ID: 1165902580

View in Genome Browser
Species Human (GRCh38)
Location 19:39175577-39175599
Sequence TGACTCTGGGCTGCTCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 237}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165902580_1165902584 -7 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902584 19:39175593-39175615 AGAGTCAGGTTCCAGCTCAGTGG 0: 1
1: 0
2: 2
3: 18
4: 231
1165902580_1165902597 30 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902597 19:39175630-39175652 GGGAGGGCACAGGCTGGCGGGGG 0: 1
1: 0
2: 8
3: 87
4: 693
1165902580_1165902588 9 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902588 19:39175609-39175631 TCAGTGGGGACTCTGTGCAGTGG 0: 1
1: 7
2: 125
3: 809
4: 1877
1165902580_1165902596 29 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902596 19:39175629-39175651 TGGGAGGGCACAGGCTGGCGGGG 0: 1
1: 0
2: 4
3: 63
4: 507
1165902580_1165902593 24 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902593 19:39175624-39175646 TGCAGTGGGAGGGCACAGGCTGG 0: 1
1: 1
2: 2
3: 65
4: 587
1165902580_1165902590 13 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902590 19:39175613-39175635 TGGGGACTCTGTGCAGTGGGAGG 0: 1
1: 1
2: 4
3: 51
4: 395
1165902580_1165902594 27 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902594 19:39175627-39175649 AGTGGGAGGGCACAGGCTGGCGG 0: 1
1: 0
2: 6
3: 80
4: 685
1165902580_1165902592 20 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902592 19:39175620-39175642 TCTGTGCAGTGGGAGGGCACAGG 0: 1
1: 0
2: 4
3: 37
4: 359
1165902580_1165902589 10 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902589 19:39175610-39175632 CAGTGGGGACTCTGTGCAGTGGG 0: 1
1: 0
2: 5
3: 41
4: 288
1165902580_1165902591 14 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902591 19:39175614-39175636 GGGGACTCTGTGCAGTGGGAGGG 0: 1
1: 1
2: 2
3: 38
4: 359
1165902580_1165902586 -5 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902586 19:39175595-39175617 AGTCAGGTTCCAGCTCAGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 178
1165902580_1165902595 28 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902595 19:39175628-39175650 GTGGGAGGGCACAGGCTGGCGGG 0: 1
1: 0
2: 5
3: 75
4: 578
1165902580_1165902585 -6 Left 1165902580 19:39175577-39175599 CCTGGTGGAGCAGCCCAGAGTCA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1165902585 19:39175594-39175616 GAGTCAGGTTCCAGCTCAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165902580 Original CRISPR TGACTCTGGGCTGCTCCACC AGG (reversed) Intronic
900130483 1:1085181-1085203 GGTCTCTGGGCAGCCCCACCTGG - Intronic
900325996 1:2108967-2108989 TGACTCAGGGCTGCACCAAGGGG - Intronic
900521689 1:3108661-3108683 TGCCTCTGGGCAGCTGCTCCAGG + Intronic
900572289 1:3364585-3364607 TGACCCTGGGCTCCTGCACGTGG + Intronic
902837832 1:19058245-19058267 TGACGGTTGGCAGCTCCACCCGG + Intergenic
903151885 1:21415513-21415535 TGACTCTGAGTGGCTCCACAAGG - Intergenic
