ID: 1165904494

View in Genome Browser
Species Human (GRCh38)
Location 19:39185404-39185426
Sequence CTCTCCACCCCAAGTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165904494_1165904500 -9 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904500 19:39185418-39185440 GGTGGAGAGGTGTTGGCTGGGGG No data
1165904494_1165904504 13 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904504 19:39185440-39185462 GATGAGATGGGGCAGCAAGCAGG No data
1165904494_1165904505 14 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904505 19:39185441-39185463 ATGAGATGGGGCAGCAAGCAGGG No data
1165904494_1165904501 0 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904501 19:39185427-39185449 GTGTTGGCTGGGGGATGAGATGG No data
1165904494_1165904502 1 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904502 19:39185428-39185450 TGTTGGCTGGGGGATGAGATGGG No data
1165904494_1165904506 20 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904506 19:39185447-39185469 TGGGGCAGCAAGCAGGGTCCTGG No data
1165904494_1165904503 2 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904503 19:39185429-39185451 GTTGGCTGGGGGATGAGATGGGG No data
1165904494_1165904499 -10 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904499 19:39185417-39185439 GGGTGGAGAGGTGTTGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165904494 Original CRISPR CTCTCCACCCCAAGTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr