ID: 1165901929

View in Genome Browser
Species Human (GRCh38)
Location 19:39173250-39173272
Sequence TGCCGACATCAGGCCCGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165901929_1165901939 5 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901939 19:39173278-39173300 CAGCCTGCTGGTCTGGCCAGTGG 0: 1
1: 1
2: 6
3: 51
4: 325
1165901929_1165901940 6 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901940 19:39173279-39173301 AGCCTGCTGGTCTGGCCAGTGGG 0: 1
1: 1
2: 8
3: 29
4: 194
1165901929_1165901945 23 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901945 19:39173296-39173318 AGTGGGGCGAAACTGGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
1165901929_1165901943 16 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901943 19:39173289-39173311 TCTGGCCAGTGGGGCGAAACTGG 0: 1
1: 0
2: 0
3: 4
4: 124
1165901929_1165901941 7 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901941 19:39173280-39173302 GCCTGCTGGTCTGGCCAGTGGGG 0: 1
1: 1
2: 7
3: 31
4: 302
1165901929_1165901933 -2 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901933 19:39173271-39173293 CACCCCCCAGCCTGCTGGTCTGG 0: 1
1: 0
2: 0
3: 38
4: 254
1165901929_1165901946 27 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901946 19:39173300-39173322 GGGCGAAACTGGCAGCTGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 175
1165901929_1165901932 -7 Left 1165901929 19:39173250-39173272 CCTCTCCGGGCCTGATGTCGGCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1165901932 19:39173266-39173288 GTCGGCACCCCCCAGCCTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165901929 Original CRISPR TGCCGACATCAGGCCCGGAG AGG (reversed) Exonic
900913481 1:5618511-5618533 AGCCCACACCAGGCCCCGAGAGG - Intergenic
901466633 1:9425907-9425929 TGAGGACACCAGGCCCAGAGAGG + Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902758166 1:18563071-18563093 TGATGACATCAGGCCAGGCGTGG + Intergenic
914862351 1:151397260-151397282 TGCCCACCTCAGGCCGGGCGCGG - Intergenic
915024127 1:152811427-152811449 TGCCTAGATCAGGGCAGGAGGGG + Intronic
920667750 1:207977539-207977561 TGCCGACATGATGCCACGAGTGG + Intergenic
1063560136 10:7118586-7118608 TGCAGACAGGAGGCCGGGAGAGG - Intergenic
1070598499 10:77849423-77849445 TGCCTTCATCAGGCGTGGAGTGG - Intronic
1073323962 10:102631893-102631915 TGCCGACATCAGGTCCCGAGTGG - Exonic
1078443021 11:11383165-11383187 TGCCCTGAGCAGGCCCGGAGAGG - Intronic
1079121410 11:17687979-17688001 TGCCTCCATCAGGGCCGGAAGGG - Intergenic
1080349755 11:31369866-31369888 GGCCGACAGCAGGCGAGGAGTGG + Exonic
1081733101 11:45385121-45385143 TGTCTACATGAGGCCCGGAGAGG + Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097190529 12:57217253-57217275 AGCCGACTTCAGGCGCGGCGGGG + Intronic
1099688445 12:85919940-85919962 TACTGACATCAGGCCTGGCGCGG - Intergenic
1101341073 12:103841783-103841805 AGCCGACATCAGCCCATGAGTGG - Intronic
1102650867 12:114441513-114441535 TGCCTACTCCAGGCCCAGAGAGG + Intergenic
1104930560 12:132337267-132337289 TGCCCACATCAGGGCTGGCGGGG - Intergenic
1107882014 13:44841017-44841039 TGGCGACATCAGCCCTGGAAAGG + Intergenic
1109268880 13:60232342-60232364 TACCGACATCATGCCCCAAGTGG - Intergenic
1110295498 13:73859422-73859444 TGCCTGCATCAGCCCTGGAGAGG + Intronic
1114077420 14:19168532-19168554 GGCAGACATCAGGCCCCGGGTGG + Intergenic
1118787729 14:69060097-69060119 TGACGTCAACAGGCCCGGAGAGG + Intronic
1129304954 15:74653210-74653232 TGAGGACATGAGGCCCAGAGAGG - Intronic
1132527614 16:425574-425596 TGCTGACGTCAGGCCCGACGGGG + Intergenic
1139017120 16:62703816-62703838 TGGCAACCTCAGGCCGGGAGCGG + Intergenic