903262511 1:22139050-22139072 TGACTCTGGGAGGCTCCTGCGGG + Intronic
903727560 1:25462118-25462140 TGAGTCCAGGCTGCTCCATCTGG - Intronic
905026199 1:34851587-34851609 TGACTCTGGTCAGCTCCCCAGGG - Intronic
907046502 1:51303171-51303193 GGACTATGGGCTGCTGCAGCTGG - Exonic
907242282 1:53087508-53087530 TGGCCCTGGGCTGCTCCCCTTGG + Exonic
907372854 1:54014296-54014318 TGCCTCTCTGCTGCTCCTCCTGG - Exonic
909727445 1:78852406-78852428 TGACTCTGTGCTGGACAACCTGG - Intergenic
913079983 1:115374867-115374889 TGACCCTGGTCTGCTCCCTCTGG + Intergenic
913096628 1:115523649-115523671 TGACTCAGCTCTGCTCCACATGG + Intergenic
914209483 1:145564530-145564552 TAACTCTGAGCAGCTCCACAAGG - Intergenic
914239828 1:145846039-145846061 GGACCCTGGGCCGCTCCTCCAGG - Exonic
914268401 1:146056898-146056920 TAACTCTGAGCAGCTCCACAAGG - Intergenic
915915452 1:159937838-159937860 TGATTCAGGGCTCCTCCCCCAGG - Exonic
915918168 1:159953692-159953714 TGTCTCTGGGCTGCTGAACCTGG + Intronic
916410521 1:164542697-164542719 TGCCTCTGAGCTGCTCCTCTGGG + Intergenic
918746612 1:188209401-188209423 TAGCTCTGGGCTGGTCCAGCTGG + Intergenic
919785964 1:201259007-201259029 GGACTTTGGGCGCCTCCACCTGG + Intergenic
920648889 1:207822324-207822346 TGACTCTGGGCTACTCCCTGGGG - Intergenic
921074962 1:211693240-211693262 TGACTCTGGGTAGGTCCACACGG - Intergenic
922421835 1:225465692-225465714 GGACTTTGTGCTCCTCCACCAGG + Intergenic
923307495 1:232701654-232701676 TGATGGTGGGCTGCACCACCCGG - Intergenic
923718619 1:236448345-236448367 TGCATGTGGGCTGCTCCTCCTGG + Intronic
1062960258 10:1567925-1567947 TGTCTCTGAGCTGCTCCCGCAGG - Intronic
1067228046 10:44388012-44388034 AGACTCTGTGCCGCTCTACCAGG + Intergenic
1067275183 10:44827727-44827749 CGTCTCTGGGCAGCTCCCCCTGG - Intergenic
1067568191 10:47352994-47353016 TGTCTCTAAGCTGCTCCACTGGG - Intronic
1069686763 10:70323820-70323842 TGGCCCTGGGCTGCTGCACGAGG - Intronic
1070783856 10:79151971-79151993 GCCCCCTGGGCTGCTCCACCAGG + Intronic
1072151564 10:92689274-92689296 GGACTCTTGGCCGCTCCACCTGG - Intergenic
1072903478 10:99430203-99430225 TGTGTCTTGGCTGCTACACCTGG + Intronic
1075314292 10:121439541-121439563 TGACCTGGGGCTCCTCCACCTGG - Intergenic
1076500063 10:130930095-130930117 TGACTCCCGGCAGCTCCAGCAGG + Intergenic
1076783659 10:132738461-132738483 TGCCTCTGGGTGGCTCCTCCCGG - Intronic
1076834348 10:133013670-133013692 AGTCTCTGGGCGGCTCCACACGG - Intergenic
1077997645 11:7467776-7467798 TGACTCTGGGCTGTTGCATATGG - Exonic
1079131148 11:17747597-17747619 TGAAGCTGGGCTGCTCCGCCAGG + Intronic
1083582333 11:63832864-63832886 TGGCTCTGGGCTGAGGCACCTGG - Intergenic
1083800999 11:65046195-65046217 TGATGCTGTGCTGCTCCAGCAGG + Exonic
1083997808 11:66280729-66280751 TGACTCTGGGCAGCGCCACTTGG - Intronic
1084530224 11:69722935-69722957 TGACTCTGTGCTTCTCCTGCTGG + Intergenic
1085668354 11:78437441-78437463 TGACTCTGGGCATCTTCACTAGG - Intronic
1090111317 11:123911827-123911849 TCTCTCTGTGCTGATCCACCTGG - Intergenic
