ID: 1165914507

View in Genome Browser
Species Human (GRCh38)
Location 19:39249375-39249397
Sequence GCTACTATGGAGAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165914507_1165914515 -7 Left 1165914507 19:39249375-39249397 CCCACCTCATTCTCCATAGTAGC No data
Right 1165914515 19:39249391-39249413 TAGTAGCTGGGACTACCGGTGGG No data
1165914507_1165914514 -8 Left 1165914507 19:39249375-39249397 CCCACCTCATTCTCCATAGTAGC No data
Right 1165914514 19:39249390-39249412 ATAGTAGCTGGGACTACCGGTGG No data
1165914507_1165914519 22 Left 1165914507 19:39249375-39249397 CCCACCTCATTCTCCATAGTAGC No data
Right 1165914519 19:39249420-39249442 CACCATTTTTTGTAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165914507 Original CRISPR GCTACTATGGAGAATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr