ID: 1165914011

View in Genome Browser
Species Human (GRCh38)
Location 19:39247163-39247185
Sequence GCCTGCTCACGTGGGAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165914011_1165914016 1 Left 1165914011 19:39247163-39247185 CCGGAGCTCCCACGTGAGCAGGC No data
Right 1165914016 19:39247187-39247209 CAGGAGGTTGAAGACCACGCTGG No data
1165914011_1165914020 27 Left 1165914011 19:39247163-39247185 CCGGAGCTCCCACGTGAGCAGGC No data
Right 1165914020 19:39247213-39247235 TGCGGCACCGAGGCGAGTCCTGG No data
1165914011_1165914019 17 Left 1165914011 19:39247163-39247185 CCGGAGCTCCCACGTGAGCAGGC No data
Right 1165914019 19:39247203-39247225 ACGCTGGCTTTGCGGCACCGAGG No data
1165914011_1165914017 9 Left 1165914011 19:39247163-39247185 CCGGAGCTCCCACGTGAGCAGGC No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165914011 Original CRISPR GCCTGCTCACGTGGGAGCTC CGG (reversed) Intergenic