1090263961 11:125342521-125342543 TGGCTCTGCGCTTTTCCACCTGG + Intronic
1090936973 11:131351877-131351899 TGATTCTGGGCTGCTATACCAGG + Intergenic
1091149665 11:133316140-133316162 TGACTCTGGTCTCCTCTTCCTGG - Intronic
1094451489 12:30587227-30587249 TGACTTTGGGCTTAGCCACCTGG - Intergenic
1094870528 12:34596930-34596952 CCACTTTGGGCTGCTCCACGTGG - Intergenic
1096619156 12:52851603-52851625 TCACTGTGGGCTGCTCCATGGGG - Intergenic
1097249451 12:57624582-57624604 TGACTGTGGTCTGCCGCACCCGG + Intronic
1098060440 12:66555185-66555207 TGTCTCTGTGCTGAGCCACCTGG - Intronic
1101585241 12:106080121-106080143 TGACTCTCAGCTGCCCCACTTGG + Intronic
1101838241 12:108310093-108310115 TTTCCCTCGGCTGCTCCACCTGG - Intronic
1103815889 12:123655803-123655825 CGACTCAGGGCTCCTCCAACAGG + Exonic
1104773547 12:131379456-131379478 CGGCTCAGGGCTGCCCCACCAGG + Intergenic
1105468326 13:20668170-20668192 AGACTCTGTGATGCCCCACCGGG - Intronic
1106095411 13:26639032-26639054 TGATTCTGGGCACCTGCACCTGG - Intronic
1107049955 13:36036250-36036272 TGCCTCTGAGCTGCTCCTCTGGG + Intronic
1107287686 13:38814516-38814538 TGTCTCTGTGCTGAGCCACCTGG + Intronic
1108980114 13:56500173-56500195 TGACACTGGGCTGCTTCATTGGG - Intergenic
1111682597 13:91461860-91461882 TGACTCTTGGCAGCCCCATCAGG - Intronic
1111980714 13:95012677-95012699 AAACTCTTGGCTGCTCCACAAGG + Intergenic
1115446226 14:33493382-33493404 TGTCTCTGTGCTGCTCCTCTGGG + Intronic
1116042812 14:39706340-39706362 TGCCTTGGGGCTGCTCCACGAGG - Intergenic
1117723092 14:58646303-58646325 TGACACTGGGCTGCTGCCCCGGG - Exonic
1118813087 14:69289616-69289638 AGACTCCTGGATGCTCCACCAGG + Intronic
1119584865 14:75823751-75823773 TGGGCATGGGCTGCTCCACCTGG + Intronic
1121564778 14:94901176-94901198 GGACTCCTGTCTGCTCCACCAGG - Intergenic
1122156092 14:99751283-99751305 TGACTCAGGGCTACTCCTCCAGG - Intronic
1122453946 14:101835150-101835172 GGACACTGGGCTGCTCCTCATGG + Intronic
1122939659 14:104975557-104975579 TGGCTCTGCCCTGCCCCACCAGG - Intronic
1122992055 14:105241111-105241133 TGACTCTGGCCTGGCCCACCGGG - Intronic
1123971849 15:25514918-25514940 TGGCTCTGCCCTGCTCCAGCAGG + Intergenic
1126657194 15:50991236-50991258 GGACAATGGGCTGCTCCATCCGG - Intronic
1126780294 15:52133906-52133928 GGACTCTCGGCTGCTCCATTTGG - Intronic
1127359473 15:58232236-58232258 TGCTTCTTGGCTGCTCCATCTGG + Intronic
1127771164 15:62232006-62232028 GAACTCTGAGCTGTTCCACCTGG + Intergenic
1128607188 15:69045887-69045909 TGACTGAAGGCTGCTCCCCCTGG - Intronic
1131278097 15:90999232-90999254 TAACTCTGGGCTGCCACAGCAGG - Intronic
1133130826 16:3675221-3675243 TGACTCTGGGCCGCATCCCCTGG + Intronic
1133230764 16:4365499-4365521 TGACTCTGGGCTCCTGGTCCTGG - Exonic
1133363010 16:5188774-5188796 TGGGTCTGGGCTGCCTCACCTGG + Intergenic
1134415076 16:14036332-14036354 TGCCTCTGGGCAGTTCCATCTGG + Intergenic
1134415192 16:14037419-14037441 TGCCTCTGGACAGCTCCATCTGG - Intergenic
1135598902 16:23764867-23764889 GGACTCTGGCCTGCACCAGCTGG + Intergenic
