ID: 1165904489

View in Genome Browser
Species Human (GRCh38)
Location 19:39185393-39185415
Sequence AAGTCTCCATGGATCACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165904489_1165904499 1 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904499 19:39185417-39185439 GGGTGGAGAGGTGTTGGCTGGGG No data
1165904489_1165904505 25 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904505 19:39185441-39185463 ATGAGATGGGGCAGCAAGCAGGG No data
1165904489_1165904502 12 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904502 19:39185428-39185450 TGTTGGCTGGGGGATGAGATGGG No data
1165904489_1165904498 0 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904498 19:39185416-39185438 GGGGTGGAGAGGTGTTGGCTGGG No data
1165904489_1165904501 11 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904501 19:39185427-39185449 GTGTTGGCTGGGGGATGAGATGG No data
1165904489_1165904500 2 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904500 19:39185418-39185440 GGTGGAGAGGTGTTGGCTGGGGG No data
1165904489_1165904503 13 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904503 19:39185429-39185451 GTTGGCTGGGGGATGAGATGGGG No data
1165904489_1165904504 24 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904504 19:39185440-39185462 GATGAGATGGGGCAGCAAGCAGG No data
1165904489_1165904497 -1 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904497 19:39185415-39185437 TGGGGTGGAGAGGTGTTGGCTGG No data
1165904489_1165904496 -5 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904496 19:39185411-39185433 GACTTGGGGTGGAGAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165904489 Original CRISPR AAGTCTCCATGGATCACCCT AGG (reversed) Intergenic
No off target data available for this crispr