ID: 1165907677

View in Genome Browser
Species Human (GRCh38)
Location 19:39203703-39203725
Sequence CTCCCTAGAACCAGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165907677_1165907687 12 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907687 19:39203738-39203760 CTGTTACAGTCGGGAGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 68
1165907677_1165907689 18 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907689 19:39203744-39203766 CAGTCGGGAGCTCAGGGGTGTGG 0: 1
1: 0
2: 6
3: 35
4: 395
1165907677_1165907686 11 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907686 19:39203737-39203759 CCTGTTACAGTCGGGAGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 63
1165907677_1165907683 3 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907683 19:39203729-39203751 TGGTGCTCCCTGTTACAGTCGGG 0: 1
1: 0
2: 1
3: 9
4: 106
1165907677_1165907690 29 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907690 19:39203755-39203777 TCAGGGGTGTGGAGCAGCCTCGG 0: 1
1: 0
2: 6
3: 40
4: 331
1165907677_1165907688 13 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907688 19:39203739-39203761 TGTTACAGTCGGGAGCTCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 97
1165907677_1165907682 2 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907682 19:39203728-39203750 CTGGTGCTCCCTGTTACAGTCGG 0: 1
1: 0
2: 2
3: 12
4: 118
1165907677_1165907691 30 Left 1165907677 19:39203703-39203725 CCTCCAGGACTGGTTCTAGGGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1165907691 19:39203756-39203778 CAGGGGTGTGGAGCAGCCTCGGG 0: 1
1: 0
2: 3
3: 43
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165907677 Original CRISPR CTCCCTAGAACCAGTCCTGG AGG (reversed) Intronic
902633381 1:17719243-17719265 CACCCTAAAAACAGTCCTGTGGG + Intergenic
903326402 1:22571314-22571336 CTCCCCACAACCAATCCTTGAGG + Intronic
906592976 1:47045643-47045665 CCTCCTAAAACCATTCCTGGAGG - Intronic
912501135 1:110122510-110122532 CCCCCAAGAACCCGTGCTGGGGG - Intergenic
913238685 1:116808111-116808133 ATCCCTAGAATTAGTCCTAGTGG + Intergenic
917529622 1:175822969-175822991 CTGCCCAAAACCAGCCCTGGGGG - Intergenic
917959249 1:180129142-180129164 CTCCCGAGAGCCAGGCCTGACGG - Intergenic
920702728 1:208230275-208230297 CTCCCCAGACCCAGTCCTCTCGG + Intronic
921910620 1:220545290-220545312 ATAGCAAGAACCAGTCCTGGAGG + Intronic
922352566 1:224746259-224746281 CTCCCGTGAACCAGTGCTGTTGG - Intergenic
924918313 1:248597789-248597811 CTCCATGGGAGCAGTCCTGGGGG + Intergenic
1066279500 10:33901640-33901662 ATCCCTAGAGCCAGGCATGGTGG + Intergenic
1071194367 10:83140610-83140632 TTTCCTAGAATCTGTCCTGGGGG - Intergenic
1071206887 10:83290295-83290317 CTGCCCAGAACCAATCCTGGAGG - Intergenic
1074599509 10:114899613-114899635 CACCCTTGAACCAATCCTGGTGG + Intronic
1075565710 10:123502312-123502334 CTCCCTGGCTCCAGTCCTGGAGG + Intergenic
1079231461 11:18652576-18652598 CTCCCTATAGCCAGGCATGGTGG - Intergenic
1081808245 11:45901450-45901472 CTCCCTAGCAGCTGGCCTGGGGG - Intronic
1084203436 11:67577204-67577226 GTCCCTGGAGCCAGTCTTGGCGG + Intergenic
1085788014 11:79471942-79471964 CTCCTAAGAACCAGACATGGAGG - Intergenic
1090173331 11:124624320-124624342 CTCCCAAGCACCAATCCTGAAGG - Intronic
1091602901 12:1928713-1928735 CTCTCTGGAAACAGTCCCGGAGG + Intergenic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1096658509 12:53106357-53106379 CTCCCGAGTACCAGTCCTAGTGG + Intronic
1100657346 12:96661047-96661069 CTCCCTAAACCCAGTCCTTTGGG + Intronic
1100784665 12:98066264-98066286 CTCCCCAGAACCAGCCCCAGGGG + Intergenic
1101588136 12:106102870-106102892 CTCCCTAAAACCTGTCCTAAGGG + Intronic
1102860663 12:116333579-116333601 CACCCTCGAGCCAATCCTGGTGG + Intergenic
1102905726 12:116673884-116673906 CTCCCTAGAACCAGTGAAGCAGG - Intergenic
1104946521 12:132417129-132417151 CAACCTGGAACCAGGCCTGGTGG + Intergenic
1108675567 13:52735081-52735103 ATCACAAGAACCACTCCTGGGGG + Intronic
1115814947 14:37153571-37153593 CTTTCTAGCCCCAGTCCTGGGGG - Intronic
1121628845 14:95408135-95408157 CTCCTCAGAACCCATCCTGGAGG - Intronic
1124076799 15:26453920-26453942 CTCCCTTGAACCACTCCATGTGG - Intergenic
1124707958 15:31981216-31981238 ATCCATAGAACTTGTCCTGGTGG + Intergenic
1125055973 15:35359244-35359266 CTGCCTAGAAACAGTCTGGGGGG - Intronic
1128928964 15:71686637-71686659 GTCCCTAGACCCATTCTTGGGGG + Intronic
1129702549 15:77776064-77776086 CTCCCTGGAAACAGCCGTGGTGG - Intronic
1133662047 16:7927706-7927728 CTCCCTAGAATCCTGCCTGGAGG + Intergenic
1139305533 16:65982745-65982767 CTCCCCAAAACCAATCATGGTGG + Intergenic
1139937653 16:70582979-70583001 CTCCCTACATCCAGCCCTGCAGG - Intronic
1141867583 16:86761292-86761314 CTCCCGAGATCAACTCCTGGTGG + Intergenic
1142227404 16:88884324-88884346 CTCCCTGCAGCCTGTCCTGGGGG + Intronic
1143459742 17:7094599-7094621 CTCCCTTGACCCAGCCCTTGAGG - Intergenic
1144341699 17:14315458-14315480 CTCCCCACAAACTGTCCTGGAGG - Intronic
1145746841 17:27326207-27326229 CTCTCTAGCTCCAGACCTGGAGG + Intergenic
1145991159 17:29080270-29080292 CTACCTGGACCCAGACCTGGAGG - Intronic
1146504687 17:33394737-33394759 CTGCCTAGAAACATTCCTGGGGG + Intronic
1147187205 17:38719509-38719531 CTTCCAAGAGCCAGACCTGGAGG + Exonic
1151572752 17:74935477-74935499 CTACCTAGCCCCAGGCCTGGAGG - Intergenic
1156500405 18:37554044-37554066 CTACCTAGAGCCAGGCCTTGTGG + Intronic
1156703261 18:39849967-39849989 TTTCCTAGAATCAGTGCTGGAGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1159106136 18:64003229-64003251 CTCTCTAAAATCAGTCCCGGTGG - Intronic
1159505979 18:69336283-69336305 CTGACTAAAACCAGTCCTGATGG - Intergenic
1160944143 19:1633373-1633395 TTCCCGAGAGCCAGGCCTGGGGG + Intronic
1162133159 19:8539766-8539788 CTCCCTAAACCCAGAGCTGGAGG + Intronic
1162926143 19:13931404-13931426 CTCCCCACAACCAGTCCAGCTGG - Intronic
1164961482 19:32434769-32434791 CTCCCTAGAACCTGACCATGTGG - Intronic
1165024144 19:32947338-32947360 CTCCCTAGTCCCAGTGCTTGGGG - Intronic
1165698488 19:37919394-37919416 ATCCTTAGAACCACTCCTTGGGG + Intronic
1165907677 19:39203703-39203725 CTCCCTAGAACCAGTCCTGGAGG - Intronic
1166862500 19:45818336-45818358 CTCCCTTGAACCAAGCCTGCAGG - Intronic
1166940140 19:46357850-46357872 CTCCCTGGACCCAGTCCTTTCGG + Intronic
925853982 2:8111711-8111733 CTCACCAGAACCAGTCCATGCGG - Intergenic
928163411 2:28950732-28950754 CTGCCCAGGACCAGGCCTGGGGG - Intergenic
928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG + Exonic
929069845 2:38019280-38019302 CTACCAAGAAACACTCCTGGTGG + Intronic
940208009 2:151225583-151225605 CACCTCAGAACCAGTCCTTGCGG + Intergenic
940304925 2:152215309-152215331 ATCCCTACATCCAGTCCTGGTGG - Intergenic
942912629 2:181264308-181264330 CTTTCTAGGAGCAGTCCTGGGGG + Intergenic
948859787 2:240747201-240747223 CTCCCGAGTCCCAGACCTGGAGG - Intronic
1169025978 20:2371932-2371954 CTCCCTAGATGCAATCCTGGAGG - Intergenic
1175302753 20:57954420-57954442 CTTTCTAGGACCAGTCCTGGAGG + Intergenic
1175535475 20:59708057-59708079 ATCCCCTGAACCAGTCATGGTGG + Intronic
1176213982 20:63939586-63939608 CTCCCTAGGTCCAGGCCAGGTGG + Intergenic
1184429707 22:44434766-44434788 CTCCCCAAACCCAGTCCTGTTGG - Intergenic
1184644041 22:45886471-45886493 CTCCCGAGAACCTGACGTGGAGG - Intergenic