1135770861 16:25217368-25217390 GGACACTGGGCTGCTGCAGCCGG + Exonic
1137749019 16:50844902-50844924 TGACTCTTCTCTGCTCCACAGGG - Intergenic
1141873536 16:86806115-86806137 TGGCTCCGGGCTGAACCACCTGG - Intergenic
1142420355 16:89966137-89966159 GGACTCGGGGCGGCTGCACCTGG + Exonic
1142832995 17:2563154-2563176 TGAATCTGGGCTTGGCCACCGGG + Intergenic
1143492496 17:7292588-7292610 TGACTCTGGGATTCACCTCCAGG - Intronic
1143857585 17:9863686-9863708 TCTCTCTGTGCTGCTCTACCTGG + Intronic
1146660103 17:34659854-34659876 TGGCCCTGGGCAGCTCCTCCTGG + Intergenic
1146907013 17:36624323-36624345 TGACTGTCAGCTGCCCCACCTGG + Intergenic
1147042460 17:37729250-37729272 TCACTCTGGGCTCCTCAACATGG - Intronic
1147673306 17:42189310-42189332 TGACTCAGGGTTGCTGCTCCTGG + Exonic
1149645519 17:58238555-58238577 TGACTCCGGGCAGATACACCAGG - Exonic
1150301384 17:64049916-64049938 TGCCTCTGAGATTCTCCACCAGG + Intronic
1151484150 17:74388004-74388026 TGACTCTGCGCTGCTGCTGCAGG + Intergenic
1151487206 17:74408453-74408475 TGACTCAGGGCTCCTCCACGTGG - Intergenic
1151507669 17:74540189-74540211 TGCCTCAGGGCTCCTCCTCCAGG + Intergenic
1151509220 17:74548016-74548038 TGCCTCAGGGCTCCTCCTCCAGG + Intergenic
1151807439 17:76414857-76414879 TGGCTCTGGGCTTGTCAACCTGG + Intronic
1152305881 17:79519905-79519927 TGCCTCTGCGCTGCTCCCCATGG + Intergenic
1152306881 17:79526274-79526296 TGCCTCTGGGTGGCTCCTCCAGG - Intergenic
1152550391 17:81026917-81026939 TGACACTGGGCTGCTCCACTGGG + Intergenic
1152716742 17:81903940-81903962 GGCCTCTGGGCTGCTCCAGGCGG + Intronic
1153154749 18:2135483-2135505 CGACTCTGGTCTCCTCCCCCAGG + Intergenic
1153225342 18:2895621-2895643 TGCCTCGGTGCTCCTCCACCTGG + Intronic
1153364408 18:4237996-4238018 TGAATTTGGGATGCTCAACCAGG - Intronic
1154020553 18:10660838-10660860 AGACTCTGGGCGGCTCCTCTGGG + Intergenic
1159651436 18:70983571-70983593 TGACTCTGGGCTGCTCCTAGTGG - Intergenic
1160242546 18:77133433-77133455 TGTCTCTGGGCTGCAGGACCAGG - Intronic
1160511210 18:79454536-79454558 TCCCTCTGGGATGCTCCAGCAGG + Intronic
1160526878 18:79543562-79543584 TCACTCTGGGCAGCTGCCCCGGG + Intergenic
1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG + Intronic
1162726792 19:12694798-12694820 TGACTCAGTGCTGCTGCTCCAGG - Exonic
1162906238 19:13825766-13825788 TGACTGTGAGCTGCGCCTCCCGG + Intronic
1163267461 19:16229519-16229541 TGGCACTGACCTGCTCCACCAGG + Intronic
1163434443 19:17286874-17286896 TGAACCTGGGCAACTCCACCTGG + Exonic
1164695654 19:30241678-30241700 GCACTCTGGGCAGCACCACCAGG + Intronic
1164816916 19:31211473-31211495 TGACTGTGGGCTCCTGGACCCGG + Intergenic
1164976052 19:32573567-32573589 TGCTTCTGAGCTGCTCCTCCAGG + Intergenic
1165200757 19:34142463-34142485 TGCCTCTGAGCTGCTCCTCTGGG - Intergenic
1165902580 19:39175577-39175599 TGACTCTGGGCTGCTCCACCAGG - Intronic
1166509245 19:43393310-43393332 TGCCCCTGAGCTGCTCCACGGGG + Intergenic
1167082929 19:47289668-47289690 TGCCTCTGGGCTGCTCTTCTGGG - Intergenic