1144515977 17:15917770-15917792 TGCCCGCGCCAGGCCCGGAGCGG - Intergenic
1151453396 17:74212700-74212722 TGCCGAACGCAGGCCAGGAGGGG - Intergenic
1151962879 17:77416497-77416519 TGCCGGCAGCAGGCAGGGAGAGG + Intronic
1155037937 18:22041135-22041157 TGCCGGCATCTGGCCAGGTGCGG + Intergenic
1156613673 18:38757264-38757286 TGCCCACGTCAGGCCAGGTGGGG - Intergenic
1158298987 18:56031469-56031491 TGCCCTCATCAGGCCAGGAATGG + Intergenic
1161596615 19:5154057-5154079 TGCCGACTCCAGGCCTGGTGGGG - Intergenic
1164833125 19:31338326-31338348 TGTCCACATCAGGCCTGGTGGGG + Intronic
1165710587 19:38008097-38008119 TGCGGACCTCAGGCCCCCAGAGG + Intronic
1165901929 19:39173250-39173272 TGCCGACATCAGGCCCGGAGAGG - Exonic
931702115 2:64917769-64917791 TGCAGACAACAGGCCAAGAGCGG + Intergenic
935088136 2:99868394-99868416 ATCCAACATCAGGCCGGGAGGGG + Intronic
938298375 2:130192803-130192825 TGACAACATCAGGCCAGGTGTGG + Intronic
938458387 2:131481854-131481876 TGACAACATCAGGCCAGGTGTGG - Intronic
948661432 2:239508932-239508954 TGCCCACCTCAGCCCAGGAGAGG - Intergenic
948690858 2:239703933-239703955 TGCGTACTTCAGGCCAGGAGTGG - Intergenic
948809922 2:240469264-240469286 AGCCGACACCACGCCAGGAGTGG + Intergenic
948822117 2:240555329-240555351 TGCCGCCAGCAGGCCCGGGCTGG - Intronic
1169029465 20:2396477-2396499 AGCAGTCATCAGGCCCGGTGTGG - Intronic
1171133787 20:22678487-22678509 TCCTCCCATCAGGCCCGGAGAGG - Intergenic
1172449115 20:35009296-35009318 TGCAGACATCAGGGCAGGACTGG + Intronic
1173014149 20:39209670-39209692 TGCAGACTTCAGGTCAGGAGTGG + Intergenic
1174048771 20:47752809-47752831 TGCAAACATCAGGCCAGGTGTGG + Intronic
1175400770 20:58698779-58698801 TGGCGTCATCAGGCCGGGGGTGG + Intronic
1175905152 20:62375893-62375915 AGCCGACATCAGGCCGGGCGCGG + Intergenic
1176159466 20:63641092-63641114 TGCAGACACCAGGCCGGGCGCGG - Exonic
1181778974 22:25179063-25179085 TGCAGACACCAGGCCGGGCGCGG - Intronic
1183397644 22:37581648-37581670 TCCCCACATCCTGCCCGGAGTGG - Intronic
950660376 3:14463526-14463548 TGCTGACAGCAGCCCCGCAGGGG - Intronic
954322155 3:49839657-49839679 TGCAGACATCAGGTCCACAGAGG + Intronic
963254824 3:143134419-143134441 TGCAAACATCTGGCCTGGAGTGG + Intergenic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
987193298 5:15500530-15500552 GGCCGACCTCCGGCCTGGAGAGG - Exonic
989133555 5:38130844-38130866 TGCTTCCATCAGGCCAGGAGAGG - Intergenic
992775106 5:80082382-80082404 TGCGGACAACACGGCCGGAGGGG - Intronic
998040963 5:138950855-138950877 AGCCGAGACCAGGCCCCGAGGGG - Intronic
998367030 5:141638212-141638234 TTCCGACATGAGGCCCTGGGGGG - Exonic
1011717997 6:90127275-90127297 TGCAGCCATCAACCCCGGAGCGG - Intronic
1018694778 6:166382882-166382904 TGCCGACACCAGACCCCGAGTGG + Exonic
1018810198 6:167293399-167293421 TGCCGACAATAGGCCCGGGTGGG - Intronic
1021545347 7:21807206-21807228 TCCTGACATCAGGCCAGGTGCGG + Intronic
1034440041 7:151081701-151081723 TGCCGATTTCCAGCCCGGAGGGG + Exonic
1035604248 8:919319-919341 TGCCGACATCAGGCCGCGACGGG + Intergenic
1036184414 8:6611906-6611928 TCCCGACGTCAGGCCGGGCGCGG - Intronic
1036415681 8:8545702-8545724 TGCCTACATCAAGCCCTCAGGGG - Intergenic
1042220943 8:66473426-66473448 TGTCTACATCAGGCCAGGTGTGG - Intronic
1050106652 9:2172815-2172837 AGCCGACATCAGCCCTGCAGTGG + Intronic
1056470892 9:86903618-86903640 TGCTGGCATCAGGTCGGGAGGGG - Intergenic
1056724087 9:89097010-89097032 TGCAGACACCAGGTCAGGAGAGG + Intronic
1060301635 9:122377646-122377668 AGCCCACATCAGGCCCCCAGGGG - Intronic
1185628133 X:1496926-1496948 TGCAAACATCAGGCCGGGCGTGG + Intronic
1198641517 X:138761112-138761134 TGCTGAGATCAGGGCCGGAGAGG - Intronic
1200171584 X:154079901-154079923 TGCCAACAGCAGGCCCAGCGTGG + Intronic