953461316 3:43083403-43083425 TTCCCAGGCACCAGTCCTGGAGG + Intronic
953903910 3:46858722-46858744 CTCCCTAGAAGCAGTCCCTTGGG + Intronic
954810446 3:53243980-53244002 CTCCCTGGAACCCCTTCTGGTGG - Intronic
955335268 3:58080326-58080348 CTCCTTAGCACCATTACTGGAGG + Intronic
961023363 3:123529602-123529624 CTCCCTAGAACTGGTACTAGAGG - Intronic
962319603 3:134379282-134379304 CTCCCTAGGAGTAATCCTGGAGG + Intergenic
966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG + Intronic
968573765 4:1355541-1355563 CTCCCTAGAAGGAGTCACGGGGG - Intronic
969244603 4:5924385-5924407 CTCCCCACATCCAGCCCTGGAGG + Intronic
969273161 4:6116562-6116584 CTCCCGCAAACCAGTCCTGTTGG + Intronic
969808290 4:9627712-9627734 CTACCTAGACAGAGTCCTGGGGG + Intergenic
972869253 4:43276314-43276336 CTCCCTCTAACCAGTTCTGTAGG + Intergenic
976388171 4:84483283-84483305 CTCCCGGGAACTTGTCCTGGGGG + Intergenic
984397174 4:179216845-179216867 CTCCTTAGAAACCGTCCTGATGG + Intergenic
989085054 5:37667017-37667039 CCCTCTAGATCCAGTCATGGGGG - Intronic
992408909 5:76485754-76485776 CTCCCTAGAGCCACACCTGGGGG - Intronic
992654586 5:78895919-78895941 TACACTAGATCCAGTCCTGGGGG - Intronic
992790504 5:80209322-80209344 CTTCTTAGAAGCAGTCCTGTTGG - Intronic
993809290 5:92455942-92455964 CACTCTTGAAACAGTCCTGGTGG + Intergenic
995837105 5:116409945-116409967 CTCCCTACAACCATAGCTGGAGG + Intronic
997607046 5:135182687-135182709 CCCCCTTGAGCCAGGCCTGGGGG - Intronic
1001716991 5:173824452-173824474 CTCCCTGTAAACAGTCCAGGGGG - Intergenic
1006539500 6:34728065-34728087 CTCCCTAGAACCAGTAGAGAGGG + Intergenic
1007693763 6:43718878-43718900 CTCACTACAATCATTCCTGGGGG + Intergenic
1010777248 6:79901426-79901448 CTCCCAAGTACCAGTCAAGGGGG + Intergenic
1019523501 7:1470764-1470786 CTCCCAAGAGCCAGCCCTCGGGG + Intronic
1019660850 7:2223304-2223326 CTCCCTAAGGCCAGTCGTGGGGG - Intronic
1021842316 7:24730886-24730908 CTCCCAAGAACAAGTATTGGAGG + Intronic
1022827669 7:34032848-34032870 CTCTCTAGAATCAGTCCTGCTGG - Intronic
1023703467 7:42914916-42914938 TTCCTGAAAACCAGTCCTGGTGG - Intronic
1025851637 7:65249362-65249384 TTTCCTAGAACCAGTCTTGTTGG - Intergenic
1028473964 7:91233938-91233960 ATTGCTAGAACCAGTCCTGTGGG + Intergenic
1029456715 7:100675499-100675521 CTCCCCAGAACCGGCCCGGGTGG - Intronic
1032541384 7:132705854-132705876 TTCACTAGTACCAGTACTGGAGG + Intronic
1035048251 7:155983258-155983280 CTCCCTGGGGTCAGTCCTGGAGG + Intergenic
1037834413 8:22207660-22207682 GTCCTGAGAACCAGGCCTGGGGG + Intronic
1038336947 8:26653159-26653181 CTCTCTAGAAACCCTCCTGGAGG - Intronic
1039501523 8:38021550-38021572 CTTCCTGGGACCATTCCTGGGGG + Intergenic
1041247344 8:55901502-55901524 CTCCCTGGAACTACTTCTGGTGG + Intronic
1042059220 8:64798924-64798946 TTCCCAAGAACCAGCCCTGAAGG + Intergenic
1047803438 8:128333568-128333590 CACCCTAGTGCCAGTCCTGTTGG - Intergenic
1056716843 9:89038251-89038273 CTCTCAAGAACCAGCCCTTGGGG - Exonic
1060303689 9:122391963-122391985 TTCCCTAGACCCAGTCCCTGAGG + Intronic
1187588435 X:20689747-20689769 CCCCCTTGAACCAGTGGTGGTGG - Intergenic
1187657513 X:21494554-21494576 CTCCCTAGTGCCAGTCTTGGCGG - Intronic
1187662045 X:21559324-21559346 CTCCCTAGTGCCAGTCTTGGTGG - Intronic
1187741881 X:22365171-22365193 CTCCCTAGACCCCCTCCTAGTGG + Intergenic
1189245682 X:39561560-39561582 GTCCCCAGAACCAGGCCTGGAGG + Intergenic
1195100990 X:101553391-101553413 GGCCCTAGATCCACTCCTGGTGG - Exonic
1197102109 X:122668592-122668614 CTCCCTAGACCCTGTCCTTTTGG - Intergenic
1197562951 X:128047149-128047171 CTCCACAGAACCAGTCCAGAAGG - Intergenic
1199191275 X:144974317-144974339 CTCCCTACTACTAGTCGTGGCGG + Intergenic