1167156745 19:47743331-47743353 TGACTCTGGGGCCCTCCCCCCGG + Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168163987 19:54534049-54534071 GGACTCTGGGCAGGTCCATCTGG - Intronic
925022761 2:584911-584933 TGAGAGTGGGCTGCTCCACCAGG + Intergenic
927562603 2:24084431-24084453 TGAGGCTGGGCTGCTCCGCGAGG - Exonic
930882993 2:56293057-56293079 TGACTCTGGTCTTCTCCAGCTGG - Intronic
931233194 2:60391472-60391494 TGACCCTAGAATGCTCCACCAGG - Intergenic
934708587 2:96501412-96501434 TGACTGTGGTCTGCTCCAGGAGG + Intronic
934756419 2:96827780-96827802 TGACACTGGGATGCTTCAACAGG - Exonic
936079329 2:109421643-109421665 TCCCTCTGGGCTTCTCCCCCAGG + Intronic
937815186 2:126243540-126243562 GGACTCAGGACTGCTCCAGCTGG - Intergenic
937853244 2:126654960-126654982 AGACTCAGGGCTTCCCCACCAGG + Intergenic
944427126 2:199594930-199594952 TGGCTCTGGGCTCTGCCACCCGG - Intergenic
946149065 2:217751868-217751890 TGGCTCTGTGCTGCTCCTCTTGG + Intronic
946374923 2:219302287-219302309 AGACTCTGGGCTGCTCTATCTGG - Exonic
948110976 2:235455718-235455740 AACCTCTGGGCTGCTCCACTGGG - Intergenic
948134755 2:235628276-235628298 TGCCTGTGAGCTGCTCCACTTGG + Intronic
1169270981 20:4199247-4199269 TGCCTCTGAGCTGCTCCTCTGGG - Intergenic
1170293200 20:14794023-14794045 TGGCTCTGTGATGCTGCACCTGG - Intronic
1171009847 20:21503281-21503303 TGTCTCAGGGTTGTTCCACCTGG + Intergenic
1171439877 20:25151478-25151500 TGACTCAGGCATGCACCACCAGG - Intergenic
1173183901 20:40824773-40824795 TGACTCTGAGCTTCCCCACAGGG - Intergenic
1173900849 20:46587996-46588018 GGATTCTGGGCTGGGCCACCTGG - Intronic
1174083263 20:47985687-47985709 AGACTCTGGGCTCCTCCAGTGGG + Intergenic
1174174994 20:48638995-48639017 GGACTCTGGGCTGTTCCCTCGGG - Intronic
1175266703 20:57707947-57707969 TGGCTCTGGGCAGGTCCTCCTGG + Intronic
1175936353 20:62515919-62515941 TGGCTCTGCGCCTCTCCACCTGG - Intergenic
1176124303 20:63468642-63468664 TGGCCCTGGGCTGCTTGACCAGG - Intronic
1176293717 21:5059559-5059581 TGGCTCTGGGCTGGCTCACCTGG + Intergenic
1178356458 21:31913617-31913639 TGCCTCTGGCCATCTCCACCTGG - Intronic
1179190297 21:39117345-39117367 TGCCACAGGGCTGCTCCCCCAGG + Intergenic
1179427356 21:41292277-41292299 TGCCTCTGGGCTGCTACTCTAGG - Intergenic
1179863542 21:44204089-44204111 TGGCTCTGGGCTGGCTCACCTGG - Intergenic
1180538948 22:16423559-16423581 TCACTCTCGGCTGCCTCACCGGG - Intergenic
1180786103 22:18548625-18548647 AGGCTGTGGGGTGCTCCACCTGG - Intergenic
1181131385 22:20734350-20734372 AGGCTGTGGGGTGCTCCACCTGG - Intronic
1181243025 22:21488179-21488201 AGGCTGTGGGGTGCTCCACCTGG - Intergenic
1182256622 22:29043658-29043680 TGTCTCTGGCCTCTTCCACCTGG + Intronic
1183466951 22:37984666-37984688 ACACTCAGGGCTCCTCCACCCGG + Intronic
1183703484 22:39463003-39463025 TGTCTCTGGGCTGTTCCTTCTGG - Intronic
950708889 3:14801308-14801330 TGACCCTGGGATGCTGCGCCTGG + Intergenic
952497820 3:33931370-33931392 GGACTGTTGGCTTCTCCACCAGG - Intergenic
954633385 3:52058648-52058670 TGACTCTGGCCTGCCCCTCAGGG - Intergenic
