ID: 1165914019

View in Genome Browser
Species Human (GRCh38)
Location 19:39247203-39247225
Sequence ACGCTGGCTTTGCGGCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165914015_1165914019 8 Left 1165914015 19:39247172-39247194 CCACGTGAGCAGGCGCAGGAGGT No data
Right 1165914019 19:39247203-39247225 ACGCTGGCTTTGCGGCACCGAGG No data
1165914011_1165914019 17 Left 1165914011 19:39247163-39247185 CCGGAGCTCCCACGTGAGCAGGC No data
Right 1165914019 19:39247203-39247225 ACGCTGGCTTTGCGGCACCGAGG No data
1165914013_1165914019 9 Left 1165914013 19:39247171-39247193 CCCACGTGAGCAGGCGCAGGAGG No data
Right 1165914019 19:39247203-39247225 ACGCTGGCTTTGCGGCACCGAGG No data
1165914009_1165914019 21 Left 1165914009 19:39247159-39247181 CCAGCCGGAGCTCCCACGTGAGC No data
Right 1165914019 19:39247203-39247225 ACGCTGGCTTTGCGGCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165914019 Original CRISPR ACGCTGGCTTTGCGGCACCG AGG Intergenic