATGCCAGCCCTGGGAAGCTGG + Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006510377 6:34518132-34518154 CCCGGCCAGGCCCCGGAAGAGGG + Intronic
1007176528 6:39901481-39901503 CAGTGCCAGGCCTGGGACTGAGG + Intronic
1007254732 6:40520759-40520781 GCTAGCCAGGCCTGGGCAGAGGG - Intronic
1016559200 6:145375876-145375898 GCGTGCCAGTGCTGGGAGGAAGG - Intergenic
1019172010 6:170138034-170138056 CCGGGCGAGGCCTGGTAAGACGG - Intergenic
1020018980 7:4850794-4850816 CCGTGTGAGACCTGGGCAGAGGG + Intronic
1020082636 7:5295079-5295101 CCCAGCCAGGCCAGGAAAGATGG - Intronic
1022504775 7:30903209-30903231 CAGGCCCAGGCCTGTGAAGAAGG - Intergenic
1023826677 7:44014536-44014558 CTGTCCCAGGCCTGGGCACACGG + Intergenic
1023838490 7:44082283-44082305 GCGCGCCAGGCCTGTGAGGAAGG + Exonic
1023981678 7:45074090-45074112 CCGTGCCAGGTCTGGTAGGATGG + Intronic
1024292346 7:47813783-47813805 CAGTGCCGGGGCTGGGGAGAGGG - Intronic
1025030614 7:55553810-55553832 CGTTGCTAGGCCTAGGAAGAGGG - Intronic
1025093139 7:56079341-56079363 CTGTGCCAGTCCTGGGAGAAAGG - Intronic
1026852660 7:73734947-73734969 CCCTGCCAGGCCAAGGAGGAAGG - Intergenic
1027050557 7:75018891-75018913 GGGTGCAGGGCCTGGGAAGAGGG - Intronic
1027269644 7:76512601-76512623 CTCTGCAAGGCCTGGGAAGCGGG - Intronic
1027320354 7:77006495-77006517 CTCTGCAAGGCCTGGGAAGCGGG - Intergenic
1027950260 7:84806654-84806676 CTGTGCCAGGCCTGAGACAAGGG - Intergenic
1029109149 7:98203426-98203448 CGGCTCCAGGCCTGGGAGGACGG - Intronic
1029382491 7:100222779-100222801 GAGTGCAGGGCCTGGGAAGAGGG + Intronic
1029737836 7:102474291-102474313 CTGTCCCAGGCCTGGGCACACGG + Intronic
1029754966 7:102567940-102567962 CTGTCCCAGGCCTGGGCACACGG + Intronic
1029772916 7:102667020-102667042 CTGTCCCAGGCCTGGGCACACGG + Intronic
1029810049 7:103038146-103038168 CCGAGCCAGGCATGGGAGGGAGG - Intronic
1031890482 7:127288055-127288077 CCATTTCAGTCCTGGGAAGACGG - Intergenic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1034338653 7:150338938-150338960 TGGTGACAGGGCTGGGAAGATGG - Intronic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1034402307 7:150870846-150870868 CCTTTCTAGGCCTGGGAAGCTGG - Intergenic
1035107872 7:156457265-156457287 CCCTGACAGGCATGGGAAGAGGG + Intergenic
1037992154 8:23328653-23328675 GAGTGCCTGGCCTGGGAACAGGG - Intronic
1038459203 8:27702377-27702399 CAGTGCCAGGACTGGGCAGCGGG - Intergenic
1042226616 8:66519680-66519702 CCAGCCCAGGCCTGGGGAGATGG - Intergenic
1042347248 8:67740210-67740232 CCAGGCCAGTCCTGGGAAAAGGG + Intronic
1044519961 8:93187817-93187839 CCCTGGCAGGCATGGGAAAAAGG + Intergenic
1048967571 8:139625515-139625537 TCCAGGCAGGCCTGGGAAGATGG - Intronic
1049470708 8:142773991-142774013 CCACCCCAGGCCTGGGAAGCAGG - Intronic
1057532079 9:95857865-95857887 GGGTGCCAGGGCTGGGAAGAAGG - Intergenic
1057592402 9:96383691-96383713 CCCGGCCGGGCCGGGGAAGAGGG + Exonic
1058541839 9:106019816-106019838 CCTGGCCAAGCCTGGGAAGGAGG - Intergenic
1058843598 9:108934195-108934217 CGGTGCCAGGCCTACAAAGAAGG - Exonic
1058896965 9:109408898-109408920 GCGAGCGAGGCCTGGGAAGGGGG + Intronic
1059249025 9:112871655-112871677 CCGCCCCAGGCCTGGAAAGTGGG + Exonic
1059779288 9:117508874-117508896 CTGTGCCAGTCCTGGGTGGATGG + Intergenic
1059844079 9:118251682-118251704 GTGTGCCTGGCCTAGGAAGAAGG + Intergenic
1060191741 9:121598400-121598422 CCGGGCCAGGCCCGGGGTGAGGG - Intronic
1061000509 9:127899647-127899669 CCGGCCCAGGCCTGGGAGGTGGG + Intronic
1061585751 9:131567309-131567331 CCGCGCCCGGCCTGAGAAAAAGG - Intergenic
1061680516 9:132240658-132240680 CAGTGCCAGGGCGGGGAAGGTGG + Intronic
1062012290 9:134273645-134273667 GTGTGCCAGGCCTGGGTGGAGGG - Intergenic
1062463184 9:136670345-136670367 CTGTGCCTGGCCTGGGGAGGCGG + Intronic
1062468694 9:136692667-136692689 CCATGCCAGGCCTGGGCCGTGGG + Intergenic
1187165466 X:16800536-16800558 CCGAGCCAGGCCTGGAGAGGAGG + Intronic
1189714005 X:43845899-43845921 CGGTGACAGGGATGGGAAGATGG - Intronic
1192189820 X:68983893-68983915 CCATGCCAGGCCTGGGAATAAGG + Intergenic
1192543384 X:71993594-71993616 CCATGCCAGGCCTGGCCAGCTGG - Intergenic
1198881252 X:141283837-141283859 CTTTGCCAGGGCTGGGCAGAGGG - Intergenic
1200397257 X:155998516-155998538 GCGTGACAGCTCTGGGAAGAGGG - Intronic
1201038073 Y:9803028-9803050 CCCTTCCAGGCCTAGGATGAAGG + Intergenic