ID: 1165904504

View in Genome Browser
Species Human (GRCh38)
Location 19:39185440-39185462
Sequence GATGAGATGGGGCAGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165904489_1165904504 24 Left 1165904489 19:39185393-39185415 CCTAGGGTGATCCATGGAGACTT No data
Right 1165904504 19:39185440-39185462 GATGAGATGGGGCAGCAAGCAGG No data
1165904494_1165904504 13 Left 1165904494 19:39185404-39185426 CCATGGAGACTTGGGGTGGAGAG No data
Right 1165904504 19:39185440-39185462 GATGAGATGGGGCAGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165904504 Original CRISPR GATGAGATGGGGCAGCAAGC AGG Intergenic
No off target data available for this crispr