956059869 3:65338640-65338662 TGACTTGGTCCTGCTCCACCTGG + Intergenic
956093194 3:65689585-65689607 TGTCTGTGGGCTTCTCCACTAGG - Intronic
956124159 3:65995701-65995723 TGAGCATGCGCTGCTCCACCGGG + Intronic
960936836 3:122909735-122909757 TGAGTCTGGCCTTCTCCAGCTGG - Exonic
961027146 3:123568337-123568359 TGCCTCTGGACAGCTCCATCTGG + Intronic
961315660 3:126033633-126033655 TGACTCTGTGCTGCTCCTGGGGG + Exonic
965547709 3:169932803-169932825 TGACTCTGGCCTGTGCCGCCTGG + Intronic
967902629 3:194471931-194471953 TGTCACTGGGCTCCTCCTCCAGG - Intronic
968258091 3:197297689-197297711 TGCCTCCGGGCTGCTCCAGCGGG + Intronic
976812357 4:89111086-89111108 TGACTCTGGGCTCCGACACCTGG + Intronic
977615489 4:99083644-99083666 TGGTCCTGGTCTGCTCCACCTGG + Intronic
982178452 4:152728293-152728315 TCCCTCTGGGCTGCTCCTTCGGG - Intronic
982178475 4:152728402-152728424 TCCCTCTGGGCTGCTCCTTCAGG - Intronic
982178489 4:152728457-152728479 TCCCTCTGGGCTGCTCCTTCAGG - Intronic
982178513 4:152728567-152728589 TCCCTCTGGGCTGCTCCTTCAGG - Intronic
982178525 4:152728619-152728641 TCCCTCTGGGCTGCTCCTTCCGG - Intronic
985599757 5:821158-821180 TGGCTCTCTGCTGCTCCCCCCGG + Intronic
985961668 5:3307344-3307366 TGCCTGTGGGCTGCACCACTGGG - Intergenic
986287510 5:6370753-6370775 TGACTATTGGCTGCTGCACGAGG - Intergenic
988688688 5:33550115-33550137 TGAACCTGGGCTGCTGCACAAGG - Intronic
989198314 5:38737691-38737713 TTACTCTTGGCTCCTCCACCTGG - Intergenic
995934786 5:117497404-117497426 TGACTCTTGATTGTTCCACCAGG + Intergenic
998891476 5:146750931-146750953 TGTCTCTCTGCTGCTCCAGCTGG - Intronic
999286895 5:150399530-150399552 TGACAGTTAGCTGCTCCACCTGG + Intronic
999367629 5:151033441-151033463 TGGCTCTGGGCTGCTACCCAGGG - Intronic
1000890936 5:166801195-166801217 TGTCTTTGGGCTGCTCAGCCAGG + Intergenic
1003719127 6:8680872-8680894 TTCCTCTGGGTTGCTGCACCAGG - Intergenic
1004265158 6:14142978-14143000 TGACTGTGGTGTGCTCCAGCTGG + Intergenic
1004556660 6:16705051-16705073 AGACTCTAGGATGCTCCAGCGGG - Intronic
1005801980 6:29435329-29435351 TGACTATGGGATGCTTCACGGGG + Intronic
1006115284 6:31773002-31773024 TGCCTCTCCGCTGCTCCACAAGG + Exonic
1007291604 6:40791416-40791438 TGTCTCTGCCCTGCTCTACCTGG - Intergenic
1009345525 6:62609605-62609627 TTCATCTGGGGTGCTCCACCAGG + Intergenic
1010657200 6:78525646-78525668 TGATTCTGAGATCCTCCACCTGG + Intergenic
1010851388 6:80782101-80782123 TGACTCTGGGTTGATCCAGGTGG + Intergenic
1011033317 6:82945242-82945264 TGTCTCTGTGCTGAGCCACCTGG - Intronic
1011559077 6:88596967-88596989 TGACACAGGGCTGCACCACTCGG - Intergenic
1013357864 6:109362562-109362584 TGGCTCTGGTTTGCTCCACTAGG + Intergenic
1015687162 6:135877532-135877554 TGACCCTGGGCTGCCCCTCAGGG - Intronic
1017093961 6:150787654-150787676 TGGCTCTGGACTGTTCCACAGGG + Intronic
1017834477 6:158164684-158164706 TCACTCTGGCTTCCTCCACCAGG - Intronic
1018908383 6:168088185-168088207 TGCCTCTGGGATGCTCCGGCTGG + Intergenic
