ID: 1165914017

View in Genome Browser
Species Human (GRCh38)
Location 19:39247195-39247217
Sequence TGAAGACCACGCTGGCTTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165914015_1165914017 0 Left 1165914015 19:39247172-39247194 CCACGTGAGCAGGCGCAGGAGGT No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data
1165914008_1165914017 26 Left 1165914008 19:39247146-39247168 CCAGAGTGTGCAGCCAGCCGGAG No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data
1165914007_1165914017 27 Left 1165914007 19:39247145-39247167 CCCAGAGTGTGCAGCCAGCCGGA No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data
1165914013_1165914017 1 Left 1165914013 19:39247171-39247193 CCCACGTGAGCAGGCGCAGGAGG No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data
1165914009_1165914017 13 Left 1165914009 19:39247159-39247181 CCAGCCGGAGCTCCCACGTGAGC No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data
1165914011_1165914017 9 Left 1165914011 19:39247163-39247185 CCGGAGCTCCCACGTGAGCAGGC No data
Right 1165914017 19:39247195-39247217 TGAAGACCACGCTGGCTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165914017 Original CRISPR TGAAGACCACGCTGGCTTTG CGG Intergenic