ID: 1165908998

View in Genome Browser
Species Human (GRCh38)
Location 19:39212428-39212450
Sequence TCCAGGAGCCCCTGCGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165908989_1165908998 27 Left 1165908989 19:39212378-39212400 CCGGTGAAGGAAGCTGGATCTGA No data
Right 1165908998 19:39212428-39212450 TCCAGGAGCCCCTGCGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165908998 Original CRISPR TCCAGGAGCCCCTGCGGGTG GGG Intergenic
No off target data available for this crispr