1019550672 7:1600914-1600936 GGAATCTTGGCTGGTCCACCAGG - Intergenic
1024048262 7:45600027-45600049 TGAGCCTGGGCTGTTCCATCAGG - Intronic
1029123762 7:98284144-98284166 TGCCTCTGGGCAGCTGCACCAGG + Intronic
1032352050 7:131173761-131173783 TGACTCGGTGCTGCTCCACGAGG + Intronic
1033659953 7:143396328-143396350 TGGCTCTGTGCTGCCCCACATGG + Intronic
1034530775 7:151695114-151695136 TGTCACTGGGCAGCCCCACCAGG - Intronic
1037703557 8:21296604-21296626 TGACTTGGAGCTGCTTCACCTGG + Intergenic
1038193091 8:25341871-25341893 GGAGCCTGGGCTGCTACACCTGG + Intronic
1039433429 8:37543464-37543486 GGCCTCTGGGCTGCTACACCCGG - Intergenic
1040011415 8:42664142-42664164 TGCCTCTGAACTGCTCCTCCAGG + Intergenic
1042130086 8:65579491-65579513 CAACTGTGGGCTGCTGCACCAGG - Intergenic
1044538614 8:93385197-93385219 TGACTCTGGAAGGGTCCACCTGG - Intergenic
1045136768 8:99229306-99229328 TGGCTCTGGGCTTCTCCATGAGG + Intronic
1045264371 8:100606689-100606711 TGACTCTAAGCTGCTACACTGGG - Intronic
1045525816 8:102940518-102940540 TGACTCTGGGCTGTCACAGCTGG - Intronic
1045846722 8:106645664-106645686 TGCCTTTGGGCTGATTCACCTGG + Intronic
1047092856 8:121592599-121592621 TGACTCTGGACTTCTCAGCCTGG + Intergenic
1047785823 8:128153134-128153156 TGACTCAATGCTGCTCCACACGG + Intergenic
1049227281 8:141461568-141461590 TGCCTCTGAGCTGCTCCTCTGGG + Intergenic
1049642057 8:143720258-143720280 TGCCTCTGTGCTGCACCAGCTGG + Exonic
1050056326 9:1659533-1659555 GGTGTCTGGGCTCCTCCACCCGG + Intergenic
1050335570 9:4586836-4586858 TGACTCTTGTCTCCTCCTCCAGG + Exonic
1050606403 9:7305846-7305868 TGACTCTGGACAGCATCACCTGG + Intergenic
1054821002 9:69520587-69520609 TCTCTCTGGGAAGCTCCACCTGG + Intronic
1058595694 9:106613280-106613302 TAACTCTGGGCAGCTCCAACTGG + Intergenic
1058633572 9:107014698-107014720 GGAGTCTGGGTTGCTCCATCTGG + Intergenic
1059418267 9:114175315-114175337 TGACTCTGGGATGATTCACGAGG - Intronic
1059420410 9:114187013-114187035 TGTCTCTGGTCTGGTCCACTTGG + Intronic
1061065548 9:128275670-128275692 TGACTTTGGGCTGGTGCTCCCGG - Intronic
1062046294 9:134425983-134426005 TGACTCTGTGCTGTTCCTTCCGG + Intronic
1062140778 9:134957675-134957697 TGACCCTAGGCTGCCACACCAGG - Intergenic
1062176986 9:135168858-135168880 GGACTCTGTCTTGCTCCACCCGG - Intergenic
1062410102 9:136419263-136419285 TGGGGCTGAGCTGCTCCACCTGG + Intronic
1062496264 9:136833162-136833184 TCGCCCTGGGCTGCCCCACCTGG + Intronic
1062496408 9:136833556-136833578 TCACCCTGGGCTGCCCCAGCTGG + Intronic
1062607439 9:137354501-137354523 TGGCTCTGGGCTGTGGCACCAGG - Intronic
1062667383 9:137682576-137682598 TGACCCTGGGCCTCTTCACCAGG + Intronic
1192159164 X:68769884-68769906 TGGCTCTGGGCTCCTTCCCCTGG + Intergenic
1199485206 X:148339092-148339114 TCTCTCTGTGCTGATCCACCTGG - Intergenic
1201180163 Y:11335216-11335238 TCACTCTTGGCTGCCTCACCGGG - Intergenic
1201313159 Y:12615881-12615903 TAGCTCTAGGCTGCTCCAGCTGG + Intergenic
1202604874 Y:26630488-26630510 TGACTCAGGACTGCACCAGCGGG - Intergenic